TMPRSS2--ERG

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

TMPRSS2 ERG

COSMIC

The fusion gene pair TMPRSS2--ERG information is available in COSMIC database.

Link
TMPRSS2--ERG

ChimerKB

Top
The fusion gene pair TMPRSS2--ERG information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
TMPRSS2_ERG-/79/ -/312/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/150/ -/312/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/79/ -/124/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/79/ -/530/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/150/ -/124/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/150/ -/226/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/373/ -/312/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/373/ -/124/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/79/ -/226/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/580/ -/312/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/150/ -/530/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/79+?/ -/312/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/460/ -/312/ Exonic hg19 - - - - Cosmic_recurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 16820092 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 16254181 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17079440 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17032499 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate carcinoma - 17032499 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 16575875 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17059688 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17108102 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17237811 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 hyperplasia - 17259299 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17259299 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 16951141 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 16951139 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17043636 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17172822 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17385188 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 hyperplasia - 17043636 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17390040 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancers - 17401460 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 17632455 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 17785564 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 17637754 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 17971772 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18798258 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19029822 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19401683 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19584163 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 - - 18519767 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 high grade prostatic intraepithelial neoplasia - 18519767 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18500259 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate carcinoma - 18474293 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18385909 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18165275 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19647299 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19649210 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19664128 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostatic adenocarcinoma - 19734849 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19494719 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 17991527 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18065961 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 - - 18065961 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19396154 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate carcinoma, prostate cancer - 19465903 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 20800881 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 20693979 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 21036922 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 20878952 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 21167530 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate small cell carcinoma - 21040948 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate carcinoma, prostate cancer - 20719821 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 20118910 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18794152 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostatic ductal adenocarcinoma - 19151660 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 20616363 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 hyperplasia - 20616363 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 21144642 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 - - 21144642 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 20442300 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 20303538 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostatic adenocarcinoma, prostatic small cell carcinoma - 21499238 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19147579 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18694509 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18794177 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 19190343 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18676740 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 18483239 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 24870262 - Cosmic_nonrecurrent
TMPRSS2_ERG-/-/ -/-/ - hg19 prostate cancer - 25586381 - Cosmic_nonrecurrent
TMPRSS2_ERGchr21/41801952/ chr21/38739196/ Exonic hg18 - - - - ChimerDB2
TMPRSS2_ERGchr21/41801952/ chr21/38878637/ Exonic hg18 - - - - ChimerDB2
TMPRSS2_ERGchr21/41801935/ chr21/38739363/ Exonic hg18 - - - - ChimerDB2
TMPRSS2_ERGchr21/41801948/ chr21/38717325/ Exonic hg18 - - - - ChimerDB2
TMPRSS2_ERGchr21/41801938/ chr21/38689162/ Exonic hg18 - - - - ChimerDB2
TMPRSS2_ERG-/0/ -/0/ Exonic hg18 - - - - TICdb

