TMPRSS2--ETV1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

TMPRSS2 ETV1

COSMIC

The fusion gene pair TMPRSS2--ETV1 information is available in COSMIC database.

Link
TMPRSS2--ETV1

ChimerKB

Top
The fusion gene pair TMPRSS2--ETV1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
TMPRSS2_ETV1-/150/ -/850/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ETV1-/150/ -/904/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ETV1-/-/ -/-/ - hg19 prostate cancers - 16254181 - Cosmic_nonrecurrent
TMPRSS2_ETV1-/-/ -/-/ - hg19 prostate cancers - 17108102 - Cosmic_nonrecurrent
TMPRSS2_ETV1-/-/ -/-/ - hg19 prostate cancer - 17632455 - Cosmic_nonrecurrent
TMPRSS2_ETV1-/-/ -/-/ - hg19 prostate cancer - 20616363 - Cosmic_nonrecurrent
TMPRSS2_ETV1-/-/ -/-/ - hg19 hyperplasia - 20616363 - Cosmic_nonrecurrent
TMPRSS2_ETV1-/-/ -/-/ - hg19 prostate cancer - 18483239 - Cosmic_nonrecurrent

ChimerPUB

Top
The fusion gene pair TMPRSS2--ETV1 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
TMPRSS2_ETV17p21.3 / 17259299prostate cancer FISH;PCR;RT-PCR - TMPRSS2:ETV1 gene fusions were not detected in any of the cases tested.
TMPRSS2_ETV1- 23244085prostate cancer FISH - Among the patients with the fusion gene, 46 (83.6%) patients had the TMPRSS2:ERG fusion product, 8 (14.8%) patients had TMPRSS2:ETV1 fusion, 1 (1.6%) patient had TMPRSS2:ETV4..
TMPRSS2_ETV1- 17632455prostate cancer FISH;PCR;RT-PCR - In this study, we used formalin-fixed paraffin-embedded tissue and evaluated both TMPRSS2-ERG and TMPRSS2-ETV1 fusions by reverse transcription polymerase chain reaction (RT-PCR) and fluorescence in situ hybridization (FISH). /// "Of 82 cases examined, TMPRSS2-ETV1 fusion was seen in only one case, by FISH. "
TMPRSS2_ETV1- 24815454prostate cancer FISH - TMPRSS2:ERG, TMPRSS2:ETV1 and TMPRSS2:ETV4 fusions were tested by multi-probe fluorescence in situ hybridization (FISH) assay. /// Neither TMPRSS2:ETV1 nor TMPRSS2:ETV4 fusion was found in any case. /// They also lack TMPRSS2:ETV1 and TMPRSS2:ETV4 fusion. /// "We evaluated TMPRSS2:ERG, TMPRSS2:ETV1 and TMPRSS2:ETV4 fusions in more than 100 Eastern Chinese prostate cancer patients. "
TMPRSS2_ETV1- 20616363prostate cancer FISH - Fluorescently labeled probes specific for ERG-related rearrangements involving the TMPRSS2-ERG fusion as well as TMPRSS2-ETV1 and TMPRSS2-ETV4 were used to assess samples for gene rearrangements indicative of malignancy under a design of sequential trial.
TMPRSS2_ETV1- 17334343prostate cancer FISH - Overall, 54 and 2% of cases demonstrated TMPRSS2:ERG and TMPRSS2:ETV1 fusions, respectively.
TMPRSS2_ETV1- 23814484prostate cancer FISH - Finally, we found one PCa with TMPRSS2-ETV1, one with C15orf21-ETV1, one with EST14-ETV1, and two with 14q133-q21.1-ETV1.
TMPRSS2_ETV1- 16820092prostate cancer FISH - No TMPRSS2/ETV1 chimeric fusion was detected in this series.
TMPRSS2_ETV1- 17390040prostate cancer PCR;RT-PCR - Molecular genetic analyses of the TMPRSS2-ERG and TMPRSS2-ETV1 gene fusions in 50 cases of prostate cancer.. /// "Herein, we have analyzed a series of 50 prostate cancer samples for expression of TPRSS2-ERG and TMPRSS2-ETV1 fusion transcripts. " /// Our findings show that the TMPRSS2-ERG fusion is common in prostate cancer and that the related TMPRSS2-ETV1 fusion is very rare. /// None of the tumors expressed a TMPRSS2-ETV1 fusion.
