TPM4--ALK

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

TPM4 ALK

COSMIC

The fusion gene pair TPM4--ALK information is available in COSMIC database.

Link
TPM4--ALK

ChimerKB

Top
The fusion gene pair TPM4--ALK information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
TPM4_ALK-/905/ -/4080/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
TPM4_ALK-/-/ -/-/ - hg19 inflammatory myofibroblastic tumour - 10934142 Oncogene; Cosmic_nonrecurrent
TPM4_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 11493472 Oncogene; Cosmic_nonrecurrent
TPM4_ALK-/-/ -/-/ - hg19 inflammatory myofibroblastic tumour - 12787312 Oncogene; Cosmic_nonrecurrent
TPM4_ALK-/-/ -/-/ - hg19 inflammatory myofibroblastic tumour - 16984614 Oncogene; Cosmic_nonrecurrent
TPM4_ALK-/0/ -/0/ Exonic hg18 - - - Oncogene; TICdb

ChimerPUB

Top
The fusion gene pair TPM4--ALK information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
TPM4_ALKt(2;5)(p23;q35) / t(2;5) / t(2;5) / t(2;19)(p23;p13) / inv(2) / 15080301anaplastic large cell lymphoma;lymphoma FISH - Among 6 variant gene rearrangements, 1 had TPM4-ALK/t(2;19)(p23;p13) and 2 had inv(2) with the breakpoint proximate to ATIC-ALK and an unknown partner gene separately.
TPM4_ALK- 25300797osteosarcoma FISH;PCR;RT-PCR - The identification of fusion genes such as SYT-SSX1/SSX2, PAX3-FOXO1, TPM3/TPM4-ALK and EWS-FLI1 in human sarcomas has provided important insight into the diagnosis and targeted therapy of sarcomas.
TPM4_ALK- 10934142- - - We have cloned two ALK fusion genes, TPM4-ALK and TPM3-ALK, which encode approximately 95-kd fusion oncoproteins characterized by constitutive kinase activity and tyrosylphosphorylation. /// TPM3-ALK and TPM4-ALK oncogenes in inflammatory myofibroblastic tumors..
TPM4_ALK- 12787312- - - Six cases showed immunohistochemical expression of the ALK protein, and two ALK-positive lesions examined by reverse transcription-polymerase chain reaction and a subsequent sequencing analysis harbored the TPM4-ALK fusion gene.
TPM4_ALK- 17694547non Hodgkin lymphoma;breast cancer;anaplastic large cell lymphoma;neuroblastoma;sarcoma;lymphoma - - In addition, two recent reports have suggested that the ALK fusion, TPM4-ALK, may be involved in the genesis of a subset of esophageal squamous cell carcinomas. /// "In addition, two recent reports have suggested that the ALK fusion, TPM4-ALK, may be involved in the genesis of a subset of esophageal squamous cell carcinomas. "

ChimerSEQ

Top
The fusion gene pair TPM4--ALK information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
TPM4_ALKchr19/16204563/ chr2/29445257/ 19p13.12 2p23.2 Exonic hg19 - Inter-chr NA AF310722 Oncogene; ChiTaRs
TPM4_ALKchr19/16204563/ chr2/29445265/ 19p13.12 2p23.2 Exonic hg19 - Inter-chr NA AF186110 Oncogene; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair TPM4--ALK information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF310722TPM4--ALK TPM419 16187370 16204563 + 1 670 100 ALK2 29445257 29446402 - 662 966 99.7
Human AF186110TPM4--ALK TPM419 16191823 16204563 + 1 595 100 ALK2 29445265 29446402 - 587 883 99.7

FARE-CAFE

Top
The fusion gene pair TPM4--ALK information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
TPM4-ALK Extramedullary hematologic malignancy FISH,G-Banding,RT-PCR t(2;19)(p23;p13.1) PubMed:11493472