ChimerPUB

Top
The fusion gene pair TMPRSS2--ERG information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
TMPRSS2_ERG- 19647299prostate cancer FISH;PCR;RT-PCR - The branched DNA assay detected TMPRSS2-ERG gene fusion from less than 200 pg of prostate cancer RNA, whereas more than 600 pg of RNA was required for fusion gene detection by one step real-time RT-PCR. /// Nonquantitative nested reverse transcription (RT)-PCR and fluorescence in situ hybridization (FISH) were used to ascertain TMPRSS2-ERG gene fusion status in prostate tissues. /// " To develop a novel assay that uses branched DNA technology to measure TMPRSS2-ERG fusion, as genetic rearrangement of TMPRSS2 regulatory sequences and coding sequences of the ERG gene has been detected in nearly half of prostate cancers, but quantitative assays to detect such TMPRSS2-ERG gene fusion have been limited to real-time polymerase chain reaction (PCR) techniques that rely on reverse transcriptase-based amplification. " /// "Our findings demonstrate a branched DNA assay that is effective for detection of TMPRSS2-ERG gene fusion in prostate cancer clinical specimens, thus providing an alternative method to ascertain TMPRSS2-ERG gene fusion in human prostate cancer tissue.. " /// Branched DNA probes were designed to detect TMPRSS2-ERG gene fusion in prostate cancer cell lines. /// "To develop a novel assay that uses branched DNA technology to measure TMPRSS2-ERG fusion, as genetic rearrangement of TMPRSS2 regulatory sequences and coding sequences of the ERG gene has been detected in nearly half of prostate cancers, but quantitative assays to detect such TMPRSS2-ERG gene fusion have been limited to real-time polymerase chain reaction (PCR) techniques that rely on reverse transcriptase-based amplification."
TMPRSS2_ERG- 24777847small cell carcinoma;prostate cancer;adenocarcinoma FISH - Of 61 cases of PSCC, 51% (31/61) demonstrated increased AR gene copy number (FISH+), 54% (33/61) were positive for TMPRSS2-ERG gene fusion, and 38% (23/61) showed AR protein expression. /// "Of the 31 AR FISH+ cases, 23 also showed TMPRSS2-ERG gene fusion, and 16 expressed AR protein. " /// "Statistically significant correlations were observed between AR gene copy number or AR protein expression and TMPRSS2-ERG gene fusion (P?=?0.001 and P?=?0.03, respectively). " /// The TMPRSS2-ERG gene rearrangement is highly specific for prostate cancer and shared by PSCC. /// Sixty-one cases of PSCC were examined for AR gene copy number and TMPRSS2-ERG rearrangement by fluorescence in situ hybridization (FISH) and AR protein expression by immunohistochemistry. /// "however, the role of androgen receptor (AR) gene alterations and interaction with TMPRSS2-ERG rearrangement are incompletely understood in PSCC. " /// Increased androgen receptor gene copy number is associated with TMPRSS2-ERG rearrangement in prostatic small cell carcinoma.. /// "In summary, high AR gene copy number emerges during the development of PSCC, often in association with TMPRSS2-ERG rearrangement. "
TMPRSS2_ERG- 25175909prostate cancer FISH - These results demonstrate the ability of confocal microscopy and FISH to identify the cell-to-cell differences in common gene fusions such as TMPRSS2-ERG that may arise independently within the same tumor focus.
TMPRSS2_ERG7p21.3 / 17259299prostate cancer FISH;PCR;RT-PCR - Frequency of the TMPRSS2:ERG gene fusion is increased in moderate to poorly differentiated prostate cancers.. /// This study indicates that TMPRSS2:ERG gene rearrangements in CaP may be used as a diagnostic tool to identify prognostically relevant sub-classifications of these cancers..
TMPRSS2_ERG- 19151660adenocarcinoma FISH - The TMPRSS2-ERG gene fusion was also rare in the acinar component of mixed ductal-acinar tumors when compared with the pure acinar adenocarcinoma controls (5 vs 45%, P=0.001, Fisher's exact test). /// "Compared with the matched acinar adenocarcinoma cases, the TMPRSS2-ERG gene fusion was significantly less frequently observed in ductal adenocarcinoma (45 vs 11% of cases, P=0.002, Fisher's exact test). " /// "We studied the occurrence of the TMPRSS2-ERG gene fusion, in 40 surgically resected ductal adenocarcinoma cases, and in their associated acinar component using fluorescence in situ hybridization. " /// TMPRSS2-ERG gene fusions are infrequent in prostatic ductal adenocarcinomas.. /// The presence of the TMPRSS2-ERG gene fusion in some cases of prostatic ductal adenocarcinoma supports the concept that ductal adenocarcinoma and acinar adenocarcinoma may be related genetically. /// "In 95% of the ductal adenocarcinoma cases in which a concurrent acinar component was analyzed, there was concordance for presence/absence of the TMPRSS2-ERG gene fusion between the different histologic subtypes. "
TMPRSS2_ERG- 19029822prostate cancer FISH - TMPRSS2-ERG gene fusion was recently reported as the most common gene rearrangement in prostate cancer (PCA). /// The TMPRSS2-ERG gene fusion status was homogenous within the same cancer focus and 82% of fusion positive PCA were present in GS 6 or 7 vs. /// "We sought to characterize the incidence, pathological features and clinical parameters of TMPRSS2-ERG gene fusion in a cohort of 196 Canadian men treated by radical prostatectomy for localized PCA, and to investigate its potential as a biomarker in PCA. " /// Using break-apart FISH assay to indirectly assess the fusion of TMPRSS2-ERG. /// "If confirmed, this could have significant clinical impact in further stratifying patients with PCA should the TMPRSS2-ERG be confirmed as a prognostic biomarker.. " /// The higher association of TMPRSS2-ERG with Gleason score 6 and 7 should be further investigated.
TMPRSS2_ERG- 23850495small cell carcinoma;adenocarcinoma FISH - Of 54 cases of prostatic small cell carcinoma, 26 (48%) were positive for TMPRSS2-ERG gene fusion by FISH and 12 (22%) showed overexpression of ERG protein by immunohistochemistry. /// "Of 54 cases of prostatic small cell carcinoma, 26 (48%) were positive for TMPRSS2-ERG gene fusion by FISH and 12 (22%) showed overexpression of ERG protein by immunohistochemistry. " /// We evaluated 54 cases of small cell carcinoma of the prostate and compared TMPRSS2-ERG gene fusion status by fluorescence in situ hybridization (FISH) to immunohistochemical staining with antibody to ERG. /// TMPRSS2-ERG gene fusion appears to be a highly specific alteration in prostatic carcinoma that is frequently shared by small cell carcinoma. /// Positive staining for ERG by immunohistochemistry is present in a subset of prostatic small cell carcinomas and correlates with the presence of TMPRSS2-ERG gene fusion. /// Frequent TMPRSS2-ERG rearrangement in prostatic small cell carcinoma detected by fluorescence in situ hybridization: the superiority of fluorescence in situ hybridization over ERG immunohistochemistry..
TMPRSS2_ERG- 21499238adenocarcinoma;prostate cancer;small cell carcinoma FISH - TMPRSS2-ERG gene fusion was found in 47% (14/30) of prostatic small cell carcinoma. /// Small cell carcinoma of the prostate demonstrates TMPRSS2-ERG rearrangement with comparable frequency to prostatic adenocarcinoma. /// ERG-TMPRSS2 rearrangement is shared by concurrent prostatic adenocarcinoma and prostatic small cell carcinoma and absent in small cell carcinoma of the urinary bladder: evidence supporting monoclonal origin..
TMPRSS2_ERG- 26503111prostate cancer FISH - The TMPRSS2:ERG (T2E) gene fusion is the most common rearrangement in prostate cancer (PCa).
TMPRSS2_ERG- 21914348small cell carcinoma;prostate cancer;adenocarcinoma FISH - TMPRSS2-ERG gene fusion was evaluated on sections of cell blocks by fluorescence in situ hybridization (FISH) using ERG gene break-apart probes. /// Metastatic prostate cancers have a high prevalence of TMPRSS2-ERG gene fusion along with a frequent copy number increase of ERG gene. /// "Therefore, an identification of the TMPRSS2-ERG gene fusion may be used to establish the prostatic origin of metastasis.. " /// TMPRSS2-ERG gene fusion can be evaluated in FNA specimens of metastatic prostate cancer. /// [TMPRSS2-ERG gene fusion in metastatic prostate cancers: a study of fine needle aspiration specimens].. /// To investigate diagnostic values of the detection of TMPRSS2-ERG gene fusion in metastatic prostate cancer. /// TMPRSS2-ERG gene fusion persists in metastatic prostate cancers and even in those with poorly differentiated SCC features.
TMPRSS2_ERG- 18500259prostate cancer FISH - To date, there has been no systematic analysis of the combined influence of genomic PTEN deletion with TMPRSS2:ERG gene fusions on clinical parameters of prostate cancer progression. /// TMPRSS2:ERG gene fusions and PTEN deletions are the most common genomic aberrations in prostate cancer. /// We carried out a retrospective analysis of 125 prostate cancers with known clinical outcome using interphase fluorescence in situ hybridization to detect the relative prevalence of TMPRSS2:ERG rearrangements and/or PTEN genomic deletions. /// TMPRSS2:ERG rearrangement was found in 60 of 125 (48%) prostate cancers. /// "Gleason grade (P=0.0002)/score (P=0.001), median tumor volume (P=0.0024), preoperative PSA (P=0.001) and perineural invasion (P=0.0304) were significantly associated with biochemical recurrence by univariate analysis with TMPRSS2:ERG approaching significance (P=0.0523). "
TMPRSS2_ERG- 18483239prostate cancer FISH - The most common prostate cancer gene fusion, TMPRSS2-ERG, can be generated by the mechanism of interstitial deletion (Edel) about 39% to 60% of the time in clinically localized disease. /// "These findings suggest that TMPRSS2-ERG with Edel is an aggressive and, in this study, uniformly lethal molecular subtype of prostate cancer associated with androgen-independent disease.. " /// "Interestingly, we observed that all of the androgen-independent metastatic prostate cancer sites harboring TMPRSS2-ERG were associated with Edel. "
TMPRSS2_ERG- 17401460small cell carcinoma;prostate cancer FISH - Molecular characterization of TMPRSS2-ERG gene fusion in the NCI-H660 prostate cancer cell line: a new perspective for an old model.. /// NCI-H660 harbors TMPRSS2-ERG fusion with a homozygous intronic deletion between TMPRSS2 and ERG.
TMPRSS2_ERG- 19396154prostate cancer FISH - In this study, we used fluorescence in situ hybridization to evaluate TMPRSS2-ERG gene fusion in prostate cancer of different zonal origins. /// Prostate cancer of transition zone origin lacks TMPRSS2-ERG gene fusion.. /// "In conclusion, we found that TMPRSS2-ERG gene fusion is associated with the zonal origin of prostate cancer. "
TMPRSS2_ERG- 20118910prostate cancer FISH;PCR - Prevalence of TMPRSS2-ERG and SLC45A3-ERG gene fusions in a large prostatectomy cohort..
TMPRSS2_ERG- 23887154prostate cancer;prostatic intraepithelial neoplasia FISH - Atypical adenomatous hyperplasia of prostate lacks TMPRSS2-ERG gene fusion.. /// Fifty-five separate prostate specimens containing AAH were investigated by fluorescence in situ hybridization and immunohistochemistry for TMPRSS2-ERG rearrangement. /// TMPRSS2-ERG rearrangements were not identified in AAH either by fluorescence in situ hybridization or by immunohistochemistry. /// The prevalence of TMPRSS2-ERG alteration in AAH is unknown.
TMPRSS2_ERG- 21937078prostate cancer FISH - Recent studies have revealed the presence of TMPRSS2-ERG gene fusion in both primary and metastatic prostate cancers. /// The relationship of TMPRSS2-ERG gene fusion between primary and metastatic prostate cancers.. /// Our study demonstrates a close relationship of the TMPRSS2-ERG gene fusion status between primary and metastatic prostate cancer.
TMPRSS2_ERG- 20693982prostate cancer FISH - TMPRSS2-ERG gene fusion was present in 7/59 (12%) transition zone, and in 12/35 (34%) peripheral zone tumors. /// A recent study suggested that TMPRSS2-ERG gene fusion is lacking in cancers arising from the transition zone of the prostate.
TMPRSS2_ERG- 17632455prostate cancer FISH;PCR;RT-PCR - Deletion, rather than translocation, was found to be the main mechanism for TMPRSS2-ERG gene fusion (81 vs 19%). /// "In this study, we used formalin-fixed paraffin-embedded tissue and evaluated both TMPRSS2-ERG and TMPRSS2-ETV1 fusions by reverse transcription polymerase chain reaction (RT-PCR) and fluorescence in situ hybridization (FISH). "
TMPRSS2_ERG- 19190343prostate cancer FISH - TMPRSS2-ERG gene fusion is not associated with outcome in patients treated by prostatectomy.. /// We analyzed TMPRSS2-ERG gene rearrangement status by fluorescence in situ hybridization in 521 cases of clinically localized surgically treated prostate cancer with 95 months of median follow-up and also in 40 unmatched metastases. /// "We therefore conclude that translocation of TMPRSS2-ERG is not associated with outcome, and the aggressive clinical features associated with CNI of chromosome 21 reflect generalized aneuploidy and are not due to CNI specifically of rearranged TMPRSS2-ERG.. " /// "DNA index assessment revealed that the majority of tumors with CNI of TMPRSS2-ERG had generalized aneuploidy/tetraploidy in contrast to tumors without TMPRSS2-ERG CNI, which were predominantly diploid. "
TMPRSS2_ERG- 24469092prostate cancer FISH - As expected, TMPRSS2-ERG gene fusion was strongly associated with increased ERG protein expression in HN and CR PCs (both P<0.0001). /// "Nearly half of the PC tissue specimens (HN: 38%, CR: 46%) harbored a TMPRSS2-ERG gene fusion. "
TMPRSS2_ERG- 18694509prostate cancer FISH - Association of TMPRSS2-ERG gene fusion with clinical characteristics and outcomes: results from a population-based study of prostate cancer.. /// "If replicated, the results presented here may provide insight into the mechanism by which the TMPRSS2-ERG gene fusion arises and also contribute to diagnostic evaluations for determining the subset of men who will go on to develop metastatic prostate cancer.. "
TMPRSS2_ERG- 17108102prostate cancer FISH - Array-based comparative genomic hybridization and interphase fluorescence in situ hybridization indicated both interstitial deletions and translocations as mechanisms of TMPRSS2:ERG gene fusion. /// "All five androgen-dependent xenografts showed as major transcript overexpression of two splice variants of TMPRSS2:ERG, linking TMPRSS2 exon 1 or 2 sequences to ERG exon 4. "
TMPRSS2_ERG- 19734849adenocarcinoma FISH - TMPRSS2-ERG gene fusion status in minute (minimal) prostatic adenocarcinoma.. /// "Given recent suggestions of TMPRSS2-ERG gene fusion association with aggressive prostatic adenocarcinoma, we evaluated the incidence of TMPRSS2-ERG fusion in minute prostatic adenocarcinomas. "
TMPRSS2_ERG- 20800881prostate cancer FISH - TMPRSS2-ERG gene fusion was identified more frequently in patients with low Gleason grade (primary Gleason pattern ? 3 or sum of Gleason score ? 7, P = .015 and .027). /// TMPRSS2-ERG gene fusion and clinicopathologic characteristics of Korean prostate cancer patients.. /// Prostate cancer with large cribriform glands revealed rare TMPRSS2-ERG gene fusion.. /// The fusion rate of the TMPRSS2-ERG gene was 20.9% (53/254).
TMPRSS2_ERG- 26692910prostate cancer FISH - About half of all prostate cancers harbor the TMPRSS2:ERG (T2E) gene fusion.
TMPRSS2_ERG- 24815454prostate cancer FISH - TMPRSS2:ERG gene fusions in prostate cancer have a dominant prevalence of approximately 50.0%, but infomration is limited on differences among ethnic and geographical groups. /// "TMPRSS2:ERG, TMPRSS2:ETV1 and TMPRSS2:ETV4 fusions were tested by multi-probe fluorescence in situ hybridization (FISH) assay. " /// "We evaluated TMPRSS2:ERG, TMPRSS2:ETV1 and TMPRSS2:ETV4 fusions in more than 100 Eastern Chinese prostate cancer patients. " /// There are more deletion pattern than insertion pattern in TMPRSS2:ERG positive cases.
TMPRSS2_ERG- 20878952prostate cancer FISH - TMPRSS2-ERG gene fusion prevalence and class are significantly different in prostate cancer of Caucasian, African-American and Japanese patients.. /// Future studies of the molecular pathways implicated in TMPRSS2-ERG gene fusion may shed light on the disparity in prevalence and mortality of PCa among different ethnic groups and help design better prevention and treatment strategies.. /// "A multivariate analysis demonstrated that TMPRSS2-ERG gene fusion correlated with the ethnicity (P=0.03), marginally correlated with the pathologic stage (P=0.06), but not other clinicopathologic parameters, including age, preoperative PSA levels, and Gleason score. " /// "We examined the prevalence and class of TMPRSS2-ERG gene fusion in PCa from Caucasian, African-American, and Japanese patients. " /// "TMPRSS2-ERG gene fusion was present in 50% (21/42) of Caucasians, 31.3% (20/64) of African-Americans, and 15.9% (7/44) of Japanese (P=0.003). " /// "The prevalence and class of TMPRSS2-ERG are significantly different in PCa of Caucasian, African-American, and Japanese patients. "
TMPRSS2_ERG- 17059688prostate cancer FISH - Importantly, by fluorescence in situ hybridization, we confirmed the presence or the absence of TMPRSS2:ERG gene fusions in matched prostate cancer tissue samples from three of three patients with fusion transcripts in their urine and from two of two patients without fusion transcripts in their urine. /// These results demonstrate that TMPRSS2:ERG gene fusions can be detected in the urine of patients with prostate cancer and support larger studies on prospective cohorts for noninvasive detection of prostate cancer.. /// "We observed a strong concordance between ERG overexpression and TMPRSS2:ERG expression, with 8 of 19 (42%) patients having detectable TMPRSS2:ERG transcripts in their urine. " /// "We observed a strong concordance between ERG overexpression and TMPRSS2:ERG expression, with 8 of 19 (42%) patients having detectable TMPRSS2:ERG transcripts in their urine." /// "By quantitative polymerase chain reaction, we assessed the expression of ERG and TMPRSS2:ERG transcripts in urine samples obtained after prostatic massage from 19 patients (11 prebiopsy and 8 pre-radical prostatectomy) with prostate cancer. "
TMPRSS2_ERG- 17527075prostate cancer FISH - If we consider the high incidence of PCA and the high frequency of this gene fusion, TMPRSS2-ERG is the most common genetic aberration so far described in human malignancies.
