TMPRSS2--ETV4

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

TMPRSS2 ETV4

COSMIC

The fusion gene pair TMPRSS2--ETV4 information is available in COSMIC database.

Link
TMPRSS2--ETV4

ChimerKB

Top
The fusion gene pair TMPRSS2--ETV4 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
TMPRSS2_ETV4-/-/ -/-/ - hg19 prostate cancers - 17079440 - Cosmic_nonrecurrent
TMPRSS2_ETV4-/-/ -/-/ - hg19 prostate cancers - 16585160 - Cosmic_nonrecurrent
TMPRSS2_ETV4-/-/ -/-/ - hg19 prostate cancer - 18794152 - Cosmic_nonrecurrent
TMPRSS2_ETV4-/-/ -/-/ - hg19 prostate cancer - 20616363 - Cosmic_nonrecurrent
TMPRSS2_ETV4-/-/ -/-/ - hg19 hyperplasia - 20616363 - Cosmic_nonrecurrent
TMPRSS2_ETV4-/-/ -/-/ - hg19 prostate cancer - 18483239 - Cosmic_nonrecurrent

ChimerPUB

Top
The fusion gene pair TMPRSS2--ETV4 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
TMPRSS2_ETV4- 16585160prostate cancer FISH;PCR - TMPRSS2:ETV4 gene fusions define a third molecular subtype of prostate cancer..
TMPRSS2_ETV4- 23244085prostate cancer FISH - Among the patients with the fusion gene, 46 (83.6%) patients had the TMPRSS2:ERG fusion product, 8 (14.8%) patients had TMPRSS2:ETV1 fusion, 1 (1.6%) patient had TMPRSS2:ETV4..
TMPRSS2_ETV4- 24815454prostate cancer FISH - TMPRSS2:ERG, TMPRSS2:ETV1 and TMPRSS2:ETV4 fusions were tested by multi-probe fluorescence in situ hybridization (FISH) assay. /// "We evaluated TMPRSS2:ERG, TMPRSS2:ETV1 and TMPRSS2:ETV4 fusions in more than 100 Eastern Chinese prostate cancer patients. " /// Neither TMPRSS2:ETV1 nor TMPRSS2:ETV4 fusion was found in any case. /// They also lack TMPRSS2:ETV1 and TMPRSS2:ETV4 fusion.
TMPRSS2_ETV4- 20616363prostate cancer FISH - Fluorescently labeled probes specific for ERG-related rearrangements involving the TMPRSS2-ERG fusion as well as TMPRSS2-ETV1 and TMPRSS2-ETV4 were used to assess samples for gene rearrangements indicative of malignancy under a design of sequential trial.
TMPRSS2_ETV4- 17079440prostate cancer PCR - Seven cases showed TMPRSS2:ERG gene fusions, whereas the TMPRSS2:ETV4 fusion was seen in one case.
TMPRSS2_ETV4- 18451133prostate cancer - - At low frequency, TMPRSS2-ETV1 and TMPRSS2-ETV4 fusion genes have been described.
TMPRSS2_ETV4- 18642766prostate cancer PCR;RT-PCR - Nested RT-PCR and direct DNA sequencing were used to detect the fusion genes of TMPRSS2/ERG, TMPRSS2/ETV1, and TMPRSS2/ETV4. /// TMPRSS2/ETV4 fusion was not detected.