TMPRSS2_ETV1- 18642766prostate cancer PCR;RT-PCR - Nested RT-PCR and direct DNA sequencing were used to detect the fusion genes of TMPRSS2/ERG, TMPRSS2/ETV1, and TMPRSS2/ETV4. /// TMPRSS2/ERG and TMPRSS2/ETV1 fusion genes may be used as diagnostic tools for PCa.. /// "TMPRSS2/ETV1 fusion was detected in only 2 cases (6.3%), including one newly discovered variant fusion transcripts with the GenBank accession number of EU090249. " /// The positive rates of TMPRSS2/ERG and TMPRSS2/ETV1 fusions showed no statistical association with the Gleason grade (P = 0.169).
TMPRSS2_ETV1- 18451133prostate cancer - - At low frequency, TMPRSS2-ETV1 and TMPRSS2-ETV4 fusion genes have been described.
TMPRSS2_ETV1- 25780911prostate cancer;adenocarcinoma - - Gene fusions involving ETS family transcription factors (mainly TMPRSS2-ERG and TMPRSS2-ETV1 fusions) have been found in ~50% of human prostate cancer cases. /// "We recently generated knockin mouse models for TMPRSS2-ERG and TMPRSS2-ETV1 fusions, utilizing the endogenous Tmprss2 promoter. " /// "Although expression of TMPRSS2-ERG or TMPRSS2-ETV1 fusion alone is insufficient to initiate prostate tumorigenesis, they appear to sensitize prostate epithelial cells for cooperation with additional oncogenic mutations to drive frank prostate adenocarcinoma. "
TMPRSS2_ETV1- 18385909prostate cancer FISH;PCR;RT-PCR - TMPRSS2:ERG transcripts were found in 44% of our samples, but we did not detect expression of TMPRSS2:ETV1. /// "We analyzed the frequency of TMPRSS2:ERG and TMPRSS2:ETV1 transcripts in 27 prostate cancer biopsies from prostatectomies, and TMPRSS2:ERG transcripts in CTC isolated from 15 patients with advanced androgen independent disease using reverse transcription polymerase chain reaction (RT-PCR). " /// "We analyzed the frequency of TMPRSS2:ERG and TMPRSS2:ETV1 transcripts in 27 prostate cancer biopsies from prostatectomies, and TMPRSS2:ERG transcripts in CTC isolated from 15 patients with advanced androgen independent disease using reverse transcription polymerase chain reaction (RT-PCR)."
TMPRSS2_ETV1- 21572435prostate cancer;adenocarcinoma - - Truncated ETV1 encoded by prostate cancer translocation TMPRSS2:ETV1 lacks the critical COP1 binding motifs and was 50-fold more stable than wild-type ETV1. /// Truncated ETV1 encoded by prostate cancer translocation TMPRSS2:ETV1 lacks the critical COP1 binding motifs and was 50-fold more stable than wild-type ETV1.
TMPRSS2_ETV1- 19293179prostate cancer PCR - TMPRSS2-ERG, TMPRSS2-ETV1, and SLC45A3-ERG rearrangements account for roughly 90% of ETS fusion prostate cancer.
TMPRSS2_ETV1- 17032499prostate cancer;prostatic intraepithelial neoplasia - - To determine the relative order of genetic events in prostate carcinogenesis, we have analyzed 34 prostate carcinomas, 19 paired HGPIN lesions, 14 benign prostate hyperplasias, and 11 morphologically normal prostatic tissues for TMPRSS2-ERG and TMPRSS2-ETV1 rearrangements and genomic imbalances.
TMPRSS2_ETV1- 17671502prostate cancer - - Whereas TMPRSS2-ERG fusions are predominant, fewer TMPRSS2-ETV1 cases have been identified than expected on the basis of the frequency of high (outlier) expression of ETV1 (refs 3-13).