TMPRSS2_ERG- 25252136prostate cancer FISH - Prevalence and prognostic significance of TMPRSS2-ERG gene fusion in lymph node positive prostate cancers.. /// TMPRSS2-ERG gene fusion is the most frequent genetic alteration in prostate cancer. /// Concordance in TMPRSS2-ERG status between primary tumors and metastases was 70.9% (Kappa 0.39).
TMPRSS2_ERG- 21743434prostate cancer;adenocarcinoma FISH - Each tissue microarray spot was scored for the presence of TMPRSS2-ERG gene fusion and for ERG gene copy number gains. /// The role of TMPRSS2-ERG gene fusion in prostate cancer prognostication remains controversial.
TMPRSS2_ERG- 21773753prostate cancer FISH - TMPRSS2-ERG, the most common gene fusion in prostate cancer, is associated with expression of a truncated protein product of the oncogene ERG.
TMPRSS2_ERG- 21814574prostate cancer FISH;PCR - A large percentage of prostate cancers harbor TMPRSS2-ERG gene fusions, leading to aberrant overexpression of the transcription factor ERG.
TMPRSS2_ERG- 19933109prostate cancer FISH - Subsequent exposure of the cells to gamma irradiation, which causes DNA double-strand breaks, facilitates the formation of the TMPRSS2-ERG gene fusion.
TMPRSS2_ERG- 17385188prostate cancer;breast cancer;colon cancer FISH - Morphological features of TMPRSS2-ERG gene fusion prostate cancer.. /// The biological effect of TMPRSS2-ERG overexpression may drive pathways that favour these common morphological features that pathologists observe daily.
TMPRSS2_ERG- 20651988prostate cancer;prostatic intraepithelial neoplasia FISH - TMPRSS2-ERG gene fusions occur in 50% of prostate cancers and result in the overexpression of a chimeric fusion transcript that encodes a truncated ERG product. /// TMPRSS2-ERG gene fusions occur in 50% of prostate cancers and result in the overexpression of a chimeric fusion transcript that encodes a truncated ERG product. /// "Epitomics, Burlingame, CA) using immunoblot analysis on prostate cancer cell lines, synthetic TMPRSS2-ERG constructs, chromatin immunoprecipitation, and immunofluorescence. " /// "Here, we characterize a rabbit anti-ERG monoclonal antibody (clone EPR 3864; Epitomics, Burlingame, CA) using immunoblot analysis on prostate cancer cell lines, synthetic TMPRSS2-ERG constructs, chromatin immunoprecipitation, and immunofluorescence."
TMPRSS2_ERG- 24195515prostate cancer FISH - We demonstrated a statistically significant positive correlation between the percentage of cells with fusion gene TMPRSS2-ERG in CaP and metastatic potential of tumors (p=0.011). /// "The aim of this study was to analyse expression of AR, TOP2B and ERG in relation to TMPRSS2-ERG gene rearrangement and relevant clinicopathological characteristics in prostate cancer (CaP). "
TMPRSS2_ERG- 23701505prostate cancer FISH - To study prostate cancer zonal differences in TMPRSS2-ERG gene rearrangement. /// TMPRSS2-ERG FISH and ERG protein immunohistochemistry were performed on tissue microarrays. /// TMPRSS2-ERG rearrangement in dominant anterior prostatic tumours: incidence and correlation with ERG immunohistochemistry. /// ERG immunohistochemistry demonstrated excellent sensitivity (86%) and specificity (96%) for TMPRSS2-ERG rearrangement. /// ERG immunohistochemistry demonstrated excellent sensitivity (86%) and specificity (96%) for TMPRSS2-ERG rearrangement. /// "TMPRSS2-ERG rearrangement occurs in dominant TZ and anterior PZ prostate cancers, with all rearranged TZ cancers in this cohort showing deletion. " /// TMPRSS2-ERG rearrangement in dominant anterior prostatic tumours: incidence and correlation with ERG immunohistochemistry..
TMPRSS2_ERG- 25591593prostate cancer FISH - This study investigated differences in prevalence of the androgen-regulated transmembrane protease serine 2 (TMPRSS2) and ETS transcription factor family member, v-ets erythroblastosis virus E26 oncogene homolog (ERG) fusion gene (TMPRSS2-ERG fusions) in clinically localized prostate cancer Japanese and German patients.
TMPRSS2_ERG7p21.2 / 16951139prostate cancer FISH - In the current study using fluorescence in situ hybridization (FISH), we identified the TMPRSS2:ERG rearrangements in 49.2% of 118 primary prostate cancers and 41.2% of 18 hormone-naive lymph node metastases. /// The FISH assay detected intronic deletions between ERG and TMPRSS2 resulting in TMPRSS2:ERG fusion in 60.3% (35 of 58) of the primary TMPRSS2:ERG prostate cancers and 42.9% (3 of 7) of the TMPRSS2:ERG hormone-naive lymph node metastases. /// The deletion as cause of TMPRSS2:ERG fusion is associated with clinical features for prostate cancer progression compared with tumors that lack the TMPRSS2:ERG rearrangement.. /// A significant association was observed between TMPRSS2:ERG rearranged tumors through deletions and higher tumor stage and the presence of metastatic disease involving pelvic lymph nodes. /// This study confirms that TMPRSS2:ERG is fused in approximately half of the prostate cancers through deletion of genomic DNA between ERG and TMPRSS2.
TMPRSS2_ERG- 25870120adenoid cystic carcinoma FISH - We also examined EGFR amplification and TMPRSS2-ERG gene rearrangement by fluorescence in situ hybridization. /// "The TMPRSS2-ERG rearrangement was not detected in any of the tumors studied, nor was ERG protein positivity identified by immunostaining. "
TMPRSS2_ERG- 26752304prostate cancer FISH - We tested the prognostic utility of a three-marker fluorescent in situ hybridization (FISH) panel (TMPRSS2/ERG rearrangements, AR gain, and PTEN deletion) in a retrospective cohort (n = 210. /// "First, PTEN deletion without TMPRSS2/ERG rearrangement was enriched in pT3/4 tumors (70% versus 48%) and tumors with Gleason grades of 8 to 9 (60% versus 17%) compared with the entire cohort. " /// "Second, AR gain and concurrent trisomy 10 without TMPRSS2/ERG rearrangement were enriched in pT3/4 tumors and tumors with Gleason grades of 8 to 9. "
TMPRSS2_ERG- 24098661prostate cancer FISH - A three-marker FISH panel detects more genetic aberrations of AR, PTEN and TMPRSS2/ERG in castration-resistant or metastatic prostate cancers than in primary prostate tumors.. /// "We analyzed 110 primary prostate cancer samples, 70 metastatic tumor samples from 11 patients, and 27 xenograft tissues derived from 22 advanced prostate cancer patients using fluorescence in situ hybridization (FISH) analysis with probes targeting the TMPRSS2/ERG, PTEN, and AR gene loci. " /// " TMPRSS2/ERG rearrangement, PTEN gene deletion, and androgen receptor (AR) gene amplification have been observed in various stages of human prostate cancer. "
TMPRSS2_ERG- 25625310prostate cancer FISH - Prostate cancer is characterized by structural rearrangements, most frequently including translocations between androgen-dependent genes and members of the ETS family of transcription factor like TMPRSS2:ERG.
TMPRSS2_ERG- 20616363prostate cancer FISH - Fluorescently labeled probes specific for ERG-related rearrangements involving the TMPRSS2-ERG fusion as well as TMPRSS2-ETV1 and TMPRSS2-ETV4 were used to assess samples for gene rearrangements indicative of malignancy under a design of sequential trial.
TMPRSS2_ERG- 17334343prostate cancer FISH - As intronic loss of genomic DNA between TMPRSS2 and ERG has been identified as a mechanism of TMPRSS2:ERG fusion, our assays allowed us to detect deletion of the 3' end of TMPRSS2 and the 5' end of ERG in 41 and 39% of cases rearranged for respective genes. /// "As intronic loss of genomic DNA between TMPRSS2 and ERG has been identified as a mechanism of TMPRSS2:ERG fusion, our assays allowed us to detect deletion of the 3' end of TMPRSS2 and the 5' end of ERG in 41 and 39% of cases rearranged for respective genes. " /// "Overall, 54 and 2% of cases demonstrated TMPRSS2:ERG and TMPRSS2:ETV1 fusions, respectively. "
TMPRSS2_ERG- 20473283prostate cancer FISH - Aim of this study was to assess, whether the ERG rearrangement and the distinct deletion site between TMPRSS2 and ERG, both predominantly resulting in a TMPRSS2-ERG fusion, occur in tumors other than prostate cancer.
TMPRSS2_ERG- 26060265prostate cancer FISH - TMPRSS2-ERG fluorescence in situ hybridisation (FISH) analyses were performed in 74 biopsies using the FISH ZytoLight TriCheck Probe (SPEC ERG/TMPRSS2).
TMPRSS2_ERG- 23352841prostate cancer FISH - Since the identification of the TMPRSS2-ERG rearrangement as the most common fusion event in prostate cancer, various methods have been developed to detect this rearrangement and to study its prognostic significance.
TMPRSS2_ERG- 19649210prostate cancer FISH - This study demonstrates that most ERG-overexpressing prostate cancers harbor hormonally regulated TMPRSS2-ERG, SLC45A3-ERG, or NDRG1-ERG fusions. /// "This study demonstrates that most ERG-overexpressing prostate cancers harbor hormonally regulated TMPRSS2-ERG, SLC45A3-ERG, or NDRG1-ERG fusions." /// "Unlike TMPRSS2-ERG and SCL45A3-ERG fusions, the NDRG1-ERG fusion is predicted to encode a chimeric protein. "
TMPRSS2_ERG- 17637754prostate cancer FISH - The FISH assays detected separation of 5' (labelled green) and 3' (labelled red) ERG sequences, which is a consequence of the TMPRSS2-ERG fusion, and additionally identify interstitial deletion of genomic sequences between the tandemly located TMPRSS2 and ERG gene sequences on chromosome 21.
TMPRSS2_ERG- 20442300prostate cancer FISH - There was no association between TMPRSS2:ERG fusion and prognosis, suggesting that TMPRSS2:ERG rearrangement does not implicate hormone dependence of the cancer.
TMPRSS2_ERG- 20719821adenocarcinoma;prostatic intraepithelial neoplasia FISH - The largest of the classic p63-negative tumors showed a TMPRSS2-ERG translocation by fluorescent in situ hybridization while the p63-positive tumor did not.
TMPRSS2_ERG- 25563374prostate cancer FISH - We present recent findings on?PCA3?and TMPRSS:ERG fusion and assessed the relationship between PSA, urine?PCA3?and TMPRSS2:ERG and corelation with pathological findings. /// "We present recent findings on?PCA3?and TMPRSS:ERG fusion and assessed the relationship between PSA, urine?PCA3?and TMPRSS2:ERG and corelation with pathological findings. " /// TMPRSS2:ERG gene was correllated with the Gleason score. /// We also examined the TMPRSS2:ERG gene in patients who had positive biopsy. /// Neither the TMPRSS2:ERG (p=0.13) nor the MSMB (p=0.556) genotype had an influence on the value of the Gleason score.
TMPRSS2_ERG- 23708657prostate cancer - - Recently, the TMPRSS2:ERG gene fusion, which results in the aberrant expression of the transcription factor ERG, has been shown to be the most common gene rearrangement in PCa. /// "In this study on TMPRSS2:ERG regulation in PCa, we used an androgen receptor and TMPRSS2:ERG fusion double-negative PCa cell model: PC3c. " /// "In three cell clones with different TMPRSS2:ERG expression levels, ectopic expression of the fusion resulted in significant induction of cell migration and invasion in a dose-dependent manner. " /// "In agreement with this phenotype, high-throughput microarray analysis revealed that a set of genes, functionally associated with cell motility and invasiveness, were deregulated in a dose-dependent manner in TMPRSS2:ERG-expressing cells. " /// "In line with these findings, there was evidence that TMPRSS2:ERG directly and positively regulates MMP9 and PLXNA2 expression in PC3c cells. " /// "Moreover, PLXNA2 upregulation contributed to TMPRSS2:ERG-mediated enhancements of PC3c cell migration and invasion. " /// Identification of novel TMPRSS2:ERG mechanisms in prostate cancer metastasis: involvement of MMP9 and PLXNA2.. /// "Importantly, we identified increased MMP9 (Metalloproteinase 9) and PLXNA2 (Plexin A2) expression in TMPRSS2:ERG-positive PCa samples, and their expression levels were significantly correlated with ERG expression in a PCa cohort. "
TMPRSS2_ERG- 25485532prostate cancer - - The TMPRSS2-ERG gene fusion is one of the most widely spread chromosomal rearrangements in carcinomas. /// "Although the TMPRSS2-ERG gene fusion appears to be a suitable diagnostic biomarker, the prognostic implications of this gene fusion are still unclear. " /// TMPRSS2-ERG gene fusion in prostate cancer..
TMPRSS2_ERG- 26880803prostate cancer;adenocarcinoma - - TMPRSS2-ERG gene fusions that occur frequently in human prostate cancers can be generated either through insertional chromosomal rearrangement or by intrachromosomal deletion. /// "In this study, we characterized two mouse models recapitulating TMPRSS2-ERG insertion or deletion events in the background of prostate-specific PTEN deficiency. " /// "Collectively, our findings established that Ets2 is a tumor suppressor gene in prostate cancer, and its loss along with other genes within the TMPRSS2-ERG interstitial region contributes to disease progression. "
TMPRSS2_ERG- 25266362prostate cancer - - The highly sensitive PRISM-SRM assays provided confident detection of 6 unique ERG peptides in both TMPRSS2-ERG positive cell lines and tissues, but not in cell lines or tissues lacking the TMPRSS2-ERG rearrangement, clearly indicating that ERG protein expression is significantly increased in the presence of the TMPRSS2-ERG gene fusion. /// "Studies of TMPRSS2-ERG gene fusions have seldom been performed at the protein level, primarily due to the lack of high-quality antibodies suitable for quantitative studies. " /// "Three peptides, shared across almost all fusion protein products, were determined to be the most abundant peptides, providing ""signature"" peptides for detection of ERG over-expression resulting from TMPRSS2-ERG gene fusion. " /// The PRISM-SRM assays provide valuable tools for studying TMPRSS2-ERG gene fusion protein products in prostate cancer.. /// "Significantly, our results provide evidence that two distinct ERG protein isoforms are simultaneously expressed in TMPRSS2-ERG positive samples as evidenced by the concomitant detection of two mutually exclusive peptides in two patient tumors and in the VCaP prostate cancer cell line. "
TMPRSS2_ERG- 22076164prostate cancer;ovarian cancer - - TMPRSS2:ERG is a gene fusion resulting from the chromosomal rearrangement of the androgen-regulated TMPRSS2 gene and the ETS transcription factor ERG, leading to the over-expression of the oncogenic molecule ERG. /// " TMPRSS2:ERG is a gene fusion resulting from the chromosomal rearrangement of the androgen-regulated TMPRSS2 gene and the ETS transcription factor ERG, leading to the over-expression of the oncogenic molecule ERG. " /// These results suggest that the oncogenic gene fusion TMPRSS2:ERG does not occur in ovarian cancer relative to prostate cancer. /// The oncogenic gene fusion TMPRSS2: ERG is not a diagnostic or prognostic marker for ovarian cancer.. /// "However, little is known about the role of the TMPRSS2:ERG gene fusion in ovarian cancer. "
TMPRSS2_ERG- 17079440prostate cancer PCR - Seven cases showed TMPRSS2:ERG gene fusions, whereas the TMPRSS2:ETV4 fusion was seen in one case. /// "In summary, our data indicate that the TMPRSS2:ERG translocation is common in advanced prostate cancer and occurs by virtue of unbalanced genomic rearrangements. "
TMPRSS2_ERG- 25088707prostate cancer - - Aberrant overexpression of ERG induced by the TMPRSS2-ERG gene fusion is likely involved in the development of prostate cancer. /// "In the present study, we designed a PI polyamide targeting TMPRSS2-ERG translocation breakpoints and assessed its effect on human prostate cancer cells. "
TMPRSS2_ERG- 23381693prostate cancer - - The TMPRSS2-ERG gene fusion resulting in ERG overexpression has been found in around 50% of prostate cancers (PCa) and is a very early event in tumorigenesis. /// The TMPRSS2-ERG gene fusion resulting in ERG overexpression has been found in around 50% of prostate cancers (PCa) and is a very early event in tumorigenesis.
TMPRSS2_ERG- 23410972prostate cancer - - Whereas EO-PCAs harbored a prevalence of balanced SRs, with a specific abundance of androgen-regulated ETS gene fusions including TMPRSS2:ERG, elderly-onset PCAs displayed primarily non-androgen-associated SRs.
TMPRSS2_ERG- 25518340prostate cancer - - TMPRSS2-ERG gene fusion is one of the most prevalent signatures in CRPC.
TMPRSS2_ERG- 24445294prostate cancer - - Whereas EO-PCAs harbored a prevalence of balanced SRs, with a specific abundance of androgen-regulated ETS gene fusions including TMPRSS2:ERG, elderly-onset PCAs displayed primarily non-androgen-associated SRs.
TMPRSS2_ERG- 26921337prostate cancer - - However, TMPRSS2-ERG gene fusions and PTEN losses occurred in only 21% and 8% of the African American patients, respectively, far less common than in patients of European ancestry.
TMPRSS2_ERG- 23204237prostate cancer - - In this study, we examined a series of adjacent G3 and Gleason pattern 4 (G4) tumors in radical prostatectomy specimens and found that all were concordant for the TMPRSS2:ERG gene fusion.
TMPRSS2_ERG- 17584912prostate cancer - - Microdeletion and concurrent translocation associated with a complex TMPRSS2:ERG prostate cancer gene fusion..
TMPRSS2_ERG- 21036922prostate cancer - - The novel gene fusions are found to be of low frequency, but, interestingly, the non-ETS fusions were all present in prostate cancer harboring the TMPRSS2-ERG gene fusion.
TMPRSS2_ERG- 17032499prostate cancer;prostatic intraepithelial neoplasia - - TMPRSS2-ERG gene fusion causing ERG overexpression precedes chromosome copy number changes in prostate carcinomas and paired HGPIN lesions.. /// "To determine the relative order of genetic events in prostate carcinogenesis, we have analyzed 34 prostate carcinomas, 19 paired HGPIN lesions, 14 benign prostate hyperplasias, and 11 morphologically normal prostatic tissues for TMPRSS2-ERG and TMPRSS2-ETV1 rearrangements and genomic imbalances. "
TMPRSS2_ERG- 20478527prostate cancer - - An integrated network of androgen receptor, polycomb, and TMPRSS2-ERG gene fusions in prostate cancer progression.. /// These findings provide a working model in which TMPRSS2-ERG plays a critical role in cancer progression by disrupting lineage-specific differentiation of the prostate and potentiating the EZH2-mediated dedifferentiation program..
TMPRSS2_ERG- 21377967prostate cancer - - TMPRSS2-ERG is the most common gene fusion type. /// The ERG overexpression induced by TMPRSS2-ERG gene fusion contributes to the development of prostate cancer. /// "TMPRSS2-ERG gene fusion functions as a biomarker for prostate cancer, which can be easily detected in urine. "