ChimerSEQ

Top
The fusion gene pair TMPRSS2--ETV4 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
TMPRSS2_ETV4chr21/42880007/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-HC-7079-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41623036/- 21q22.3 17q21.31 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-M7-A725-01A - FusionScan
TMPRSS2_ETV4chr21/42879876/- chr17/41623036/- 21q22.3 17q21.31 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-KC-A7FD-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41623036/- 21q22.3 17q21.31 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-G9-6371-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-CH-5763-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-M7-A725-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41623036/- 21q22.3 17q21.31 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-KC-A7FD-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-KC-A7FD-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41613847/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-KC-A7FD-01A - FusionScan
TMPRSS2_ETV4chr21/42879876/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 Out-of-Frame Inter-chr PRAD TCGA-KC-A7FD-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-KK-A7AW-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-G9-6371-01A - FusionScan
TMPRSS2_ETV4chr21/42879876/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 Out-of-Frame Inter-chr PRAD TCGA-G9-6371-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41613847/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-G9-6371-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-HC-7077-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41623036/- 21q22.3 17q21.31 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-HC-7077-01A - FusionScan
TMPRSS2_ETV4chr21/42870045/- chr17/41623036/- 21q22.3 17q21.31 Exonic hg19 CDS-5'UTR Inter-chr PRAD TCGA-HC-7077-01A - FusionScan
TMPRSS2_ETV4chr21/42880007/- chr17/41613847/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-HC-7077-01A - FusionScan
TMPRSS2_ETV4chr21/42870045/- chr17/41622735/- 21q22.3 17q21.31 Exonic hg19 In-Frame Inter-chr PRAD TCGA-HC-7077-01A - FusionScan
TMPRSS2_ETV4chr21/42870045/- chr17/41623035/- 21q22.3 17q21.31 Exonic hg19 CDS-5'UTR Inter-chr PRAD TCGA-HC-7077-01A - TopHat-Fusion
TMPRSS2_ETV4chr21/42880007/- chr17/41622734/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-HC-7077-01A - TopHat-Fusion
TMPRSS2_ETV4chr21/42880007/- chr17/41623035/- 21q22.3 17q21.31 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-HC-7077-01A - TopHat-Fusion
TMPRSS2_ETV4chr21/42880007/- chr17/41622734/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-KC-A7FD-01A - TopHat-Fusion
TMPRSS2_ETV4chr21/42880007/- chr17/41622737/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-KC-A7FD-01A - TopHat-Fusion
TMPRSS2_ETV4chr21/42880007/- chr17/41623035/- 21q22.3 17q21.31 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-KC-A7FD-01A - TopHat-Fusion
TMPRSS2_ETV4chr21/42880007/- chr17/41622734/- 21q22.3 17q21.31 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-G9-6371-01A - TopHat-Fusion
TMPRSS2_ETV4chr21/42870045/- chr17/41622734/- 21q22.3 17q21.31 Exonic hg19 In-Frame Inter-chr PRAD TCGA-HC-7077-01A - TopHat-Fusion
TMPRSS2_ETV4chr21/42879876/- chr17/41622734/- 21q22.3 17q21.31 Exonic hg19 Out-of-Frame Inter-chr PRAD TCGA-G9-6371-01A - TopHat-Fusion
TMPRSS2_ETV4chr21/42880008/- chr17/41623036/- 21q22.3 17q21.31 Exonic hg19 - Inter-chr PRAD TCGA-KC-A7FD-01A - PRADA
TMPRSS2_ETV4chr21/42880085/ chr17/41622350/ 21q22.3 17q21.31 Exonic hg19 - Inter-chr prostate cancer EU693079 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair TMPRSS2--ETV4 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human EU693079TMPRSS2--ETV4 TMPRSS221 42870044 42880085 - 1 151 100 ETV417 41622350 41623036 - 150 395 100

FARE-CAFE

Top
The fusion gene pair TMPRSS2--ETV4 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
TMPRSS2-ETV4 Prostate cancer qPCR,RT-PCR,RACE,PCR,FISH,DNA sequencing t(17;21)(q21;q22.3) PubMed:18794152

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
TMPRSS2-ETV4 TMPRSS2-ETV4 TMPRSS2 42870064 1 0 ETV4 41623013 0 1 caagatggctttgaactcaGtctcggcccccgcttggggcccc 18794152 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
TMPRSS2-ETV4 TMPRSS2-ETV4 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ETV4 1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
TMPRSS2-ETV4 hsa-miR-26b-5p _ Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
TMPRSS2-ETV4 NM_001135099.1 - - -

TicDB

Top
The fusion gene pair TMPRSS2--ETV4 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
TMPRSS2 ETV4 18794152 caagatggctttgaactcaGtctcggcccccgcttggggcccc

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair TMPRSS2--ETV4 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
PRAD G9-6351-01A TMPRSS2__ETV4 0.96 21:42866283/-1 17:41607549/-1 tier3 In-frame 18267 NA
PRAD G9-6371-01A TMPRSS2__ETV4 0.96 21:42879877/-1 17:41622735/-1 tier1 5UTR-CDS 18268 NA
PRAD HC-7077-01A TMPRSS2__ETV4 0.96 21:42870046/-1 17:41623036/-1 tier1 CDS-5UTR 18269 NA
PRAD HC-7079-01A TMPRSS2__ETV4 0.96 21:42870046/-1 17:41623036/-1 tier3 CDS-5UTR 18270 NA
PRAD KC-A7FD-01A TMPRSS2__ETV4 0.96 21:42880008/-1 17:41623036/-1 tier1 5UTR-5UTR 18271 NA
PRAD KK-A7AW-01A TMPRSS2__ETV4 0.96 21:42880008/-1 17:41622735/-1 tier4 5UTR-CDS 18272 NA
PRAD M7-A725-01A TMPRSS2__ETV4 0.96 21:42880008/-1 17:41622735/-1 tier1 5UTR-CDS 18273 NA

FusionCancer

Top
The fusion gene pair TMPRSS2--ETV4 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair TMPRSS2--ETV4 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene TMPRSS2--ETV4 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene TMPRSS2--ETV4 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene TMPRSS2--ETV4 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene TMPRSS2--ETV4 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene TMPRSS2--ETV4 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair TMPRSS2--ETV4 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene TMPRSS2--ETV4 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene TMPRSS2--ETV4 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene TMPRSS2 is a known oncogene according to ONGENE database.