ChimerSEQ

Top
The fusion gene pair TMPRSS2--ETV1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
TMPRSS2_ETV1chr21/42880007/- chr7/13975521/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-YL-A8SC-01A - FusionScan
TMPRSS2_ETV1chr21/42879876/- chr7/13978871/- 21q22.3 7p21.2 Exonic hg19 In-Frame Inter-chr PRAD TCGA-EJ-7788-01A - FusionScan
TMPRSS2_ETV1chr21/42866282/- chr7/13950932/- 21q22.3 7p21.2 Exonic hg19 In-Frame Inter-chr PRAD TCGA-HC-7818-01A - FusionScan
TMPRSS2_ETV1chr21/42880007/- chr7/13950932/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-HC-7818-01A - FusionScan
TMPRSS2_ETV1chr21/42880007/- chr7/13978871/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-YL-A8SC-01A - FusionScan
TMPRSS2_ETV1chr21/42880007/- chr7/13971374/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-YL-A8SC-01A - FusionScan
TMPRSS2_ETV1chr21/42879876/- chr7/13978871/- 21q22.3 7p21.2 Exonic hg19 In-Frame Inter-chr PRAD TCGA-YL-A8SC-01A - FusionScan
TMPRSS2_ETV1chr21/42880007/- chr7/13978871/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-EJ-5501-01A - FusionScan
TMPRSS2_ETV1chr21/42879876/- chr7/13978871/- 21q22.3 7p21.2 Exonic hg19 In-Frame Inter-chr PRAD TCGA-EJ-5501-01A - FusionScan
TMPRSS2_ETV1chr21/42880007/- chr7/13978871/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-EJ-7788-01A - FusionScan
TMPRSS2_ETV1chr21/42870045/- chr7/13978871/- 21q22.3 7p21.2 Exonic hg19 Out-of-Frame Inter-chr PRAD TCGA-EJ-7788-01A - FusionScan
TMPRSS2_ETV1chr21/42880007/- chr7/13971374/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-HC-7818-01A - FusionScan
TMPRSS2_ETV1chr21/42870045/- chr7/13971374/- 21q22.3 7p21.2 Exonic hg19 Out-of-Frame Inter-chr PRAD TCGA-HC-7818-01A - FusionScan
TMPRSS2_ETV1chr21/42866282/- chr7/13971374/- 21q22.3 7p21.2 Exonic hg19 Out-of-Frame Inter-chr PRAD TCGA-HC-7818-01A - FusionScan
TMPRSS2_ETV1chr21/42880007/- chr7/13978870/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-EJ-5501-01A - TopHat-Fusion
TMPRSS2_ETV1chr21/42880007/- chr7/13978870/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-YL-A8SC-01A - TopHat-Fusion
TMPRSS2_ETV1chr21/42880007/- chr7/13978870/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-EJ-7788-01A - TopHat-Fusion
TMPRSS2_ETV1chr21/42880007/- chr7/13971373/- 21q22.3 7p21.2 Exonic hg19 5'UTR-CDS Inter-chr PRAD TCGA-HC-7818-01A - TopHat-Fusion
TMPRSS2_ETV1chr21/42879876/- chr7/13978870/- 21q22.3 7p21.2 Exonic hg19 In-Frame Inter-chr PRAD TCGA-YL-A8SC-01A - TopHat-Fusion
TMPRSS2_ETV1chr21/42870045/- chr7/13978870/- 21q22.3 7p21.2 Exonic hg19 Out-of-Frame Inter-chr PRAD TCGA-EJ-7788-01A - TopHat-Fusion
TMPRSS2_ETV1chr21/42866282/- chr7/13971373/- 21q22.3 7p21.2 Exonic hg19 Out-of-Frame Inter-chr PRAD TCGA-HC-7818-01A - TopHat-Fusion
TMPRSS2_ETV1chr21/42870045/- chr7/13971373/- 21q22.3 7p21.2 Exonic hg19 Out-of-Frame Inter-chr PRAD TCGA-HC-7818-01A - TopHat-Fusion
TMPRSS2_ETV1chr21/42866282/- chr7/13950931/- 21q22.3 7p21.2 Exonic hg19 In-Frame Inter-chr PRAD TCGA-HC-7818-01A - TopHat-Fusion
TMPRSS2_ETV1chr21/42880078/ chr7/13975394/ 21q22.3 7p21.2 Exonic hg19 - Inter-chr NA EU090249 - ChiTaRs
TMPRSS2_ETV1chr21/42880082/ chr7/14017052/ 21q22.3 7p21.2 Exonic hg19 - Inter-chr prostate cancer DQ204770 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair TMPRSS2--ETV1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human DQ204770TMPRSS2--ETV1 TMPRSS221 42880008 42880082 - 1 75 100 ETV17 14017052 14017108 - 73 129 100
Human DQ204771TMPRSS2--ETV1 TMPRSS221 42870046 42880082 - 1 146 100 ETV17 14017052 14017105 - 147 200 100
Human EU090249TMPRSS2--ETV1 TMPRSS221 42866302 42880078 - 1 346 100 ETV17 13975394 13975469 - 341 416 100