TMPRSS2_ERG- 23578236prostate cancer - - Real-time quantitative polymerase chain reaction analysis and in some cases DNA sequencing was used to validate the presence and the expression levels of TMPRSS2-ERG gene fusions. /// In our series of patients with prostate cancer over expression of the ERG gene predicted the presence of TMPRSS2-ERG rearrangements in almost all cases. /// The expression level of the TMPRSS2-ERG gene was studied in various histological grades of prostate cancer and castration-resistant prostate cancer (CPRC). /// " To assess whether oestrogen-regulated gene (ERG) expression analysis using GeneChip arrays can predict transmembrane protease, serine 2 (TMPRSS2)-ERG fusion. "
TMPRSS2_ERG- 23625457prostate cancer;sarcoma - - The recent discovery of a recurrent gene fusion TMPRSS2-ERG in approximately half of the prostate cancers tested indicates that gene fusions also play a role in the onset of common epithelial cancers.
TMPRSS2_ERG- 24115205prostate cancer PCR - Quality assessment was conducted using spectrophotometric analysis and RNA was analyzed for RNA integrity number (RIN) and by real-time reverse-transcription PCR (qRT-PCR) for racemase, hepsin, ERG, TMPRSS2-ERG gene fusions, and the microRNAs miR-26a, miR-26b, miR-141, and miR-221.
TMPRSS2_ERG- 19644960prostate cancer PCR - The neoplastic nature of the cells was verified by detection of the TMPRSS2/ERG gene fusion expression.
TMPRSS2_ERG- 26011342prostate cancer PCR;RT-PCR - PCA3 overexpression, GSTP1 promoter hyper-methylation, TMPRSS2-ERG gene fusions, IVS1-27G>A in the KLF6 gene and mutations in androgen receptor (AR) gene, for diagnostic purposes were assessed.
TMPRSS2_ERG- 26665675prostate cancer PCR;RT-PCR - TMPRSS2:ERG gene fusion was associated with higher pathological grades of prostate cancer.. /// To study the relationship between TMPRSS2: ERG gene fusion and the pathological grade of prostate cancer (PCa). /// "The TMPRSS2: ERG fusion gene was detected in 28 (45.16%) of the PCa cases, but in none of the 10 BPH cases or the 9 cancer cell strains. " /// "We examined the TMPRSS2:ERG fusion gene in the PCa samples by nest RT-PCR, compared the Gleason scores between the TMPRSS2:ERG-positive and -negative cases, and analyzed the association of TMPRSS2: ERG fusion with the pathological features of PCa. " /// [Relationship between TMPRSS2: ERG and the pathological grade of prostate cancer].. /// "No statistically significant differences were found in the Gleason scores between the TMPRSS2:ERG-positive and -negative cases (Z = -0.609, P = 0.542), but the primary Gleason score was markedly higher in the former than in the latter (Z = -2.600, P = 0.009). " /// "Univariate logistic regression analysis showed that TMPRSS2:ERG was associated with the cribriform growth pattern (OR = 6.250, P = 0.002), foamy gland morphology (OR = 6.666, P = 0.023), and signet-ring cells (OR = 3.240, P = 0.035), but multivariate logistic regression analysis manifested that it was associated with the cribriform growth pattern only (OR = 3.750, P = 0.033). "
TMPRSS2_ERG- 25753984prostate cancer PCR;RT-PCR - PCA3 overexpression, TMPRSS2-ERG gene fusion, GSTP1 promoter hypermethylation, somatic mutations in the AR gene and the IVS1-27G > A polymorphism in the KLF6 gene were studied. /// The TMPRSS2-ERG positive status correlates with moderate to poorly differentiated prostate tumors and it is considered as unfavorable disease predictor.
TMPRSS2_ERG- 24297949prostate cancer;prostatic intraepithelial neoplasia - - TMPRSS2:ERG gene fusion predicts subsequent detection of prostate cancer in patients with high-grade prostatic intraepithelial neoplasia..
TMPRSS2_ERG- 21307934prostate cancer - - Rearrangement breakpoints were enriched near open chromatin, androgen receptor and ERG DNA binding sites in the setting of the ETS gene fusion TMPRSS2-ERG, but inversely correlated with these regions in tumours lacking ETS fusions. /// "Rearrangement breakpoints were enriched near open chromatin, androgen receptor and ERG DNA binding sites in the setting of the ETS gene fusion TMPRSS2-ERG, but inversely correlated with these regions in tumours lacking ETS fusions. "
TMPRSS2_ERG- 23480797prostate cancer - - The TMPRSS2-ERG gene fusion, the most common gene fusion, is found in approximately 50% of prostate cancer cases.
TMPRSS2_ERG- 17390040prostate cancer PCR;RT-PCR - Molecular genetic analyses of the TMPRSS2-ERG and TMPRSS2-ETV1 gene fusions in 50 cases of prostate cancer..
TMPRSS2_ERG- 17172822prostate cancer PCR;RT-PCR - Expression of TMPRSS2:ERG gene fusion in prostate cancer cells is an important prognostic factor for cancer progression.. /// "However, the clinical significance of TMPRSS2:ERG gene fusion among prostate cancer patients is unknown. " /// "We assayed for the presence of the TMPRSS2:ERG gene fusion product among 26 patients who underwent surgery for clinically localized prostate cancer using RT-PCR and direct DNA sequencing, and evaluated its prognostic significance. "
TMPRSS2_ERG- 17237811prostate cancer - - TMPRSS2:ERG gene fusion associated with lethal prostate cancer in a watchful waiting cohort..
TMPRSS2_ERG- 25728532prostate cancer - - In the United States, half of men with prostate cancer harbor the androgen-regulated gene fusion TMPRSS2:ERG. /// We hypothesized that men with TMPRSS2:ERG positive tumors are more responsive to androgen deprivation therapy (ADT). /// "Our results, combined with those from earlier studies, provide suggestive evidence that men with TMPRSS2:ERG positive tumors may have longer prostate cancer survival after ADT. "
TMPRSS2_ERG- 23578235prostate cancer - - Significance of the TMPRSS2:ERG gene fusion in prostate cancer..
TMPRSS2_ERG- 23478499prostate cancer - - The TMPRSS2-ERG gene fusion has provided insight into the early development of prostate cancer but has not been unequivocally associated with aggressive disease.
TMPRSS2_ERG- 22949099prostate cancer;ductal carcinoma;prostatic intraepithelial neoplasia - - Finally, IDC-P is associated with TMPRSS2-ERG gene fusion, which was reported to be regulated by estrogens and their receptors.
TMPRSS2_ERG- 24505269prostate cancer - - The TMPRSS2-ERG gene fusion is found in approximately half of all prostate cancers. /// "Based on a historical watchful waiting cohort, an association between TMPRSS2-ERG, evaluated as positive immune staining, and shorter survival of prostate cancer patients was identified. " /// TMPRSS2-ERG expression predicts prostate cancer survival and associates with stromal biomarkers.. /// "The functional and prognostic significance of TMPRSS2-ERG is, however, not fully understood. " /// "Novel associations between TMPRSS2-ERG and alterations in the tumor stroma, for example, increased vascular density, hyaluronan and PDGFR? and decreased Caveolin-1, all known to be associated with an aggressive disease, were found. "
TMPRSS2_ERG- 20713528prostate cancer PCR - TMPRSS2-ERG and other gene fusions involving ETS factors and genes with strong promoter elements are common in prostate cancer.
TMPRSS2_ERG- 22424448prostate cancer - - The Formal Concept Analysis (FCA) method was applied to assess whether the TMPRSS2-ERG gene fusion could influence the degree of overexpression of PRDX3 and PRDX4 in prostate cancer. /// Reverse phase protein arrays verified that the overexpression of both PRDX3 and PRDX4 in tumor samples is negatively correlated with the presence of the TMPRSS2-ERG gene fusion.
TMPRSS2_ERG- 20068566prostate cancer - - Recent studies have indicated that prostate cancer patients with the TMPRSS2-ERG gene fusion have a higher risk of recurrence. /// Prostate cancer genes associated with TMPRSS2-ERG gene fusion and prognostic of biochemical recurrence in multiple cohorts.. /// "RNA from radical prostatectomy tumour specimens was analysed using cDNA-mediated, annealing, selection, extension and ligation (DASL) to determine mRNAs associated with TMPRSS2-ERG T1/E4 fusion and prognostic of biochemical recurrence. " /// "TMPRSS2-ERG T1/E4 fusion-positive tumours had differentially regulated mRNAs observed in multiple studies, the most significant one coded for ERG. "
TMPRSS2_ERG- 20145164- - - Studies of TMPRSS2-ERG gene fusions in diagnostic trans-rectal prostate biopsies..
TMPRSS2_ERG- 22505341prostate cancer;adenocarcinoma PCR - TMPRSS2-ERG is the most common gene fusion in PCa, whereas activation of telomerase is a common feature of various malignancies. /// "The cases negative for both transcripts, TMPRSS2-ERG and TERT, rarely recurred (P=0.014) and showed significantly longer biochemical recurrence-free period (P=0.022) as compared to the TMPRSS2-ERG and/or TERT-positive cases. " /// The results of our study suggest that combined analysis of TMPRSS2-ERG and TERT expression can be a valuable tool for early prediction of biochemical recurrence of PCa after radical prostatectomy.. /// "In total, 74% (117/158) of the prostate adenocarcinomas were positive for the TMPRSS2-ERG and/or TERT expression. " /// Combined analysis of TMPRSS2-ERG and TERT for improved prognosis of biochemical recurrence in prostate cancer..
TMPRSS2_ERG- 22421313prostate cancer - - The androgen-regulated gene fusion TMPRSS2-ERG could be used to clarify both the cells of origin and the evolution of prostate cancer cells.
TMPRSS2_ERG- 24054868prostate cancer - - Consistent with the notion of CACNA1D as an ERG-regulated gene, CACNA1D gene expression levels were significantly higher in prostate cancers with TMPRSS2-ERG gene fusion compared with the cases without this gene fusion.
TMPRSS2_ERG- 20598135prostate cancer - - CTCs were successfully enriched and detected in men with advanced prostate cancer using an immunomagnetic enrichment procedure coupled with amplified molecular assays for PSA, PCA3, and TMPRSS2:ERG gene fusion mRNAs. /// "The purpose of our study was to investigate an immunomagnetic fractionation procedure to enrich circulating prostate tumor cells (CTCs) from peripheral blood specimens, and to apply amplified molecular assays for the detection of prostate-specific markers (PSA, PCA3 and TMPRSS2:ERG gene fusion mRNAs). "
TMPRSS2_ERG- 25852077prostate cancer - - Obesity and Prostate Cancer Risk According to Tumor TMPRSS2:ERG Gene Fusion Status..
TMPRSS2_ERG- 23849895prostate cancer;adenocarcinoma - - TMPRSS2-ERG is the most common gene fusion in conventional prostatic adenocarcinoma (PCa), identified in about 40% to 70% of cases.
TMPRSS2_ERG- 24418414prostate cancer PCR - We found that NKX3.1 directly binds to TMPRSS2 upstream sequences and negatively regulates the expression of the ERG protooncogene through the TMPRSS2-ERG gene fusion. /// "Although, the androgenic activation of TMPRSS2 gene has been established, little is known about other elements that may interact with TMPRSS2 promoter sequences to modulate ERG expression in TMPRSS2-ERG gene fusion context. "
TMPRSS2_ERG- 20147525prostate cancer - - 1{alpha},25-Dihydroxyvitamin D3 inhibits growth of VCaP prostate cancer cells despite inducing the growth-promoting TMPRSS2:ERG gene fusion.. /// "However, the effects of VDR activation have not been examined in the presence of the recently identified androgen-regulated TMPRSS2:ERG gene fusions, which occur in a high percentage of prostate cancers and play a role in growth and invasiveness. " /// "In VCaP cells, we were not able to prevent EB1089-mediated TMPRSS2:ERG induction with an androgen receptor antagonist, Casodex, although in LNCaP cells, as reported for some other common androgen receptor and VDR target genes, Casodex reduces EB1089-mediated induction of TMPRSS2. " /// "Here we show that the natural VDR agonist 1alpha,25-dihydroxyvitamin D(3) and its synthetic analog EB1089 increase expression of TMPRSS2:ERG mRNA in VCaP prostate cancer cells. "
TMPRSS2_ERG- 26941365prostate cancer - - The TMPRSS2:ERG gene fusion occurs in roughly 50% of prostate cancers. /// Association of Prostate Cancer Risk Variants with TMPRSS2:ERG Status: Evidence for Distinct Molecular Subtypes..
TMPRSS2_ERG- 23158212prostatic intraepithelial neoplasia - - Immunohistochemical (IHC) staining for ERG is used as a surrogate for TMPRSS2-ERG gene fusion, a specific molecular event seen in ~50% of prostate carcinomas (PCas) and ~20% of high-grade prostatic intraepithelial neoplasia (HGPIN) intermingled with adjacent PCa demonstrating identical gene fusions.
TMPRSS2_ERG- 26026052prostate cancer - - The TMPRSS2-ERG Gene Fusion Blocks XRCC4-Mediated Nonhomologous End-Joining Repair and Radiosensitizes Prostate Cancer Cells to PARP Inhibition.. /// We reported that radiosensitization by a PARP inhibitor (PARPi) was highly prominent in prostate cancer cells expressing the TMPRSS2-ERG gene fusion protein. /// DNA-PKcs deficiency caused by TMPRSS2-ERG destabilized critical NHEJ components on chromatin. /// "However, the presence of TMPRSS2-ERG, by inhibiting NHEJ DNA repair, enhanced PARPi-mediated radiosensitization. " /// "VCaP cells, which harbor TMPRSS2-ERG and PC3 cells that stably express it, displayed ?H2AX and 53BP1 foci constitutively, indicating persistent DNA damage that was absent if TMPRSS2-ERG was depleted by siRNA in VCaP cells. " /// DNA-PKcs autophosphorylation was restored to the level of parental cells when TMPRSS2-ERG was depleted by siRNA. /// "The extent of DNA damage was enhanced and associated with TMPRSS2-ERG's ability to inhibit DNA-PKcs function, as indicated by its own phosphorylation (Thr2609, Ser2056) and that of its substrate, Ser1778-53BP1. " /// "Therefore, by inhibiting NHEJ, TMPRSS2-ERG provides a synthetic lethal interaction with PARPi in prostate cancer patients expressing TMPRSS2-ERG.. " /// "Here, we show that TMPRSS2-ERG blocks nonhomologous end-joining (NHEJ) DNA repair by inhibiting DNA-PKcs. "
TMPRSS2_ERG- 23565244prostate cancer - - VCaP cells, which harbor the TMPRSS2-ERG gene fusion and PC3 cells that stably express a similar construct (fusion III) showed enhanced sensitivity towards rucaparib, which, in turn, increased the radiation response to a similar extent as the DNA-PKcs inhibitor NU7441. /// "This combination was most effective in the presence of the TMPRSS2-ERG and in the absence of PTEN, indicating clinical potential for brachytherapy in patients with intermediate and high risk PCa.. "
TMPRSS2_ERG- 24768356prostate cancer - - We discuss the genetic basis of CaP progression from localized to systemic disease (e.g., point mutations, copy-number alterations, and structural variants) in relation with unique features of CaP biology, including intraprostatic and interprostatic heterogeneity, multifocality and multiclonality, TMPRSS2:ERG, and other ETS-family gene fusions.
TMPRSS2_ERG- 26990456prostate cancer - - The TMPRSS2-ERG gene fusion is detected in approximately half of primary prostate cancers (PCa) yet the prognostic significance remains unclear.
TMPRSS2_ERG- 22674214prostate cancer - - The TMPRSS2:ERG gene fusion was found in 8.3% of the BPH, 15.6% of the NP, and 50% of the PCa samples. /// The prostate cancer gene 3 (PCA3) and TMPRSS2:ERG gene fusion are promising prostate cancer (PCa) specific biomarkers. /// Rational basis for the combination of PCA3 and TMPRSS2:ERG gene fusion for prostate cancer diagnosis.. /// "Our aim was to simultaneously quantify the expression levels of PCA3 and TMPRSS2:ERG in a panel of benign prostatic hyperplasia (BPH), normal prostate adjacent to PCa (NP) and PCa tissue samples, to provide a rational basis for the understanding of the false-positive and false-negative results of the urine assays. " /// "The mRNA was isolated, transcribed into cDNA and the relative expressions of PCA3 and TMPRSS2:ERG were measured using a quantitative real-time polymerase chain reaction. " /// Some of the control samples did express TMPRSS2:ERG and a cut-off value had to be defined to avoid false-positive results.. /// The expression levels of PCA3 and TMPRSS2:ERG were compared between the different groups. /// "The use of TMPRSS2:ERG in the PCA3 negative cases allowed diagnosis of four of the seven false-negative samples and added one false-positive, but we had to define a cut-off value to avoid eight false-positive results. " /// "Considering tissue expression of the markers, most of the false-negative results of the PCA3 test were corrected by TMPRSS2:ERG (57%) and the combination of both had a higher sensitivity for PCa diagnosis. "
TMPRSS2_ERG- 18059348prostate cancer - - The development of a new method for analyzing expression microarray data, called COPA, has led to the discovery of TMPRSS2-ERG gene fusion involvement in the development of prostate cancer, while expression analysis of castration-resistant prostate cancer has suggested the use of novel therapeutic approaches for advanced disease.
TMPRSS2_ERG- 24292212prostate cancer - - These results suggest that obesity is linked with poorer prostate cancer prognosis primarily in men with tumors harboring the gene fusion TMPRSS2:ERG.. /// TMPRSS2:ERG is a hormonally regulated gene fusion present in about half of prostate tumors. /// "We investigated whether obesity, which deregulates several hormonal pathways, interacts with TMPRSS2:ERG to impact prostate cancer outcomes. " /// ERG overexpression (a TMPRSS2:ERG marker) was assessed by immunohistochemistry of tumor tissue from radical prostatectomy or transurethral resection of the prostate. /// Modification of the association between obesity and lethal prostate cancer by TMPRSS2:ERG..
TMPRSS2_ERG- 26986253prostate cancer - - Experimental studies have shown androgen receptor stimulation to facilitate formation of the TMPRSS2:ERG gene fusion in prostate cell lines. /// No study has tested whether higher pre-diagnostic circulating sex hormone levels in men increase risk of developing TMPRSS2:ERG-positive prostate cancer specifically. /// These findings provide some suggestive evidence that higher pre-diagnostic free testosterone levels are associated with an increased risk of developing TMPRSS2:ERG-positive prostate cancer.. /// "We examined associations between pre-diagnostic circulating levels of total testosterone, free testosterone, DHT, androstanediol glucuronide, estradiol, and SHBG and risk of prostate cancer by TMPRSS2:ERG status. " /// TMPRSS2:ERG was estimated by ERG immunohistochemistry.