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
TPM4-ALK TPM4-ALK-Isoform1 TPM4 16204563 0 1 ALK 29446290 0 1 AAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACA _ AF186110
TPM4-ALK TPM4-ALK-Isoform2 TPM4 16204563 0 1 ALK _ 0 _ TGAAGAAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGA _ AF310722
TPM4-ALK TPM4-ALK-Isoform3 TPM4 _ _ 1 ALK 29446307 0 1 CTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGTGTACCTCCGGAAGCACCAAGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCCTCGAC _ AF362887

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
TPM4-ALK TPM4-ALK-Isoform1 1) Tropomyosin
1) Actin , Myosin_head , Tropomyosin , Troponin
1) MAM
2) Gly_rich
1) ig , Astacin , MATH
TPM4 1) Tropomyosin
1) Actin , Myosin_head , Tropomyosin , Troponin
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
- -
TPM4-ALK TPM4-ALK-Isoform2 1) Tropomyosin
1) Actin , Myosin_head , Tropomyosin , Troponin
- -TPM4 1) Tropomyosin
1) Actin , Myosin_head , Tropomyosin , Troponin
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
TPM4-ALK TPM4-ALK-Isoform3 - - 1) MAM
2) Gly_rich
1) ig , Astacin , MATH
TPM4 1) Tropomyosin
1) Actin , Myosin_head , Tropomyosin , Troponin
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) Tropomyosin
1) Actin , Myosin_head , Tropomyosin , Troponin

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
TPM4-ALK hsa-miR-132-3p hsa-miR-1hsa-miR-215-5phsa-miR-192-5phsa-miR-940hsa-miR-125a-5phsa-miR-28-5phsa-let-7b-5p Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
TPM4-ALK NM_001145160.1 - 1) TRIM28_HUMAN
2) MITF_HUMAN
3) STAT1_HUMAN
4) RBL2_HUMAN
5) P53_HUMAN
6) RUNX1_HUMAN
7) PRDM14_HUMAN
8) ESTROGEN RECEPTOR ALPHA_HUMAN
9) EGR1_HUMAN
10) FOS_HUMAN
11) GATA3_HUMAN
12) E2F1_HUMAN
13) SOX2_HUMAN
14) CTCF_HUMAN
15) BRG1_HUMAN
16) HNF4A_HUMAN
17) TFAP2C_HUMAN
18) FOXA1_HUMAN
19) ESR1_HUMAN
20) NR1H3_HUMAN
21) SETDB1_HUMAN
-

TicDB

Top
The fusion gene pair TPM4--ALK information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
TPM4 ALK AF186110 AAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACA
TPM4 ALK AF310722 TGAAGAAGAAATTAAACTTCTGTCTGACAAACTGAAAGAGGCTGAGACCCGTGCTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGA
TPM4 ALK AF362887 CTGAATTTGCAGAGAGAACGGTTGCAAAACTGGAAAAGACAATTGATGACCTGGAAGTGTACCTCCGGAAGCACCAAGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCCTCGAC

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair TPM4--ALK information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair TPM4--ALK information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair TPM4--ALK information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene TPM4--ALK has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene TPM4--ALK is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene TPM4--ALK is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene TPM4--ALK is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene TPM4--ALK was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair TPM4--ALK information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene TPM4--ALK is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene TPM4--ALK has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene TPM4 is not a known oncogene according to ONGENE database.


The tail gene ALK is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene TPM4 is cancer associated according to Bushman Cancer Gene database.


The tail gene ALK is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene TPM4 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ALK is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene TPM4--ALK is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene TPM4--ALK is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair TPM4--ALK information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene TPM4--ALK is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene TPM4--ALK has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair TPM4--ALK information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair TPM4--ALK information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair TPM4--ALK is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
TPM4--ALKThe pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7

Cortex_Dataset

Top
Fusion gene TPM4--ALK is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair TPM4--ALK information is not available in ChromothripsisDB database.