FARE-CAFE

Top
The fusion gene pair TMPRSS2--ETV1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
TMPRSS2-ETV1 Prostate cancer qPCR,RT-PCR,RACE,PCR,FISH,DNA sequencing t(7;21)(p21.2;q22.3) PubMed:16254181

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
TMPRSS2-ETV1 TMPRSS2-ETV1-Isoform1 TMPRSS2 42880082 1 0 ETV1 14017052 0 0 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGCTCAGGTACCTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTT _ DQ204770
TMPRSS2-ETV1 TMPRSS2-ETV1-Isoform2 TMPRSS2 42880082 1 0 ETV1 14017052 0 0 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCACTCAGGTACCTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTT _ DQ204771
TMPRSS2-ETV1 TMPRSS2-ETV1-Isoform3 TMPRSS2 42880082 1 0 ETV1 _ 0 _ TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGTCCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGCAGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACCCTAGCCAGGTGAATGGCTCAAG _ DQ204772
TMPRSS2-ETV1 TMPRSS2-ETV1-Isoform4 TMPRSS2 42880082 1 0 ETV1 _ 0 _ TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTTATTCCAGGATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGCAAGACAAATGACTCACAGAGAAAAAAGATGGCAGAACCAAGGGCAACTAAAG _ DQ204773

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
TMPRSS2-ETV1 TMPRSS2-ETV1-Isoform1 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ETV1 1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ETV1 TMPRSS2-ETV1-Isoform2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ETV1 1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ETV1 TMPRSS2-ETV1-Isoform3 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ETV1 1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ETV1 TMPRSS2-ETV1-Isoform4 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ETV1 1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets
1) ETS_PEA3_N
2) Ets
1) SRF-TF , Ank_2 , PAX , Ets

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
TMPRSS2-ETV1 hsa-miR-335-5p _ Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
TMPRSS2-ETV1 NM_001135099.1 - - -

TicDB

Top
The fusion gene pair TMPRSS2--ETV1 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
TMPRSS2 ETV1 DQ204770 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGCTCAGGTACCTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTT
TMPRSS2 ETV1 DQ204771 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTCATATTGAACATTCCAGATACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCACTCAGGTACCTGACAATGATGAGCAGTTTGTACCAGACTATCAGGCTGAAAGTT
TMPRSS2 ETV1 DQ204772 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGTCCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGCAGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACCCTAGCCAGGTGAATGGCTCAAG
TMPRSS2 ETV1 DQ204773 TAGGCGCGAGCTAAGCAGGAGGCGGAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAGGTTATTCCAGGATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGCAAGACAAATGACTCACAGAGAAAAAAGATGGCAGAACCAAGGGCAACTAAAG

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair TMPRSS2--ETV1 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
PRAD EJ-5501-01A TMPRSS2__ETV1 0.78 21:42879877/-1 7:13978871/-1 tier1 5UTR-CDS 18263 NA
PRAD EJ-7788-01A TMPRSS2__ETV1 0.78 21:42870046/-1 7:13978871/-1 tier1 Out-of-frame 18264 NA
PRAD HC-7818-01A TMPRSS2__ETV1 0.78 21:42866283/-1 7:13971374/-1 tier4 Out-of-frame 18265 NA
PRAD YL-A8SC-01A TMPRSS2__ETV1 0.78 21:42879877/-1 7:13978871/-1 tier1 5UTR-CDS 18266 NA

FusionCancer

Top
The fusion gene pair TMPRSS2--ETV1 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair TMPRSS2--ETV1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene TMPRSS2--ETV1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene TMPRSS2--ETV1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene TMPRSS2--ETV1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene TMPRSS2--ETV1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene TMPRSS2--ETV1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair TMPRSS2--ETV1 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene TMPRSS2--ETV1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene TMPRSS2--ETV1 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene TMPRSS2 is a known oncogene according to ONGENE database.


The tail gene ETV1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene TMPRSS2 is cancer associated according to Bushman Cancer Gene database.


The tail gene ETV1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene TMPRSS2 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ETV1 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene TMPRSS2--ETV1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene TMPRSS2--ETV1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair TMPRSS2--ETV1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene TMPRSS2--ETV1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene TMPRSS2--ETV1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair TMPRSS2--ETV1 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair TMPRSS2--ETV1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair TMPRSS2--ETV1 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene TMPRSS2--ETV1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair TMPRSS2--ETV1 information is not available in ChromothripsisDB database.