The tail gene ETV4 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene TMPRSS2 is cancer associated according to Bushman Cancer Gene database.


The tail gene ETV4 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene TMPRSS2 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.
The tail gene ETV4 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene TMPRSS2--ETV4 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene TMPRSS2--ETV4 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair TMPRSS2--ETV4 information is available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

5'Gene5'Chr5'Coordinate3'Gene3'Chr3'Coordinate# Spanning ReadsSPLICE JUNCTION?IN-FRAME?JUNCTION SEQUENCECASE NUMBERCAISISLibrary
TMPRSS22142870046ETV4174161384711YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA CTCAGGTACCAGACAGTGATGAGCAGTTTGTTCCTGATTTCCATTCAGAA 29611522406115224-T-C1
TMPRSS22142866283ETV41741613847136YESYESCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAA CTCAGGTACCAGACAGTGATGAGCAGTTTGTTCCTGATTTCCATTCAGAA 29611522406115224-T-C1
TMPRSS22142860321ETV4174162303648YESNOGTGTGATGGCGTGTCACACTGCCCCGGCGGGGAGGACGAGAATCGGTGTG GTCTCGGCCCCCGCTTGGGGCCCCGGCCGTGCGGCCGGAGGGAGCGGCCG 30611511506115115-T
TMPRSS22142860321ETV41741622735109YESNOGTGTGATGGCGTGTCACACTGCCCCGGCGGGGAGGACGAGAATCGGTGTG AAATCGCCCGGAAATGGGAGCTTGCGCGAAGCGCTGATCGGCCCGCTGGG 30611511506115115-T
TMPRSS22142880008ETV41741623036696YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GTCTCGGCCCCCGCTTGGGGCCCCGGCCGTGCGGCCGGAGGGAGCGGCCG 1325115187SI_7398
TMPRSS22142880008ETV41741623036275YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GTCTCGGCCCCCGCTTGGGGCCCCGGCCGTGCGGCCGGAGGGAGCGGCCG 1325115187SI_7404
TMPRSS22142880008ETV417416227353817YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG AAATCGCCCGGAAATGGGAGCTTGCGCGAAGCGCTGATCGGCCCGCTGGG 1325115187SI_7398
TMPRSS22142880008ETV417416227351324YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG AAATCGCCCGGAAATGGGAGCTTGCGCGAAGCGCTGATCGGCCCGCTGGG 1325115187SI_7404
TMPRSS22142870046ETV41741623036692YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GTCTCGGCCCCCGCTTGGGGCCCCGGCCGTGCGGCCGGAGGGAGCGGCCG 1325115187SI_7398
TMPRSS22142870046ETV41741623036307YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GTCTCGGCCCCCGCTTGGGGCCCCGGCCGTGCGGCCGGAGGGAGCGGCCG 1325115187SI_7404
TMPRSS22142870046ETV41741622735344YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA AAATCGCCCGGAAATGGGAGCTTGCGCGAAGCGCTGATCGGCCCGCTGGG 1325115187SI_7398
TMPRSS22142870046ETV41741622735188YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA AAATCGCCCGGAAATGGGAGCTTGCGCGAAGCGCTGATCGGCCCGCTGGG 1325115187SI_7404
TMPRSS22142861434ETV41741613847320YESYESGACCTTCCTCGTGGGAGCTGCGCTGGCCGCTGGCCTACTCTGGAAGTTCA CTCAGGTACCAGACAGTGATGAGCAGTTTGTTCCTGATTTCCATTCAGAA 1385115027SI_5092
TMPRSS22142861434ETV41741613847352YESYESGACCTTCCTCGTGGGAGCTGCGCTGGCCGCTGGCCTACTCTGGAAGTTCA CTCAGGTACCAGACAGTGATGAGCAGTTTGTTCCTGATTTCCATTCAGAA 1385115027SI_5094
TMPRSS22142860321ETV417416138474582YESYESGTGTGATGGCGTGTCACACTGCCCCGGCGGGGAGGACGAGAATCGGTGTG CTCAGGTACCAGACAGTGATGAGCAGTTTGTTCCTGATTTCCATTCAGAA 1385115027SI_5092
TMPRSS22142860321ETV417416138476304YESYESGTGTGATGGCGTGTCACACTGCCCCGGCGGGGAGGACGAGAATCGGTGTG CTCAGGTACCAGACAGTGATGAGCAGTTTGTTCCTGATTTCCATTCAGAA 1385115027SI_5094

Pancreases_Dataset

Top
Fusion gene TMPRSS2--ETV4 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene TMPRSS2--ETV4 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair TMPRSS2--ETV4 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair TMPRSS2--ETV4 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair TMPRSS2--ETV4 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene TMPRSS2--ETV4 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair TMPRSS2--ETV4 information is not available in ChromothripsisDB database.