TMPRSS2_ERG- 17224639prostate cancer - - TMPRSS2:ERG gene fusion a new genetic marker for prostate cancer progression..
TMPRSS2_ERG- 19013008prostatic intraepithelial neoplasia - - The TMPRSS2-ERG gene fusion recently reported as a potentially aggressive molecular subtype of PCa is regulated by ER-dependent signalling. /// TMPRSS2-ERG expression has been found to be increased by ERalpha agonist (oestrogens) and decreased by ERbeta agonists.
TMPRSS2_ERG- 20596054prostate cancer - - TMPRSS2-ERG gene fusion in transition zone prostate cancer..
TMPRSS2_ERG- 24646496- - - Words of wisdom: Re: TMPRSS2-ERG gene fusions induce prostate tumorigenesis by modulating microRNA miR-200c..
TMPRSS2_ERG- 17043636- - - Interestingly, distinct patterns of hybrid transcripts were found in samples taken from separate regions of individual cancer-containing prostates, suggesting that TMPRSS2-ERG gene fusions may be arising independently in different regions of a single prostate.. /// TMPRSS2-ERG gene fusions have recently been reported to be present in a high proportion of human prostate cancers. /// "In the current study, we show that great diversity exists in the precise structure of TMPRSS2-ERG hybrid transcripts found in human prostates. "
TMPRSS2_ERG- 26310325prostate cancer - - The TMPRSS2-ERG gene fusion occurs in about half of prostate cancer (PCa) cases and results in overexpression of the transcription factor ERG. /// "Finally, we show that PCa patientswho are smokers have larger tumors if their tumors are TMPRSS2-ERG gene fusion positive. "
TMPRSS2_ERG- 24759320prostate cancer - - By contrast with MDV3100, JQ1 functions downstream of AR, and more potently abrogated BRD4 localization to AR target loci and AR-mediated gene transcription, including induction of the TMPRSS2-ERG gene fusion and its oncogenic activity.
TMPRSS2_ERG- 22142399prostate cancer - - The TMPRSS2-ERG gene fusion results in the modulation of transcriptional patterns and cellular pathways with potential consequences for prostate cancer progression. /// TMPRSS2-ERG gene fusions occur in about 50% of all prostate cancer cases and represent promising markers for molecular subtyping. /// TMPRSS2-ERG -specific transcriptional modulation is associated with prostate cancer biomarkers and TGF-? signaling..
TMPRSS2_ERG- 18719366prostate cancer - - Of note, curcumin downregulated transcript encoded by the potentially causal TMPRSS2-ERG gene fusion, a common oncogenic alteration noted in 50-70% of prostate cancer patients.
TMPRSS2_ERG- 26660523- - - The human prostate tumor suppressor NKX3.1 mediates the DNA repair response and interacts with the androgen receptor to assure faithful completion of transcription thereby protecting against TMPRSS2-ERG gene fusion.
TMPRSS2_ERG- 24186205prostate cancer - - Therapeutic delivery of miR-200c may provide personalized treatment for patients with the molecular subtype of PCa that harbors TMPRSS2-ERG gene fusions.. /// TMPRSS2-ERG gene fusions induce prostate tumorigenesis by modulating microRNA miR-200c..
TMPRSS2_ERG- 18065961prostatic intraepithelial neoplasia - - TMPRSS2-ERG gene fusion leading to the androgenic induction of the ERG proto-oncogene expression is a highly prevalent oncogenic alteration in prostate tumor cells. /// "To assess the role of TMPRSS2-ERG alteration in prostate cancer onset and/or progression, we have evaluated the status of fusion transcripts in benign glands, prostatic intraepithelial neoplasia (PIN) and multiple cancer foci of each prostate. " /// Frequent presence of the TMPRSS2-ERG in index tumors suggests critical roles of ERG alterations in the onset and progression of a large subset of prostate cancer. /// TMPRSS2-ERG expression was correlated with clinicopathological features. /// "However, heterogeneity of the TMPRSS2-ERG detection in the context of multiple cancer foci and its frequency in PIN also support the role of other genomic alterations in the origins of prostate cancer.. "
TMPRSS2_ERG- 19136943prostate cancer - - 10) gene fusion in a chronic myelogenous leukaemia cell line and the TMPRSS2-ERG gene fusion in a prostate cancer cell line and tissues.
TMPRSS2_ERG- 26571387prostate cancer - - In VCaP cells, a human prostate cancer cell line overexpressing both AR and the TMPRSS2-ERG gene fusion, an androgen response element (ARE)-targeted Py-Im polyamide significantly downregulates AR driven gene expression.
TMPRSS2_ERG- 25780911prostate cancer;adenocarcinoma - - Genetic interaction between Tmprss2-ERG gene fusion and Nkx3.1-loss does not enhance prostate tumorigenesis in mouse models.. /// Gene fusions involving ETS family transcription factors (mainly TMPRSS2-ERG and TMPRSS2-ETV1 fusions) have been found in ~50% of human prostate cancer cases. /// "In Tmprss2-ERG;Nkx3.1+/- (or -/-) male mice, although we observed a slight but significant upregulation of Tmprss2-ERG fusion expression upon Nkx3.1 loss, we did not detect any significant cooperation between these two genetic events to enhance prostate tumorigenesis in vivo. " /// "Although expression of TMPRSS2-ERG or TMPRSS2-ETV1 fusion alone is insufficient to initiate prostate tumorigenesis, they appear to sensitize prostate epithelial cells for cooperation with additional oncogenic mutations to drive frank prostate adenocarcinoma. " /// "We recently generated knockin mouse models for TMPRSS2-ERG and TMPRSS2-ETV1 fusions, utilizing the endogenous Tmprss2 promoter. " /// "Previous studies have shown that deletions at 8p21 (harboring NKX3.1) and 21q22 (resulting in TMPRSS2-ERG fusion) were both present in a subtype of prostate cancer cases, and that ERG can lead to epigenetic silencing of NKX3.1 in prostate cancer cells, whereas NKX3.1 can in turn negatively regulate TMPRSS2-ERG fusion expression via suppression of the TMPRSS2 promoter activity. "
TMPRSS2_ERG- 24925673prostate cancer - - Experimental data suggest that heightened AR activity facilitates formation of TMPRSS2:ERG, a gene fusion present in approximately 50% of tumors of patients with prostate cancer. /// We undertook a nested case-control study to investigate the hypothesis that shorter CAG repeat length would be associated with prostate cancer risk defined by TMPRSS2:ERG status. /// Our results provide supportive evidence that androgen signaling underlies the development of prostate tumors that harbor TMPRSS2:ERG. /// Androgen receptor CAG repeat polymorphism and risk of TMPRSS2:ERG-positive prostate cancer.. /// "Moreover, these results suggest that TMPRSS2:ERG may represent a unique molecular subtype of prostate cancer with an etiology distinct from TMPRSS2:ERG-negative disease.. " /// These data suggest that shorter CAG repeats are specifically associated with development of TMPRSS2:ERG-positive prostate cancer.
TMPRSS2_ERG- 21676887prostate cancer - - Importantly, 38% of clinically localized prostate cancers and 27% of metastatic prostate cancers harboring the TMPRSS2-ERG gene fusions exhibited overexpression of wild-type ERG. /// "By employing an integrative approach, we show that the TMPRSS2-ERG gene fusion product binds to the ERG locus and drives the overexpression of wild-type ERG in prostate cancers. " /// "Knockdown of TMPRSS2-ERG in VCaP cells resulted in the downregulation of wild-type ERG transcription, whereas stable overexpression of TMPRSS2-ERG in the gene fusion-negative PC3 cells was associated with the upregulation of wild-type ERG transcript. " /// "Further, androgen signaling-mediated upregulation of TMPRSS2-ERG resulted in the concomitant upregulation of wild-type ERG transcription in VCaP cells. "
TMPRSS2_ERG- 23357671prostate cancer - - However, the association between TMPRSS2: ERG gene fusions and the aggressiveness of prostate cancer remains elusive. /// TMPRSS2: ERG gene fusions are the most common types of gene fusions in prostate cancer. /// We hypothesize that some N-terminal truncated ERG proteins encoded by TMPRSS2: ERG fusion genes account for the conflict.
TMPRSS2_ERG- 21575865acute myeloid leukemia;prostate cancer;myeloid leukemia;ewing sarcoma;sarcoma - - We investigate the mechanisms by which ETS fusions mediate their effects, and find that the product of the predominant ETS gene fusion, TMPRSS2:ERG, interacts in a DNA-independent manner with the enzyme poly (ADP-ribose) polymerase 1 (PARP1) and the catalytic subunit of DNA protein kinase (DNA-PKcs).
TMPRSS2_ERG- 21394739prostate cancer - - The effect of TMPRSS2/ERG gene fusions had differing effects on radiosensitivity and chemosensitivity depending on cell line and fusion type. /// Further work is needed with clinical samples to establish whether TMPRSS2/ERG gene fusions affect radio- and chemosensitivity in vivo.. /// "Expression of TMPRSS2/ETS-related gene (ERG) fusion gene transcripts is linked with tumor proliferation, invasion, and an aggressive phenotype. " /// Clonogenic survival of PC3 and DU145 cells stably expressing TMPRSS2/ERG Types III and VI fusion genes was measured after X-irradiation (0-8?Gy) and Paclitaxel.
TMPRSS2_ERG- 21499236prostate cancer;adenocarcinoma PCR - The TMPRSS2-ERG gene fusion that leads to ERG overexpression occurs in ~70% of prostate cancers. /// ERG overexpression was due to TMPRSS2-ERG gene fusion in all cases.
TMPRSS2_ERG- 23086769prostate cancer - - ERG rearrangements (most commonly transmembrane protease, serine 2 [TMPRSS2]:ERG [T2:ERG] gene fusions) have been identified in approximately 50% of prostate cancers . /// Correlation of urine TMPRSS2:ERG and PCA3 to ERG+ and total prostate cancer burden..
TMPRSS2_ERG- 20693979prostate cancer RT-PCR - The incidence and clinical significance of the TMPRSS2:ERG gene fusion in prostate cancer has been investigated with contradictory results. /// Total RNA from 194 formalin-fixed and paraffin-embedded prostate cancer samples obtained by radical prostatectomy was subjected to reverse-transcriptase polymerase chain reaction to detect the common TMPRSS2:ERG T1-E4 and T1-E5 fusion transcripts and five other non-TMPRSS2:ERG fusion transcripts. /// "To exclude the possibility that Japanese prostate cancer displays novel TMPRSS2:ERG transcript variants or has unique 5' fusion partners for the ETS genes, we performed 5' RACE using fresh-frozen prostate cancer samples. " /// Internodular heterogeneity of TMPRSS2:ERG was observed in 5 out of 11 multifocal cases (45%). /// "The frequencies of both TMPRSS2:ERG- and non-TMPRSS2:ERG-positive cases were lower than those reported for European, North American or Brazilian patients. " /// "We identified 54 TMPRSS2:ERG-positive cases (54/194, 28%) and two HNRPA2B1:ETV1-positive cases (2/194, 1%). " /// "Because we identified a relatively low frequency of TMPRSS2:ERG and other fusions, further evaluation is required before this promising molecular marker should be introduced into the management of Japanese prostate cancer patients.. "
TMPRSS2_ERG- 24406865intraductal carcinoma - - TMPRSS2-ERG is the most common gene fusion in conventional prostatic adenocarcinoma, identified in about 40-70% of cases.
TMPRSS2_ERG- 20303538prostate cancer - - Clinical implications of TMPRSS2-ERG gene fusion expression in patients with prostate cancer treated with radical prostatectomy.. /// "In the nonexpressing TMPRSS2-ERG group the prognostic factors were cT, Gleason score and margins. "
TMPRSS2_ERG- 26478752prostate cancer - - Prostate cancer (PC) can be stratified into distinct molecular subtypes based on TMPRSS2-ERG gene fusion status, but its potential prognostic value remains controversial.
TMPRSS2_ERG- 18519767prostate cancer;prostatic intraepithelial neoplasia - - The TMPRSS2-ERG gene fusion that has recently been described in prostate cancer has also been shown to occur in a subset of HGPIN. /// "In this study, we assessed a series of HGPIN lesions and paired prostate cancer for the presence of TMPRSS2-ERG gene fusion. " /// "Given the more aggressive nature of TMPRSS2-ERG prostate cancer, the findings of this study raise the possibility that gene fusion-positive HGPIN lesions are harbingers of more aggressive disease. "
TMPRSS2_ERG- 17971772prostate cancer PCR;RT-PCR - We tested for the presence of TMPRSS2:ERG gene fusion product, using RT-PCR and direct sequencing. /// The prognostic significance of the presence of the TMPRSS2:ERG gene fusion product remains controversial.
TMPRSS2_ERG- 19204029prostate cancer - - The isolated exosomes also contained RNA, including the gene fusion TMPRSS2-ERG product.
TMPRSS2_ERG- 18231617prostate cancer - - Common genetic alterations in prostate cancer patients have been identified, including CpG hypermethylation of GSPT1 and TMPRSS2:ERG gene fusion.
TMPRSS2_ERG- 23918607prostate cancer - - Preclinical data suggest that TMPRSS2-ERG gene fusions, present in about 50% of prostate cancers, may be a surrogate for DNA repair status and therefore a biomarker for DNA-damaging agents. /// TMPRSS2-ERG status is not prognostic following prostate cancer radiotherapy: implications for fusion status and DSB repair.. /// "To test this hypothesis, we examined whether TMPRSS2-ERG status was associated with biochemical failure after clinical induction of DNA damage following image-guided radiotherapy (IGRT). " /// The potential role of TMPRSS2-ERG status as a prognostic factor for biochemical relapse-free rate (bRFR. /// TMPRSS2-ERG is therefore unlikely to be a predictive factor for IGRT response.. /// "In two similarly treated IGRT cohorts, TMPRSS2-ERG status was not prognostic for bRFR, in disagreement with the hypothesis that these prostate cancers have DNA repair defects that render them clinically more radiosensitive. " /// "In both cohorts, TMPRSS2-ERG status was not associated with bRFR on univariate or multivariate analysis. "
TMPRSS2_ERG- 25897494prostate cancer;adenocarcinoma - - Despite conflicting published results, TMPRSS2-ERG gene fusion and PTEN loss are generally considered unfavorable markers for PC progression.
TMPRSS2_ERG- 22245323prostate cancer - - The identification of prostate cancer specific genomic aberrations, ie TMPRSS2:ERG gene fusion, might improve diagnosis and affect prostate cancer treatment. /// Molecular diagnosis of prostate cancer: PCA3 and TMPRSS2:ERG gene fusion.. /// The only 2 true prostate cancer specific biomarkers identified to date remain PCA3 and TMPRSS2:ERG gene fusion..
TMPRSS2_ERG- 23789042prostate cancer - - Preliminary Results of Noninvasive Detection of TMPRSS2:ERG Gene Fusion in a Cohort of Patients With Localized Prostate Cancer.. /// "No correlation between TMPRSS2:ERG gene fusion status and tumor stage, Gleason grade, prostate-specific antigen level, or surgical margin status was observed.. "
TMPRSS2_ERG- 27041928prostate cancer - - Moreover, it has been demonstrated recently that TMPRSS2-ERG gene fusion is identified as the predominant genetic change in patients diagnosed with PCa. /// PCA3 and TMPRSS2-ERG gene fusions as diagnostic biomarkers for prostate cancer.. /// "In this review, we focused on the potential use of PCA3 and TMPRSS2-ERG gene fusion detection in the diagnosis of PCa. " /// "Recent study revealed that combination of the PCA3 and TMPRSS2-ERG gene fusion test optimizes PCa detection compared with that of single biomarker, which would lead to a considerable reduction of the number of prostate biopsies. "
TMPRSS2_ERG- 23088973prostate cancer - - The impact of TMPRSS2-ERG gene fusion on prognosis was also evaluated.
TMPRSS2_ERG- 24909781prostate cancer - - This study aims to investigate prevalence of ETS-related gene (ERG) oncoprotein overexpression in Filipinos as surrogate of TMPRSS2-ERG gene fusions, using a highly specific monoclonal antibody (ERG-MAb), and conduct the first attempt to study the role of genetic alterations in the aggressive tumor biologic behaviour of CaP among Filipinos.
TMPRSS2_ERG- 25897535prostate cancer - - But only the combination of the urinary assays for TMPRSS2:ERG gene fusion and PCA3 (both use the same platform) show the expected improved accuracy for PCa detection.
TMPRSS2_ERG- 21669963prostate cancer - - The most frequently identified fusion gene is TMPRSS2:ERG, which causes ERG protein overexpression in PCa cells. /// "To characterize ERG and TMPRSS2:ERG transcriptional activity of OPN, we focused on ETS binding sites (EBS) localized in conserved regions of the promoter. " /// "Moreover, stable transfection of prostate tumor cell lines by TMPRSS2:ERG upregulates endogenous OPN expression. "
TMPRSS2_ERG- 26575822prostate cancer - - The TMPRSS2-ERG gene rearrangement status of patient samples was determined by transformation of the exon array and RNA seq expression data to robust z-scores followed by the application of a threshold>3 to define a positive TMPRSS2-ERG gene fusion event in a tumour sample.
TMPRSS2_ERG- 23554889prostate cancer - - The TMPRSS2/ERG (T/E) fusion gene is present in the majority of all prostate cancers (PCa).
TMPRSS2_ERG- 25749044prostate cancer - - Majority of prostate cancer (PCa) patients carry TMPRSS2/ERG (T/E) fusion genes and there has been tremendous interest in understanding how the T/E fusion may promote progression of PCa.
TMPRSS2_ERG- 18642766prostate cancer PCR;RT-PCR - TMPRSS2/ERG and TMPRSS2/ETV1 fusion genes may be used as diagnostic tools for PCa.. /// "Nested RT-PCR and direct DNA sequencing were used to detect the fusion genes of TMPRSS2/ERG, TMPRSS2/ETV1, and TMPRSS2/ETV4. " /// TMPRSS2/ERG and TMPRS22/ETV1 fusion genes with different subtypes exist in the tissues of PCa. /// The positive rates of TMPRSS2/ERG and TMPRSS2/ETV1 fusions showed no statistical association with the Gleason grade (P = 0.169).
TMPRSS2_ERG- 20493449prostate cancer - - Many abstract on prevention, natural history and tumor markers such as PCa3 and fusion gene TMPRSS2 : ERG were presented.
TMPRSS2_ERG- 19584279prostate cancer - - It seems clear that androgen receptor (AR)-regulated expression of the TMPRSS2:ERG fusion gene plays an early role in prostate cancer (PC) development or progression, but the extent to which TMPRSS2:ERG is down-regulated in response to androgen deprivation therapy (ADT) and whether AR reactivates TMPRSS2:ERG expression in castration-resistant PC (CRPC) have not been determined. /// "To further assess whether TMPRSS2:ERG expression is initially down-regulated in response to ADT, we examined VCaP cells, which express the TMPRSS2:ERG fusion gene, and xenografts. " /// Reactivation of androgen receptor-regulated TMPRSS2:ERG gene expression in castration-resistant prostate cancer.. /// "These results show that expression of TMPRSS2:ERG, similarly to other AR-regulated genes, is restored in CRPC and may contribute to tumor progression.. " /// "We show that ERG message levels in TMPRSS2:ERG fusion-positive CRPC are comparable with the levels in fusion gene-positive primary PC, consistent with the conclusion that the TMPRSS2:ERG expression is reactivated by AR in CRPC. "
