TMPRSS2--ETV5

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

TMPRSS2 ETV5

COSMIC

The fusion gene pair TMPRSS2--ETV5 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair TMPRSS2--ETV5 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
TMPRSS2_ETV5-/-/ -/-/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ETV5-/-/ -/-/ - hg19 prostate cancer - 18172298 - Cosmic_nonrecurrent

ChimerPUB

Top
The fusion gene pair TMPRSS2--ETV5 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
TMPRSS2_ETV5- 18172298prostate cancer FISH;PCR - Characterization of TMPRSS2:ETV5 and SLC45A3:ETV5 gene fusions in prostate cancer.. /// Characterization of two cases with ETV5 outlier expression by RNA ligase-mediated rapid amplification of cDNA ends identified one case with a TMPRSS2:ETV5 fusion and one case with a SLC45A3:ETV5 fusion.

ChimerSEQ

Top
The fusion gene pair TMPRSS2--ETV5 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
TMPRSS2_ETV5chr21/42880007/- chr3/185823731/- 21q22.3 3q27.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-KK-A7AZ-01A - FusionScan
TMPRSS2_ETV5chr21/42879876/- chr3/185823731/- 21q22.3 3q27.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-ZG-A9L5-01A - FusionScan
TMPRSS2_ETV5chr21/42861433/- chr3/185823731/- 21q22.3 3q27.2 Exonic hg19 CDS-5'UTR Inter-chr PRAD TCGA-KK-A7AZ-01A - FusionScan
TMPRSS2_ETV5chr21/42880007/- chr3/185823731/- 21q22.3 3q27.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-ZG-A9L5-01A - FusionScan
TMPRSS2_ETV5chr21/42866282/- chr3/185823731/- 21q22.3 3q27.2 Exonic hg19 CDS-5'UTR Inter-chr PRAD TCGA-ZG-A9L5-01A - FusionScan
TMPRSS2_ETV5chr21/42870045/- chr3/185823731/- 21q22.3 3q27.2 Exonic hg19 CDS-5'UTR Inter-chr PRAD TCGA-ZG-A9L5-01A - FusionScan
TMPRSS2_ETV5chr21/42866282/- chr3/185823730/- 21q22.3 3q27.2 Exonic hg19 CDS-5'UTR Inter-chr PRAD TCGA-ZG-A9L5-01A - TopHat-Fusion
TMPRSS2_ETV5chr21/42880007/- chr3/185823730/- 21q22.3 3q27.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-ZG-A9L5-01A - TopHat-Fusion
TMPRSS2_ETV5chr21/42861433/- chr3/185823730/- 21q22.3 3q27.2 Exonic hg19 CDS-5'UTR Inter-chr PRAD TCGA-KK-A7AZ-01A - TopHat-Fusion
TMPRSS2_ETV5chr21/42880007/- chr3/185823730/- 21q22.3 3q27.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-KK-A7AZ-01A - TopHat-Fusion
TMPRSS2_ETV5chr21/42880083/ chr3/185798922/ 21q22.3 3q27.2 Exonic hg19 - Inter-chr prostate cancer EU314929 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair TMPRSS2--ETV5 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human EU314929TMPRSS2--ETV5 TMPRSS221 42880007 42880083 - 1 77 100 ETV53 185798922 185823734 - 74 425 100

FARE-CAFE

Top
The fusion gene pair TMPRSS2--ETV5 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
TMPRSS2-ETV5 Prostate cancer qPCR,RT-PCR,RACE,PCR,FISH,DNA sequencing PubMed:18172298

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
TMPRSS2-ETV5 TMPRSS2-ETV5-Isoform1 TMPRSS2 _ _ 0 ETV5 _ 0 _ agtgtgcacctcaaGaggatcccttttcccc 18172298 _
TMPRSS2-ETV5 TMPRSS2-ETV5-Isoform2 TMPRSS2 _ _ 0 ETV5 185823710 0 0 ccgcctggagcgcggcagGaggatcccttttcccccagaa 18172298 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
TMPRSS2-ETV5 TMPRSS2-ETV5-Isoform1 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ETV5 1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) ETS_PEA3_N
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ETV5 TMPRSS2-ETV5-Isoform2 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ETV5 1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) ETS_PEA3_N
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SRF-TF , Ank_2 , PAX , Ets

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
TMPRSS2-ETV5 hsa-miR-335-5p _ Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
TMPRSS2-ETV5 NM_001135099.1 - 1) MITF_HUMAN
2) STAT1_HUMAN
3) RBL2_HUMAN
4) RUNX1_HUMAN
5) FOS_HUMAN
6) GATA3_HUMAN
7) SOX2_HUMAN
8) TAL1_HUMAN
9) CTCF_HUMAN
10) BRG1_HUMAN
11) HNF4A_HUMAN
12) TFAP2C_HUMAN
13) CEBPA_HUMAN
14) SETDB1_HUMAN
15) TAL1_HUMAN
16) TRIM24_HUMAN
-

TicDB

Top
The fusion gene pair TMPRSS2--ETV5 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
TMPRSS2 ETV5 18172298 agtgtgcacctcaaGaggatcccttttcccc
TMPRSS2 ETV5 18172298 ccgcctggagcgcggcagGaggatcccttttcccccagaa

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair TMPRSS2--ETV5 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
PRAD KK-A7AZ-01A TMPRSS2__ETV5 0.14 21:42861434/-1 3:185823731/-1 tier1 CDS-5UTR 18274 NA
PRAD ZG-A9L5-01A TMPRSS2__ETV5 0.14 21:42866283/-1 3:185823731/-1 tier1 CDS-5UTR 18275 NA

FusionCancer

Top
The fusion gene pair TMPRSS2--ETV5 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair TMPRSS2--ETV5 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene TMPRSS2--ETV5 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene TMPRSS2--ETV5 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene TMPRSS2--ETV5 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene TMPRSS2--ETV5 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene TMPRSS2--ETV5 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair TMPRSS2--ETV5 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene TMPRSS2--ETV5 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene TMPRSS2--ETV5 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene TMPRSS2 is a known oncogene according to ONGENE database.
The tail gene ETV5 is not a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene TMPRSS2 is cancer associated according to Bushman Cancer Gene database.


The tail gene ETV5 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene TMPRSS2 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.
The tail gene ETV5 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene TMPRSS2--ETV5 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene TMPRSS2--ETV5 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair TMPRSS2--ETV5 information is available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

5'Gene5'Chr5'Coordinate3'Gene3'Chr3'Coordinate# Spanning ReadsSPLICE JUNCTION?IN-FRAME?JUNCTION SEQUENCECASE NUMBERCAISISLibrary
TMPRSS22142880008ETV53185823731491YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAGGATCCCTTTTCCCCCAGAAATTACTCAATGCTGAAACCTCTCAAAGT 809115047SI_5942
TMPRSS22142879877ETV5318582373131YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAGGATCCCTTTTCCCCCAGAAATTACTCAATGCTGAAACCTCTCAAAGT 809115047SI_5942

Pancreases_Dataset

Top
Fusion gene TMPRSS2--ETV5 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene TMPRSS2--ETV5 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair TMPRSS2--ETV5 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair TMPRSS2--ETV5 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair TMPRSS2--ETV5 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene TMPRSS2--ETV5 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair TMPRSS2--ETV5 information is not available in ChromothripsisDB database.