TMPRSS2_ERG- 23052253prostate cancer - - The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer tumors.
TMPRSS2_ERG- 25948797prostate cancer - - Many other biomarkers based on the expression of specific genes of PCa are being studied and validated, for instance the fusion gene TMPRSS2-ERG with a commercial kit available, while another approach is to test the expression of a panel of genes.
TMPRSS2_ERG- 25906745prostate cancer - - We investigated the molecular relationship between TMPRSS2-ERG (T2E) fusion gene and insulin-like growth factor receptor (IGF-1R) to optimize the use of IGF-1R inhibitors.IGF-1R was analyzed in cell lines and in radical prostatectomy specimens in relation to T2E status.
TMPRSS2_ERG- 23201468prostate cancer - - Prospective multicentre evaluation of PCA3 and TMPRSS2-ERG gene fusions as diagnostic and prognostic urinary biomarkers for prostate cancer.. /// To evaluate the diagnostic and prognostic value of Progensa PCA3 and TMPRSS2-ERG gene fusions (as individual biomarkers and as a panel) for PCa in a prospective multicentre setting. /// Prostate cancer antigen 3 (PCA3) and v-ets erythroblastosis virus E26 oncogene homolog (TMPRSS2-ERG) gene fusions are promising prostate cancer (PCa) specific biomarkers that can be measured in urine. /// "TMPRSS2-ERG had prognostic value, whereas PCA3 did not. " /// Both PCA3 and TMPRSS2-ERG had significant additional predictive value to the ERSPC risk calculator parameters in multivariate analysis (p<0.001 and resp. /// "We assessed the predictive value of Progensa PCA3 and TMPRSS2-ERG (quantitative nucleic acid amplification assay to detect TMPRSS2-ERG messenger RNA [mRNA]) for PCa, Gleason score, clinical tumour stage, and PCa significance (individually and as a marker panel). " /// TMPRSS2-ERG had independent additional predictive value to PCA3 and the ERSPC risk calculator parameters for predicting PCa. /// Sensitivity of PCA3 increased from 68% to 76% when combined with TMPRSS2-ERG. /// "The area under the curve (AUC) increased from 0.799 (ERSPC risk calculator), to 0.833 (ERSPC risk calculator plus PCA3), to 0.842 (ERSPC risk calculator plus PCA3 plus TMPRSS2-ERG) to predict PCa. " /// "TMPRSS2-ERG added significant predictive value to the ERSPC risk calculator to predict biopsy Gleason score (p<0.001) and clinical tumour stage (p=0.023), whereas PCA3 did not. " /// Implementing the novel urinary biomarker panel PCA3 and TMPRSS2-ERG into clinical practice would lead to a considerable reduction of the number of prostate biopsies..
TMPRSS2_ERG- 24504521prostate cancer PCR - The identification of recurrent gene fusions in common epithelial cancers--for example, TMPRSS2/ERG in prostate cancer and EML4/ALK in nonsmall cell lung carcinomas--has raised the question of whether fusion genes are pathogenetically important also in ovarian carcinomas.
TMPRSS2_ERG- 21169414prostate cancer;prostatic intraepithelial neoplasia - - The TMPRSS2/ERG (T/E) fusion gene is present and thought to be an oncogenic driver of approximately half of all prostate cancers.
TMPRSS2_ERG- 24468524prostate cancer;bladder cancer - - To investigate whether messenger ribonucleic acid (mRNA) expression of TMPRSS2-ERG fusion gene, a suggested prostate cancer (PCa) biomarker, was specific to cancerous lesions alone and to study the expression of SPINK1 and PCA3 mRNAs in the same cohort to also explore the proposed mutual exclusivity of TMPRSS2-ERG and SPINK1 expression. /// "Expression of TMPRSS2-ERG transcripts was detected in 45 of 88 (51%) HBP tissues from RP specimens and more frequently (57 of 86, 66%) found in cancerous lesions. " /// "Levels of 2 TMPRSS2-ERG transcripts, PCA3, and SPINK1 mRNAs were measured with highly standardized reverse transcription quantitative polymerase chain reaction assays in cystoprostatectomy specimens from 19 patients with invasive bladder cancer and 174 radical prostatectomy (RP) samples (88 histologically benign prostate [HBP] tissues and 86 from cancerous lesions) from 87 patients with clinically localized PCa. " /// "In contrast, TMPRSS2-ERG expression was detected in only 2 of 19 (11%) cystoprostatectomy specimens, both with incidental PCa foci elsewhere in the gland. " /// "Cancer-associated changes in the expression of TMPRSS2-ERG, PCA3, and SPINK1 in histologically benign tissue from cancerous vs noncancerous prostatectomy specimens.. " /// "Although the expression of TMPRSS2-ERG, SPINK1, and PCA3 mRNA is higher or more frequently found in cancerous lesions, HBP tissues from patients with clinically localized PCa manifest molecular, mRNA level changes that are absent in cystoprostatectomy specimens lacking incidental PCa foci or infrequent in cystoprostatectomy specimens containing incidental PCa. "
TMPRSS2_ERG- 25972242prostate cancer - - The TMPRSS2/ERG (T/E) fusion gene is present in approximately 50% of prostate cancers and promotes tumor progression in vivo.
TMPRSS2_ERG- 22930729prostate cancer - - Using a sequencing-based approach, our work uncovers significant global epigenetic alterations in TMPRSS2-ERG gene fusion-negative tumors and provides a mechanistic explanation for the tumor formation process.. /// "In addition, global methylation patterns show significant differences based on the TMPRSS2-ERG rearrangement status. " /// "In contrast to TMPRSS2-ERG -rearranged tumors, the pathomechanism for gene fusion-negative tumors is completely unclear. "
TMPRSS2_ERG- 21731703prostate cancer;adenocarcinoma - - Role of TMPRSS2-ERG gene fusion in negative regulation of PSMA expression.. /// The purpose of this investigation is to determine whether PSMA expression can be regulated by the TMPRSS2-ERG gene fusion. /// Our data indicated that downregulation of PSMA in androgen-treated VCaP cells appears partially mediated by TMPRSS2-ERG gene fusion.. /// "After 24 hours of androgen treatment, TMPRSS2-ERG mRNA level was increased in VCaP cells. "
TMPRSS2_ERG- 19494719prostate cancer PCR;RT-PCR - The recently identified TMPRSS2: ERG fusion gene is a candidate oncogene for prostate cancer (PCa). /// "The presence of TMPRSS2:ERG transcripts and the levels of ERG RNA, measured by quantitative Real Time-PCR, did not correlate significantly with clinical and pathologic characteristics of the tumors. " /// The lower proportion of patients expressing TMPRSS2: ERG in group B suggests that androgen ablation inhibits the expression of TMPRSS2:ERG. /// "Histochemical analysis showed that ERG expression is limited to tumor cells, and in group A patients (but not in group B patients) it is limited to those glands that express TMPRSS2:ERG. "
TMPRSS2_ERG- 25913390prostate cancer - - An improved understanding of the genetic basis of prostate carcinogenesis has produced an increasing number of potential prognostic and predictive tools, such as transmembrane protease, serine2:v-ets avian erythroblastosis virus E26 oncogene homolog (TMPRSS2:ERG) gene fusion status, loss of the phosphatase and tensin homolog (PTEN) gene, and gene expression signatures utilizing messenger RNA from tumor tissue.
TMPRSS2_ERG- 24739220prostate cancer - - Transmembrane protease, serine 2 and v-ets erythroblastosis virus E26 homolog (TMPRSS2-ERG) gene fusions are the common molecular signature of prostate cancer. /// Androgen receptor and gene network: Micromechanics reassemble the signaling machinery of TMPRSS2-ERG positive prostate cancer cells.. /// 6) TMPRSS2-ERG encoded protein targeting.
TMPRSS2_ERG- 18474293leukemia;adenocarcinoma;sarcoma PCR;RT-PCR - We identified the fusion gene TMPRSS2-ERG by reverse-transcriptase polymerase chain reaction (RT-PCR) in 40/55 carcinomas (72%).
TMPRSS2_ERG- 24065644prostate cancer - - We obtained the fusion gene expression profiling of prostate tumors, clustered them into several biological pathways, highlighted three "rediscovered" fusion genes (TMPRSS2-ERG, KLK2, and KLK3) and proved the reliability of our method..
TMPRSS2_ERG- 24495450prostate cancer - - Promising results have also been seen with the use of the fusion gene TMPRSS2:ERG and with various forms of the urokinase plasminogen activation receptor.
TMPRSS2_ERG- 22821767prostate cancer - - Detection of fusion gene TMPRSS2:ERG transcripts in urine have been recently described in order to refine urine-based detection of prostate cancer (PCa), but data its clinical impact remain scarce. /// "Integration of levels TMPRSS2:ERG transcripts in urine, with PCA3-score, androgenic status, genetic status and traditional clinical variables could significantly increase detection of high risk localized PCa.. " /// "Univariate and multivariate analysis by logistic regression model (logit) were conducted to study the correlation of TMPRSS2:ERG status, PCA3, and PSA density with biopsy results, and Gleason score. " /// TMPRSS2:ERG was detected by urine assay (Progensa?). /// "PCA3 score, PSA density and TMPRSS2:ERG-score were correlated with presence of PCa (P?
TMPRSS2_ERG- 26280815prostate cancer - - Assessment of long-term outcomes associated with urinary prostate cancer antigen 3 and TMPRSS2:ERG gene fusion at repeat biopsy.. /// " In men with clinically localized prostate cancer who have undergone at least 1 previous negative biopsy and have elevated serum prostate-specific antigen (PSA) levels, long-term health outcomes associated with the assessment of urinary prostate cancer antigen 3 (PCA3) and the transmembrane protease, serine 2 (TMPRSS2):v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG) gene fusion (T2:ERG) have not been investigated previously in relation to the decision to recommend a repeat biopsy. "
TMPRSS2_ERG- 23213079prostate cancer - - Comparative assessment of urinary prostate cancer antigen 3 and TMPRSS2:ERG gene fusion with the serum [-2]proprostate-specific antigen-based prostate health index for detection of prostate cancer.. /// " We compared urinary prostate cancer antigen 3 (PCA3), transmembrane protease, serine 2 (TMPRSS2):v-ets erythroblastosis virus E26 oncogene homolog (avian) (ERG) gene fusion (T2:ERG), and the serum [-2]proprostate-specific antigen ([-2]proPSA)-based prostate health index (Phi) for predicting biopsy outcome. "
TMPRSS2_ERG- 18358509prostate cancer - - The role of AR signalling has also been highlighted by the fusion gene TMPRSS2:ERG recently identified in the majority of PCa.
TMPRSS2_ERG- 19716227prostate cancer PCR - Expression of the androgen-regulated fusion gene TMPRSS2-ERG does not predict response to endocrine treatment in hormone-na?ve, node-positive prostate cancer.. /// TMPRSS2-ERG expression was analysed by PCR using a forward primer in TMPRSS2 exon 1 and a reverse primer in ERG exon 4. /// "To determine whether expression of androgen-regulated TMPRSS2-ERG predicts response to endocrine treatment in hormone-na?ve, node-positive PCa. " /// TMPRSS2-ERG was expressed in 59% of the 71 patients who could be analysed. /// Expression of TMPRSS2-ERG is frequent in lymph node metastases of patients with untreated PCa. /// Our results suggest that expression of TMPRSS2-ERG is not a candidate marker to select for metastatic PCa patients who will benefit more from endocrine treatment..
TMPRSS2_ERG- 25977336prostate cancer - - NKX3.1 Suppresses TMPRSS2-ERG Gene Rearrangement and Mediates Repair of Androgen Receptor-Induced DNA Damage.. /// Analysis of prostate cancer tissues showed that the presence of a TMPRSS2-ERG rearrangement was highly correlated with lower levels of NKX3.1 expression consistent with the role of NKX3.1 as a suppressor of the pathogenic gene rearrangement..
TMPRSS2_ERG- 19642730prostate cancer;adenocarcinoma - - TMPRSS2:ERG gene rearrangement appears to be an early event in prostate cancer and is not observed in benign or hyperplastic prostatic epithelium. /// The relationship between TMPRSS2:ERG gene rearrangement and other morphologic and prognostic parameters of prostate cancer is still unclear.. /// Duplication of TMPRSS2:ERG appears to predict a worse prognosis.
TMPRSS2_ERG- 19592507- - - Not only did a paired-end approach provide a greater dynamic range in comparison with single read based approaches, but it clearly distinguished the high-level "driving" gene fusions, such as BCR-ABL1 and TMPRSS2-ERG, from potential lower level "passenger" gene fusions.
TMPRSS2_ERG- 25993147multiple endocrine neoplasia;neuroectodermal tumor - - Only WD-NETs arise in patients with inherited neuroendocrine neoplasia syndromes (e.g., multiple endocrine neoplasia type 1), and some common genetic alterations are site-specific (e.g., TMPRSS2-ERG gene rearrangement in PD-NECs arising in the prostate gland).
TMPRSS2_ERG- 24074533prostate cancer - - The TMPRSS2-ERG gene rearrangement is highly specific for prostate cancer.
TMPRSS2_ERG- 23334893prostate cancer - - ETS-related gene (ERG) protein is present in 40-70% of prostate cancer and is correlated with TMPRSS2-ERG gene rearrangements.
TMPRSS2_ERG- 23321466prostate cancer FISH;PCR;RT-PCR - TMPRSS2-ERG rearrangement was investigated by FISH (n=44), ERG protein by IHC (n=84), and CXCR4 by quantitative RT-PCR (n=44). /// "TMPRSS2-ERG rearrangement was investigated by FISH (n=44), ERG protein by IHC (n=84), and CXCR4 by quantitative RT-PCR (n=44). " /// "In conclusion, our results reveal for the first time that CXCR4 overexpression is associated with high Gleason score prostate tumors, but that it is independent of the TMPRSS2-ERG rearrangement.. " /// "TMPRSS2-ERG rearrangement and ERG protein expression were present in almost 50% of the cases, without statistical differences between the different Gleason score groups. " /// Different studies have suggested an association between CXCR4 and ERG overexpression resulting from the TMPRSS2-ERG rearrangement. /// CXCR4 mRNA overexpression in high grade prostate tumors: lack of association with TMPRSS2-ERG rearrangement..
TMPRSS2_ERG- 26411452prostate cancer - - We integrated chromatin-immunoprecipitation-coupled sequencing and microarray expression profiling in TMPRSS2-ERG gene rearrangement positive DUCaP cells with the GWAS PCa risk SNPs catalog to identify disease susceptibility SNPs localized within functional androgen receptor-binding sites (ARBSs).
TMPRSS2_ERG- 26959281pure red cell aplasia FISH;PCR;RT-PCR - TMPRSS2-ERG and SLC45A3-ERG by RT-PCR, FISH, and direct sequencing. /// Single TMPRSS2-ERG translocation is associated with low grade PrCa. /// "SLC45A3-ERG and TMPRSS2-ERG rearrangements and their association with ERG and PTEN expression and with clinical and pathological features have been analyzed in 80??rCa (PSMAR-Biobank, Barcelona, Spain). " /// Concurrent TMPRSS2-ERG and SLC45A3-ERG rearrangements plus PTEN loss are not found in low grade prostate cancer and define an aggressive tumor subset.. /// "SLC45A3-ERG was found in 25 cases, 20 of them with concurrent TMPRSS2-ERG rearrangement: 11.5% GS??=??6, 22.2% GS??=??7, and 50% GS?????8 tumors (P??=??0.013). " /// Single TMPRSS2-ERG was found in 51.6% GS?????7 and 22.2% GS?????8 tumors (P??=??0.027). /// Tumors with combined TMPRSS2-ERG/SLC45A3-ERG fusions plus PTEN loss should be excluded from watchful waiting and are candidates for intensive therapy.
TMPRSS2_ERG- 18385909prostate cancer FISH;PCR;RT-PCR - However, TMPRSS2:ERG transcripts were not detected in any of the 15 CTC samples, including the 10 cases analyzed by FISH. /// "We analyzed the frequency of TMPRSS2:ERG and TMPRSS2:ETV1 transcripts in 27 prostate cancer biopsies from prostatectomies, and TMPRSS2:ERG transcripts in CTC isolated from 15 patients with advanced androgen independent disease using reverse transcription polymerase chain reaction (RT-PCR). " /// "TMPRSS2:ERG transcripts were found in 44% of our samples, but we did not detect expression of TMPRSS2:ETV1. "
TMPRSS2_ERG- 22695242prostate cancer - - The potential for using urine measurements such as prostate cancer antigen 3 (PCA3) RNA and the transmembrane protease, serine 2 v-ets erythroblastosis virus E26 oncogene homolog (avian) (TMPRSS2-ERG) gene fusion to aid screening is discussed.
TMPRSS2_ERG- 21383613prostatic intraepithelial neoplasia - - TMPRSS2:ERG gene rearrangement is the most common chromosomal alteration and is highly specific for PCa. /// "Recently, 2 studies reported that positive immunohistochemical (IHC) stains with an ERG antibody highly correlated with the TMPRSS2:ERG gene rearrangement status. "
TMPRSS2_ERG- 25457014prostate cancer - - While some studies have suggested a univariate relationship between urinary prostate cancer antigen 3 (PCA3) and transmembrane protease, serine 2-v-ets avian erythroblastosis virus E26 oncogene homolog gene fusion (TMPRSS2:ERG) with adverse biopsy features, these markers have not been consistently shown to independently predict AS outcomes.
TMPRSS2_ERG- 23561577prostate cancer - - We identified the TMPRSS2-ERG rearrangement associated 3-Mbp deletion on chromosome 21 and found corresponding fusion plasma fragments in these cases.
TMPRSS2_ERG- 19152679prostate cancer;leukemia - - Using this array, proof of principle was demonstrated by detection of known fusion genes (such as TCF3:PBX1, ETV6:RUNX1, and TMPRSS2:ERG) from all six positive controls consisting of leukemia cell lines and prostate cancer biopsies.
TMPRSS2_ERG- 23781502prostate cancer FISH;PCR;RT-PCR - Molecular characterization and clinical impact of TMPRSS2-ERG rearrangement on prostate cancer: comparison between FISH and RT-PCR.. /// The presence of TMPRSS2-ERG rearrangement was observed in 56.6% of cases. /// No association between TMPRSS2-ERG status and clinicopathological parameters nor biochemical progression and clinical progression free survival was found.
TMPRSS2_ERG- 23447416prostate cancer - - This strategy showed > 90% sensitivity and specificity in identifying TMPRSS2-ERG rearrangements, and allowed identification of intra- and inter-chromosomal rearrangements involving TMPRSS2 and ERG with known and novel fusion partners. /// "This strategy showed > 90% sensitivity and specificity in identifying TMPRSS2-ERG rearrangements, and allowed identification of intra- and inter-chromosomal rearrangements involving TMPRSS2 and ERG with known and novel fusion partners. " /// TMPRSS2-ERG rearrangements occur in approximately 50% of prostate cancers and therefore represent one of the most frequently observed structural rearrangements in all cancers. /// The observed TMPRSS2-ERG rearrangements often exhibited complex chromosomal architecture associated with several intra- and inter-chromosomal rearrangements.
TMPRSS2_ERG- 23272087prostate cancer - - Notably, knockdown of the ATM gene expression in HPr-1AR cells can promote androgen-induced TMPRSS2: ERG rearrangement, a prostate-specific chromosome translocation frequently found in prostate cancer cells.
TMPRSS2_ERG- 17654723prostate cancer - - In this article we present evidence demonstrating that multiple genomic alterations contribute to the formation of various TMPRSS2/ERG transcripts.
TMPRSS2_ERG- 21623182prostate cancer;prostatic intraepithelial neoplasia - - Recently, TMPRSS2:ERG gene rearrangement was found to be highly specific for and detected in approximately 50% of prostate cancer. /// Positive immunohistochemical staining with a novel anti-ERG antibody highly correlated with TMPRSS2:ERG gene rearrangement status.
TMPRSS2_ERG- 19396168prostate cancer;adenocarcinoma;prostatic intraepithelial neoplasia - - We find that prostate cancer specimens containing the TMPRSS2-ERG rearrangement are significantly enriched for loss of the tumor suppressor PTEN.
TMPRSS2_ERG- 19293179prostate cancer PCR - TMPRSS2-ERG, TMPRSS2-ETV1, and SLC45A3-ERG rearrangements account for roughly 90% of ETS fusion prostate cancer.
TMPRSS2_ERG- 23555854prostate cancer PCR - As a result, TDRD1 becomes transcriptionally activated in TMPRSS2:ERG-positive prostate cancer. /// Tudor domain-containing protein 1 gene (TDRD1) was reported to be differentially expressed between TMPRSS2:ERG-negative and TMPRSS2:ERG-positive prostate cancer. /// "Accordingly, demethylation of the TDRD1 promoter in TMPRSS2:ERG-negative prostate cancer cells by DNA methyltransferase inhibitors resulted in TDRD1 induction. "
TMPRSS2_ERG- 24510842prostate cancer - - In conclusion, our study identifies an association of NBS1 expression with surrogates of genomic instability in prostate cancer including TMPRSS2-ERG rearrangements and PTEN deletion.
TMPRSS2_ERG- 26344096prostate cancer - - SPOP mutations and TMPRSS2-ERG rearrangements occur collectively in up to 65% of human prostate cancers.
TMPRSS2_ERG- 26392259prostate cancer - - High-level EZH2 staining was also associated with TMPRSS2:ERG rearrangement and ERG expression in prostate cancers (P < 0.0001) and was linked to deletions of PTEN, 6q15, 5q21 and 3p13 (P < 0.0001 each) particularly in ERG-negative cancers.
TMPRSS2_ERG- 24266818prostate cancer - - TMPRSS2-ERG is a recurrent rearrangement specific for prostate cancer, leading to the overexpression of a truncated ERG protein product that is amenable to immunohistochemical detection.
TMPRSS2_ERG- 25794974prostate cancer - - Moreover, high-level HDAC1 staining was associated with TMPRSS2:ERG rearrangement and ERG expression in prostate cancers (p<0.0001) and was linked to deletions of PTEN (p<0.0001), 6q (p<0.0001) and 5q (p=0.0028) in ERG-negative cancers.
TMPRSS2_ERG- 20018353prostate cancer - - All but 2 ERG rearranged foci had detectable TMPRSS2-ERG transcript levels. /// "Each focus was assessed for size, Gleason score, ERG rearrangement, and TMPRSS2-ERG transcript. "
TMPRSS2_ERG- 19212347prostate cancer - - The TMPRSS2:ERG genetic rearrangement has been reported to occur in approximately 40% of primary prostate tumours (ETV1 genetic rearrangements occur at a much lower frequency), and it results in the aberrant androgen-regulated expression of ERG.
TMPRSS2_ERG- 26935606prostate cancer - - To examine the function of such fusion genes, an expression plasmid containing the TMPRSS2:ERG (T1/E5) sequence (??RG) from a patient sample was constructed and transiently transfected into DU145 cells, which do not express the fusion gene. /// "By contrast, VCaP cells, which do contain TMPRSS2:ERG, were sensitized to cisplatin??nduced apoptosis through siRNA inhibition of the fusion gene. "
TMPRSS2_ERG- 19861517prostate cancer - - Additional findings, regardless of TMPRSS2-ERG status, were the overrepresentation of a rare BRCA2 variant (V2728I: P = 0.03. /// "Thirteen nonsynonymous variants, 5 of which had a minor allele frequency of <0.05, were genotyped in 210 familial cases, 47 of which with a known TMPRSS2-ERG status, 329 sporadic cases, and 512 controls. "
TMPRSS2_ERG- 18542058prostate cancer - - The high prevalence of TMPRSS2-ERG rearrangements ( approximately 60%) in prostate cancer (CaP) leads to androgenic induction of the ETS-related gene (ERG) expression. /// ERG knockdown in TMPRSS2-ERG expressing CaP cells induced striking morphological changes and inhibited cell growth both in cell culture and SCID mice.
TMPRSS2_ERG- 23940108ewing sarcoma;prostate cancer;sarcoma - - We performed an integrative study of genome-wide DNA-binding and transcription data in EWSR1/FLI1 expressing ES and TMPRSS2/ERG containing PC cells.
TMPRSS2_ERG- 21601955prostate cancer - - TMPRSS2-ERG overexpresses ERG through an androgen-mediated response. /// TMPRSS2-ERG overexpresses ERG through an androgen-mediated response. /// "Although the prognostic implications of TMPRSS2-ERG have not been fully elucidated, they constitutes a field of great diagnostic potential and, therefore, the development of techniques to identify and to analyze the presence and characteristics of this gene in a non-invasive fashion deserves great interest in this area. "
TMPRSS2_ERG- 18165275prostate cancer PCR;RT-PCR - Detection of TMPRSS2-ERG translocations in human prostate cancer by expression profiling using GeneChip Human Exon 1.0 ST arrays..
TMPRSS2_ERG- 24687926prostate cancer - - Immunohistochemical data were available for PTEN, p-Akt, pS6, stathmin, androgen receptor (AR), and ERG (as a measure of the TMPRSS2:ERG translocation). /// "Immunohistochemical data were available for PTEN, p-Akt, pS6, stathmin, androgen receptor (AR), and ERG (as a measure of the TMPRSS2:ERG translocation). "
TMPRSS2_ERG- 23535644prostate cancer - - The presence and expression of TMPRSS2/ERG in prostate stem cells would provide ERG-driven survival advantages, allowing maintenance of this mutated genotype.. /// Monoallelic expression of TMPRSS2/ERG in prostate cancer stem cells..
TMPRSS2_ERG- 24961351prostate cancer FISH;PCR;RT-PCR - TMPRSS2-ERG has also been detected in prostate intraepithelial neoplasia (PIN) lesions and more rarely in benign prostatic hyperplasia (BPH) regions mainly in PCa-bearing glands. /// These findings indicate that TMPRSS2-ERG may or may not lead to PCa development.. /// The possibility that the fusion TMPRSS2-ERG may be present in BPH samples in the absence of apparent PCa was addressed.
TMPRSS2_ERG- 19002169prostate cancer - - Many components of the epigenetic machinery, including histone deacetylase (whose expression level is linked to the TMPRSS2:ERG translocation) and the histone methylase EZH2, are potential therapeutic targets.
TMPRSS2_ERG- 23872663prostate cancer - - Recent studies, however, suggest that genetic differences, such as the lower incidence of Chinese prostate cancers harboring TMPRSS2-ERG translocations compared to patients from Western countries, should be carefully considered in the context of genotypic and phenotypic differences among interracial groups.
TMPRSS2_ERG- 26294063prostate cancer;prostatic intraepithelial neoplasia PCR - ERG protein expression was limited to areas of TMPRSS2-ERG mRNA expression, but did not identify all of them. /// " PCA3 and TMPRSS2-ERG are commonly overexpressed biomarkers in prostate cancer, but reports have emerged demonstrating altered expression also in areas outside the tumour foci in cancerous prostates. " /// TMPRSS2-ERG mRNAs were detected in three patients and in 15 tissue samples in total. /// "ERG protein expression was limited to areas of TMPRSS2-ERG mRNA expression, but did not identify all of them. " /// "TMPRSS2-ERG expression was detected in carcinoma foci, regions next to them, and in samples not adjacent to carcinoma foci. " /// "Altered PCA3 and TMPRSS2-ERG expression in histologically benign regions of cancerous prostates: a systematic, quantitative mRNA analysis in five prostates.. " /// "Our aim was to measure PCA3 and TMPRSS2-ERG expression systematically in all regions of prostate cross-sections, matching the data to corresponding tissue morphology. " /// TMPRSS2-ERG and PCA3 mRNA levels were measured with quantitative reverse-transcription PCR assays in 270 samples from cross-sections of five radical prostatectomy specimens.
TMPRSS2_ERG- 18676740prostate cancer PCR - Copy numbers of TMPRSS2-ERG splice variants were determined by quantitative reverse transcription-PCR in laser capture microdissected prostate cancer cells. /// Full-length TMPRSS2-ERG transcripts were cloned and sequenced from a cDNA library generated from pooled RNA of six TMPRSS2-ERG fusion-positive prostate tumors. /// This study focuses on qualitative and quantitative features of full-length TMPRSS2-ERG transcripts in prostate cancer. /// "Two types of TMPRSS2-ERG cDNAs were identified: type I, which encodes full-length prototypical ERG protein (ERG1, ERG2, ERG3), and type II, encoding truncated ERG proteins lacking the ETS domain (ERG8 and a new variant, TEPC). " /// Delineation of TMPRSS2-ERG splice variants in prostate cancer..
TMPRSS2_ERG- 25007891prostate cancer PCR - Three tissue microarrays (TMAs) containing samples from 98 patients with PCa and one TMA of 27 samples from individuals without PCa were tested for ERG immunostaining, and the presence of TMPRSS2:ERG transcripts was confirmed by quantitative real time PCR (qRT-PCR). /// "Three tissue microarrays (TMAs) containing samples from 98 patients with PCa and one TMA of 27 samples from individuals without PCa were tested for ERG immunostaining, and the presence of TMPRSS2:ERG transcripts was confirmed by quantitative real time PCR (qRT-PCR). " /// The role of TMPRSS2:ERG in molecular stratification of PCa and its association with tumor aggressiveness: a study in Brazilian patients..
TMPRSS2_ERG- 25933120prostate cancer - - Microarray analysis further confirmed ERG inhibition by both siRNAs TMPRSS2-ERG and revealed one common down-regulated gene, ADRA2A, involved in cell proliferation and migration. /// Two of the five siRNAs tested were found to efficiently inhibit mRNA of both TMPRSS2-ERG variants and to decrease ERG protein expression. /// "In conclusion, this study offers a new prospect of treatment for prostate cancer based on siRNA-squalene nanoparticles targeting TMPRSS2-ERG junction oncogene. " /// "Microarray analysis further confirmed ERG inhibition by both siRNAs TMPRSS2-ERG and revealed one common down-regulated gene, ADRA2A, involved in cell proliferation and migration. " /// TMPRSS2-ERG junction oncogene is present in more than 50% of patients with prostate cancer and its expression is frequently associated with poor prognosis. /// "To propose a concrete therapeutic approach, siRNA TMPRSS2-ERG IV was conjugated to squalene, which can self-organize as nanoparticles in water. " /// Antineoplastic Effects of siRNA against TMPRSS2-ERG Junction Oncogene in Prostate Cancer.. /// Our aim is to achieve gene knockdown by siRNA TMPRSS2-ERG and then to assess the biological consequences of this inhibition.
TMPRSS2_ERG- 18794177prostate cancer PCR;RT-PCR - Among all of the reported fusion partners in the ETS gene family, TMPRSS2:ERG is the most prevalent one.
TMPRSS2_ERG- 25520876prostate cancer - - However, samples with a CAG repeat of 17 were found more frequently in the TMPRSS2:ERG fusion positive than negative prostate cancer cases and mediated a higher rate of androgen-induced TMPRSS2 and ERG co-localisation than AR with longer (24) and shorter (15) CAG repeats. /// "However, samples with a CAG repeat of 17 were found more frequently in the TMPRSS2:ERG fusion positive than negative prostate cancer cases and mediated a higher rate of androgen-induced TMPRSS2 and ERG co-localisation than AR with longer (24) and shorter (15) CAG repeats. " /// "Shorter CAG repeat length was also not shown to be associated with a higher induction rate of TMPRSS2 and ERG proximity, an essential step for TMPRSS2:ERG fusion formation. "
TMPRSS2_ERG- 19401683prostate cancer - - As a proof-of-concept, we show the presence of two known prostate cancer biomarkers, PCA-3 and TMPRSS2:ERG the in exosomes isolated from urine of patients, showing the potential for diagnosis and monitoring cancer patients status..
TMPRSS2_ERG- 19664128prostate cancer - - Urine fractions from 55 patients (with and without prior prostatic massage) were analyzed for the presence of TMPRSS2:ERG isoforms using real-time qPCR. /// "Sixty-nine percent of urine samples following prostatic massage were positive for TMPRSS2:ERG isoforms a or b, five out of which were positive for both, vs 24% of samples obtained without prior massage. " /// Our findings contribute to the increasing elucidation of the role of TMPRSS2:ERG in the development of prostate cancer..
TMPRSS2_ERG- 21167530prostate cancer - - We evaluated the clinicopathological characteristics of single focus prostate cancer in radical prostatectomies, its clinical relevance and the occurrence of TMPRSS2-ERG rearrangement.
TMPRSS2_ERG- 25779129prostate cancer PCR - On the other hand, qRT-PCR exhibited a higher sensitivity, as TMPRSS2-ERG transcripts were detected in as few as 100 VCaP cells, in comparison to NanoString methodologies which detected ERG from 10,000 cells. /// "On the other hand, qRT-PCR exhibited a higher sensitivity, as TMPRSS2-ERG transcripts were detected in as few as 100 VCaP cells, in comparison to NanoString methodologies which detected ERG from 10,000 cells. " /// "We utilized TMPRSS2-ERG positive VCaP and TMPRSS2-ERG negative LNCaP cells to simulate three different sample types (cells, tissue, and post-DRE urine sediment). "
TMPRSS2_ERG- 17785564prostate cancer PCR;RT-PCR - In this report, we used for the first time the combination of the prostate cancer-specific biomarkers TMPRSS2-ERG and PCA3, which significantly improves the sensitivity for prostate cancer diagnosis..
TMPRSS2_ERG- 20562851prostate cancer ISH - TMPRSS2-ERG gene fusion is associated with low Gleason scores and not with high-grade morphological features.. /// TMPRSS2-ERG gene fusion is associated with lower core-specific and overall Gleason scores and not with high-grade morphologies. /// " TMPRSS2-ERG gene rearrangement is seen in about half of clinically localized prostate cancers, yet controversy exists with regard to its prognostic implications. " /// "Using maximum Gleason score, based on three core evaluation, and overall Gleason score, based on prostatectomy sections, Fisher's exact test was performed for tumors with TMPRSS2-ERG translocation/deletion, copy number increase (? 3) of the TMPRSS2-ERG region without translocation/deletion, and copy number increase and concomitant translocation/deletion. " /// These findings indicate that translocation/deletion of TMPRSS2-ERG is not associated with histological features of aggressive prostate cancer.. /// "Conversely, TMPRSS2-ERG copy number increase, with or without rearrangement, is associated with higher Gleason score. " /// "No significant difference in TMPRSS2-ERG incidence was observed between patients with and without cribriform glands, glomerulations, signet-ring cells, or intraductal cancer (P=0.821, 0.095, 0.132, 0.375). " /// Fluorescence in situ hybridization was performed to delineate TMPRSS2-ERG aberrations.
TMPRSS2_ERG- 22240201prostate cancer - - These include the seminal discovery of chromosomal translocations such as TMPRSS2-ERG gene fusions as well as the identification of critical oncogenes exemplified by the polycomb group protein EZH2.
TMPRSS2_ERG- 25925381prostate cancer - - We validated OCP using molecular standards and more than 300 FFPE tumor samples, achieving >95% accuracy for KRAS, epidermal growth factor receptor, and BRAF mutation detection as well as for ALK and TMPRSS2:ERG gene fusions.
TMPRSS2_ERG- 23664537adenocarcinoma ISH - Immunohistochemical evaluation of TMPRSS2-ERG gene fusion in adenosis of the prostate..
TMPRSS2_ERG- 19584163prostate cancer ISH - We sought to determine the prevalence of TMPRSS2-ERG gene fusion among prostate-specific antigen-screened men undergoing prostate biopsy in the United States. /// "These findings indicate a need for prospective studies to evaluate the relationship of TMPRSS2-ERG rearrangement with clinical course of screening-detected prostate cancer in North American men, and a need for the development of noninvasive screening tests to detect TMPRSS2-ERG rearrangement.. " /// This is the first prospective North American multicenter study to characterize TMPRSS2-ERG prostate cancer prevalence in a cohort of patients undergoing needle biopsy irrespective of whether or not they subsequently undergo prostatectomy.
TMPRSS2_ERG- 24931216prostate cancer - - Further, we demonstrate concurrent in situ detection of gene expression, point mutations, and gene fusions of the prostate cancer relevant targets AMACR, AR, TP53, and TMPRSS2-ERG.
TMPRSS2_ERG- 23695551prostate cancer - - TMPRSS2-ERG was the most recurrent rearrangement present in eight cases, in both GP3 and GP4.
TMPRSS2_ERG- 25791755prostate cancer - - New recurrent alterations have been identified in PCa (e.g., TMPRSS2-ERG translocation, SPOP and CHD1 mutations, and chromoplexy), and many previous ones in well-established pathways have been validated (e.g., androgen receptor overexpression and mutations.
TMPRSS2_ERG- 24072184prostate cancer;prostatic intraepithelial neoplasia ISH - We compared tissue PCA3 expression with tissue level ERG expression and matched pre-prostatectomy urine PCA3 and TMPRSS2-ERG levels. /// Evaluation of tissue PCA3 expression in prostate cancer by RNA in situ hybridization--a correlative study with urine PCA3 and TMPRSS2-ERG..

ChimerSEQ

Top
The fusion gene pair TMPRSS2--ERG information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5740-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J9-A52E-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-8469-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-ZG-A8QZ-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5754-01A - FusionScan
TMPRSS2_ERGchr21/42861433/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5502-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6377-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J9-A52B-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5521-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8I4-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8I4-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KC-A7F6-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-4L-AA1F-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-A9S4-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5769-11A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7783-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-7783-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5496-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6362-11A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6342-11A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-A6HY-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-V1-A8WS-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-V1-A8WS-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8I8-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8I8-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-A8D0-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A8D0-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A46F-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7797-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-7797-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-7325-01B - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-XQ-A8TB-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7819-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7819-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5508-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5508-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A879-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5791-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6E1-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67N-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5507-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7230-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67L-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8IA-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6E6-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5769-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A9WX-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6354-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7213-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8IC-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-ZG-A9LZ-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5501-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-A76X-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A46I-01A - FusionScan
TMPRSS2_ERGchr21/42866282/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-X4-A8KQ-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-X4-A8KQ-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-X4-A8KQ-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A876-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SL-01B - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A8SL-01B - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6365-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6365-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5506-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5506-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6384-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SP-01B - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5746-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7818-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-MG-AAMC-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J4-A67K-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-A8VV-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A83I-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J4-A83I-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6336-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5789-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5789-01A - FusionScan
TMPRSS2_ERGchr21/42866282/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5789-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A875-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A9WL-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A9WL-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5522-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5522-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6342-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5495-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7081-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6385-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-8198-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8257-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-A8VT-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-2A-A8VT-01A - FusionScan
TMPRSS2_ERGchr21/42866282/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A7B2-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-QU-A6IN-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A872-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6351-11A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-YL-A8SF-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5739-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5739-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SA-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-8260-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A48F-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-A48F-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-8472-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J4-A83J-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J4-A83J-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5794-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5768-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-A8D1-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7744-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6329-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-TP-A8TT-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6351-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A8HL-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5524-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8HK-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5752-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5752-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8II-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-ZG-A9L1-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A9L1-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7211-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6332-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5740-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-8469-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-8469-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5498-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A8QZ-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5754-01A - FusionScan
TMPRSS2_ERGchr21/42860320/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5502-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5502-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6377-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67T-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39947671/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67T-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J9-A52B-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J9-A52B-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6364-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-XJ-A83F-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-XJ-A83F-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5521-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5521-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8I4-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KC-A7F6-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-4L-AA1F-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-4L-AA1F-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A9MC-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-A9S4-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5769-11A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7783-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6363-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5496-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6362-11A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A59Y-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A8FO-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-A8FO-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A6HY-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-V1-A8WS-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-V1-A8WS-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8I8-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A8D0-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A46F-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-A46F-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7797-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J9-A8CM-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J9-A8CM-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J9-A8CM-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7325-01B - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A46D-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6363-11A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7747-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-A9S7-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-A9S7-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VN-A88Q-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-VN-A88Q-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7212-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7212-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7212-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5741-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5741-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-XQ-A8TB-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7819-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-AAYU-01A - FusionScan
TMPRSS2_ERGchr21/42866282/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-2A-AAYU-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5508-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A879-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8213-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5791-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5791-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-M7-A71Z-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-M7-A71Z-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7209-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7209-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6DY-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A6DY-01A - FusionScan
TMPRSS2_ERGchr21/42860320/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6DY-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KC-A4BN-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E1-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E1-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KC-A4BV-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-V1-A9ZG-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-V1-A9ZG-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67S-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J4-A67S-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5507-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7230-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7230-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67L-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5497-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5497-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8IA-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E2-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A6E2-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6E2-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E6-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6353-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5526-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5526-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5769-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5769-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A9WX-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6354-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6354-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7213-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8IC-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A8IC-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A9LZ-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KC-A4BR-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5764-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7327-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-7327-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7327-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-7327-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A632-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A632-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 CDS-5'UTR Intra-chr PRAD TCGA-HC-A632-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6362-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A76X-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-A76X-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-7525-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7232-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SL-01B - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6365-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5744-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5744-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6384-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5516-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8259-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-8259-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5525-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5525-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6356-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-XJ-A9DK-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SP-01B - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5746-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-V1-A9OY-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5527-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5527-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A6G1-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7818-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7818-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-MG-AAMC-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-MG-AAMC-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J9-A8CK-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J9-A8CK-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67K-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-A8VV-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-2A-A8VV-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7B1-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A7B1-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A7B1-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A83I-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6336-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6361-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A87C-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7AU-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HI-7171-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HI-7171-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HI-7171-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A7NF-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A875-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7328-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A9WL-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-YL-A9WL-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E4-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5522-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6342-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5495-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6373-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A9N3-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7B4-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7B4-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A7B4-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7785-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7081-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VN-A88M-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VN-A88M-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6385-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-8198-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 CDS-5'UTR Intra-chr PRAD TCGA-HC-8257-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-A8VT-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A87D-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A87D-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5499-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5499-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A65F-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7B2-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A7B2-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-QU-A6IN-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-QU-A6IN-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-7509-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-7509-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SF-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A87K-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A87K-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5739-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8262-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-8262-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SA-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-YL-A8SA-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A8SA-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8260-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A48F-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-8472-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A83J-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5503-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-VN-A88L-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VN-A88L-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7315-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-7315-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-7315-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A65D-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VN-A88K-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5794-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5768-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A8D1-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7744-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7744-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-H9-A6BY-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-H9-A6BY-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6329-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6329-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6329-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-TP-A8TT-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6351-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7077-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-FC-7708-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-FC-7708-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8IM-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8IM-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8HL-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5524-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5524-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67R-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8HK-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 CDS-5'UTR Intra-chr PRAD TCGA-YL-A8HK-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5752-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5752-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8II-01A - FusionScan
TMPRSS2_ERGchr21/42879876/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8II-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A9L1-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7231-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7231-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6332-01A - FusionScan
TMPRSS2_ERGchr21/42870045/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6332-01A - FusionScan
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A76X-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5741-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7230-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A6M7-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7077-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7321-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VN-A88Q-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5752-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7785-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-V1-A9O9-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A87D-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-A8VV-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7793-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6354-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-FC-7708-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8262-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SP-01B - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A8FO-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-A9S7-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7744-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A59Y-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7B1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-XQ-A8TB-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5746-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5769-11A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5530-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-V1-A8WS-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7784-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HI-7171-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J9-A52B-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7327-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6332-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5521-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6329-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A83I-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A9WL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SA-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5740-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SF-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6DY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A875-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5526-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5497-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E2-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8259-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A87K-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-XJ-A83F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8213-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7315-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-A9S4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-A8VT-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7212-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J9-A8CK-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A9LZ-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5769-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-8472-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6351-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A83K-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7AU-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5507-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7230-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A8QZ-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5743-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5495-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-7525-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39947670/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67T-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67T-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6361-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6365-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A83J-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A872-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5498-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8I4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42871601/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5522-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5522-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39947670/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5522-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5522-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39966566/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5522-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39969016/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5522-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6363-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67R-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A6G1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7B4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7B4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7325-01B - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67K-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6342-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6373-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VN-A88M-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8HL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A65F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7231-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5791-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5791-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8IC-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A87C-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7213-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 CDS-5'UTR Intra-chr PRAD TCGA-HC-A632-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39966566/- 21q22.3 21q22.2 Exonic hg19 CDS-5'UTR Intra-chr PRAD TCGA-HC-A632-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A632-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7B1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5769-11A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5512-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5530-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6384-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A6HY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A7B2-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8IH-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SL-01B - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8SL-01B - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7081-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KC-A7F6-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8II-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8II-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-M7-A71Z-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A9WX-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 CDS-5'UTR Intra-chr PRAD TCGA-YL-A8HK-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-8198-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8HK-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39966566/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8HK-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6356-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6363-11A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-H9-A6BY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8IA-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5790-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5525-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-V1-A9ZG-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6385-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A8HJ-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A9L4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7327-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7211-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7747-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KC-A4BR-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-V1-A9OY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39966566/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-V1-A9OY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A9L2-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5508-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A46I-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6353-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KC-A4BN-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-QU-A6IP-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A879-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7783-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7783-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-8469-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5765-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5503-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A46D-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6329-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8260-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A83I-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-MG-AAMC-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-YL-A9WL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-ZG-A9MC-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5516-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5794-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7745-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6377-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6377-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7819-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67L-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6DY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VP-A876-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5754-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5764-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5496-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7328-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-A7NF-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8I8-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5524-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5524-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5524-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5527-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J9-A8CM-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A8IM-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 CDS-5'UTR Intra-chr PRAD TCGA-HC-8257-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5744-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5744-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5506-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-8257-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-5502-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6364-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7232-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-XJ-A9DI-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-A8VL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7797-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-EJ-7797-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7209-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A8D0-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A8D1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-7509-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-7509-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39966566/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-7509-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A48F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-A48F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-J4-A67S-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KK-A6E6-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 CDS-5'UTR Intra-chr PRAD TCGA-VN-A88K-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-G9-6362-11A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-KC-A4BV-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-VN-A88K-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-XJ-A9DK-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-A8VT-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-2A-AAYU-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-HC-7212-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5739-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5739-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39956868/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5768-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39966566/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5768-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880007/- chr21/39969016/- 21q22.3 21q22.2 Exonic hg19 5'UTR-5'UTR Intra-chr PRAD TCGA-CH-5768-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-A76X-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5741-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7230-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J4-A6M7-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-7321-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-X4-A8KQ-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5752-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-V1-A9O9-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-VP-A87D-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878909/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A87D-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A87D-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-2A-A8VV-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-7793-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-FC-7708-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-VN-A88L-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-8262-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-YL-A8SP-01B - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-A8FO-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-A9S7-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7744-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A7B1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A7B1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42865473/- chr21/39839000/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A8IH-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8IH-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5769-11A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5530-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-V1-A8WS-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-7784-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HI-7171-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J9-A52B-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-7327-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6332-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5521-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6329-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J4-A83I-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-YL-A9WL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A9WL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-YL-A8SA-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A8SA-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-YL-A8SF-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42860320/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6DY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A6DY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5499-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39818130/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5499-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5526-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5497-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A6E2-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42860320/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5502-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-XJ-A83F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A87K-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-7315-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-A9S4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-2A-AAYU-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7212-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-2A-A8VT-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-2A-A8VT-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J9-A8CK-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-ZG-A9LZ-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42868170/- chr21/39869525/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-A76X-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5769-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5769-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6351-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-A76X-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6351-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879085/- chr21/39833123/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J4-A83K-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5769-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7230-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-ZG-A8QZ-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J4-A6M7-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5495-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6365-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J4-A83J-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J4-A83J-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-VN-A88Q-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-VP-A872-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6361-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6361-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42865040/- chr21/39837582/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-X4-A8KQ-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5752-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870674/- chr21/39812988/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-7785-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A8I4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878909/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5498-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5752-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8I4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A87D-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5789-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5789-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39859593/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5789-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870178/- chr21/39874614/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A7B4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42872304/- chr21/39852648/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6362-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6363-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A7B4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39881275/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-2A-A8VV-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J4-A67K-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-7325-01B - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-7325-01B - TopHat-Fusion
TMPRSS2_ERGchr21/42865470/- chr21/39873529/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6342-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6354-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VN-A88M-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A8HL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879500/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7231-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-A65F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-8262-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A8IC-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5791-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39844002/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-A8FO-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879624/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7213-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A7B2-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8IH-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5769-11A - TopHat-Fusion
TMPRSS2_ERGchr21/42878049/- chr21/39870186/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5512-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6384-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878734/- chr21/39868732/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-A6HY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6384-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-A6HY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A7B2-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8IH-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A8SL-01B - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-M7-A71Z-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7081-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7081-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KC-A7F6-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8II-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-M7-A71Z-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A9WX-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-TP-A8TT-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-H9-A6BY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39863826/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A8IA-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-V1-A8WS-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39881275/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-V1-A8WS-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879623/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6356-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6E1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8IA-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5525-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-V1-A9ZG-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5790-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A8HJ-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-ZG-A9L4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-ZG-A9L2-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KC-A4BR-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870044/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-QU-A6IN-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-QU-A6IN-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5508-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A879-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-8469-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-8469-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-8469-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5521-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5521-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6329-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42872206/- chr21/39862257/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-8260-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42876948/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-A46D-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878908/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5765-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878909/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-A46D-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879875/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-MG-AAMC-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5765-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-A46D-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-G9-6329-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-8260-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5516-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-YL-A8SA-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5740-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7819-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42860320/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6DY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6DY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A6DY-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-VP-A876-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J4-A67L-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-VP-A876-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-CH-5764-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5754-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5496-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A8I8-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-4L-AA1F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5526-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J9-A8CM-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42871612/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5524-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5527-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-4L-AA1F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5524-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5527-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J9-A8CM-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5497-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39859593/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5497-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5506-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-A46F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-KK-A6E2-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879875/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5506-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5744-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42860320/- chr21/39895863/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-EJ-5502-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42860320/- chr21/39896851/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5502-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42860320/- chr21/39899608/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5502-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7232-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39846043/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-7232-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7232-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-2A-A8VL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39844002/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-2A-A8VL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866368/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-2A-A8VL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866406/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-2A-A8VL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-2A-A8VL-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-A8D0-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878370/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6E4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-7209-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-A8D1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6E4-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42878371/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-A48F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879499/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-J4-A67S-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879623/- chr21/39817542/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-J4-A67S-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-HC-A48F-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42875331/- chr21/39860754/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-HC-8213-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-KK-A6E6-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-ZG-A9L1-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42870045/- chr21/39795482/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-7315-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42872304/- chr21/39852648/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-G9-6362-11A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-EJ-5542-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42866282/- chr21/39844002/- 21q22.3 21q22.2 Exonic hg19 In-Frame Intra-chr PRAD TCGA-2A-AAYU-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42879876/- chr21/39817543/- 21q22.3 21q22.2 Exonic hg19 Out-of-Frame Intra-chr PRAD TCGA-CH-5739-01A - TopHat-Fusion
TMPRSS2_ERGchr21/42880008/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KK-A8IM-01A - PRADA
TMPRSS2_ERGchr21/42879877/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-J9-A8CK-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KK-A8II-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-HC-7231-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-J4-A83K-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-VP-A875-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-CH-5790-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KK-A8I8-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KK-A6E1-01A - PRADA
TMPRSS2_ERGchr21/42879877/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-HC-A8D1-01A - PRADA
TMPRSS2_ERGchr21/42879877/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-J4-A6G1-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KK-A8I4-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-V1-A8MK-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-J4-A83I-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KC-A7F6-01A - PRADA
TMPRSS2_ERGchr21/42878372/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-EJ-5512-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-YL-A8HK-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-VP-A879-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-EJ-A7NF-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-EJ-A46D-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-G9-7525-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-YL-A8HJ-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KK-A7AU-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-VN-A88M-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KK-A7B4-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-HC-A632-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-VP-A87D-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-YL-A8HL-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39956869/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-VN-A88K-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KK-A6E4-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-VP-A87K-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-EJ-7328-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-KK-A8IA-01A - PRADA
TMPRSS2_ERGchr21/42879877/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-VP-A87C-01A - PRADA
TMPRSS2_ERGchr21/42880008/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 - Intra-chr PRAD TCGA-HC-7213-01A - PRADA
TMPRSS2_ERGchr21/42880078/ chr21/39795453/ 21q22.3 21q22.2 Exonic hg19 - Intra-chr NA EU090248 - ChiTaRs
TMPRSS2_ERGchr21/42880082/ chr21/39956768/ 21q22.3 21q22.2 Exonic hg19 - Intra-chr NA DQ204773 - ChiTaRs
TMPRSS2_ERGchr21/42880068/ chr21/39767292/ 21q22.3 21q22.2 Exonic hg19 - Intra-chr NA EU432099 - ChiTaRs
TMPRSS2_ERGchr21/42880065/ chr21/39817494/ 21q22.3 21q22.2 Exonic hg19 - Intra-chr NA DQ831522 - ChiTaRs
TMPRSS2_ERGchr21/42880085/ chr21/39817389/ 21q22.3 21q22.2 Exonic hg19 - Intra-chr NA FJ423744 - ChiTaRs
TMPRSS2_ERGchr21/42866283/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-frame Intra-chr PRAD TCGA-KK-A8IH-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-CH-5740-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39795483/- 21q22.3 21q22.2 Exonic hg19 Out-of-frame Intra-chr PRAD TCGA-XJ-A83F-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-VN-A88L-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-VN-A88Q-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-HC-7744-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-EJ-5499-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-EJ-7784-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-EJ-7327-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-EJ-5521-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-J9-A52B-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-EJ-A46F-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-KK-A8IC-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-VP-A876-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-H9-A6BY-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-EJ-5506-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-EJ-A8FO-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-HC-A8D0-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-J9-A8CM-01A - PRADA
TMPRSS2_ERGchr21/42866283/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 Out-of-frame Intra-chr PRAD TCGA-X4-A8KQ-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-VP-A872-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-HC-8262-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-HC-A76X-01A - PRADA
TMPRSS2_ERGchr21/42870046/- chr21/39817544/- 21q22.3 21q22.2 Exonic hg19 In-frame Intra-chr PRAD TCGA-M7-A71Z-01A - PRADA
TMPRSS2_ERGchr21/42880082/ chr21/39817327/ 21q22.3 21q22.2 Exonic hg19 - Intra-chr prostate cancer DQ204772 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair TMPRSS2--ERG information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human DQ204772TMPRSS2--ERG TMPRSS221 42880007 42880082 - 1 76 100 ERG21 39817327 39817547 - 73 293 100
Human EU090248TMPRSS2--ERG TMPRSS221 42880006 42880078 - 1 73 100 ERG21 39795453 39956872 - 69 290 100
Human DQ204773TMPRSS2--ERG TMPRSS221 42880006 42880082 - 1 77 100 ERG21 39956768 39956872 - 73 177 100
Human EU432099TMPRSS2--ERG TMPRSS221 42880007 42880068 - 1 62 100 ERG21 39767292 39817547 - 59 999 100
Human DQ831522TMPRSS2--ERG TMPRSS221 42880006 42880065 - 1 60 100 ERG21 39817494 39956872 - 56 297 100
Human FJ423744TMPRSS2--ERG TMPRSS221 42880007 42880085 - 2 80 100 ERG21 39817389 39817547 - 77 235 100

FARE-CAFE

Top
The fusion gene pair TMPRSS2--ERG information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
TMPRSS2-ERG Prostate cancer qPCR,RT-PCR,RACE,PCR,FISH,DNA sequencing (21)(q22.2;q22.3) PubMed:16254181

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
TMPRSS2-ERG TMPRSS2-ERG-Isoform1 TMPRSS2 _ _ 0 ERG _ 0 _ agcgcggcagGaagccttat 16254181 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform2 TMPRSS2 _ _ 0 ERG _ 0 _ agcgcggcagGttattccag 16951141 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform3 TMPRSS2 _ _ 0 ERG _ 0 _ tgcacctcaaGaagccttat 16951141 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform4 TMPRSS2 _ _ 0 ERG _ 0 _ tttgaactcaGaactctcct 16951141 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform5 TMPRSS2 _ _ 0 ERG _ 0 _ tttgaactcaGaagccttat 16951141 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform6 TMPRSS2 _ _ 0 ERG _ 0 _ tttgaactcaGttattccag 16951141 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform7 TMPRSS2 _ _ 0 ERG _ 0 _ aactgataaggcttcCtgccgcgctccagg 17032499 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform8 TMPRSS2 42861456 1 0 ERG 39795460 0 1 CGCTGGCCTACTCTGGAAGTTCagAACTCTCCTGATGAATGCAGTGT 16575875 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform9 TMPRSS2 42860308 0 0 ERG _ 0 _ CGGGGAGGACGAGAATCGGTGTggAAGCCTTATCAGTTATGAGT 16575875 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform10 TMPRSS2 42870065 1 0 ERG 39817523 0 1 GCAAGATGGCTTTGAACTCagAAGCCTTATCAGTTGTGAGTG 16575875 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform11 TMPRSS2 42880028 1 0 ERG 39817524 0 1 GCGCCGCCTGGAGCGCGGCAggAAGCCTTATCAGTTGTGAGT 16575875 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform12 TMPRSS2 42861455 1 0 ERG 39817524 0 1 GCTGGCCTACTCTGGAAGTTCagAAGCCTTATCAGTTGTGAGT 16575875 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform13 TMPRSS2 _ _ 0 ERG _ 0 _ agcgcggcagCcgtcaggtt 16951141 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform14 TMPRSS2 _ _ 0 ERG _ 0 _ agcgcggcagGaactctcct 16951141 _
TMPRSS2-ERG TMPRSS2-ERG-Isoform15 TMPRSS2 _ _ 0 ERG _ 0 _ agcgcggcagGaagccttat 16951141 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
TMPRSS2-ERG TMPRSS2-ERG-Isoform1 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform2 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform3 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform4 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform5 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform6 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform7 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform8 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform9 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform10 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform11 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform12 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
- -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform13 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform14 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets
TMPRSS2-ERG TMPRSS2-ERG-Isoform15 - - - -TMPRSS2 1) SRCR_2
2) Trypsin
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SRCR_2
2) Trypsin
3) SAM_PNT
4) Ets
1) A2M_N , Coagulase , Ecotin , Haemadin , Kazal_1 , Kunitz_legume , PAN_1 , Peptidase_M14 , SH3_1 , Squash , Thrombin_light , Trypsin , WAP , A2M_recep , CompInhib_SCIN , FXa_inhibition , Hepsin-SRCR , Kazal_2 , LRR_8 , PDZ , Pro_Al_protease , SRCR , Staphylokinase , Tissue_fac , Trypsin_2 , potato_inhibit , Antistasin , EGF , Fib_alpha , Hirudin , Kringle , Ldl_recept_a , PDZ_2 , Propep_M14 , Sema , Sushi , Tme5_EGF_like , V-set , Bowman-Birk_leg , EGF_CA , Globin , Inhibitor_I10 , Kunitz_BPTI , NGF , Pacifastin_I , Prot_inhib_II , Serpin , TIL , Triabin , VWA
2) SAM_PNT , Phage_lysozyme
3) SRF-TF , Ank_2 , PAX , Ets

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
TMPRSS2-ERG hsa-miR-133a-3phsa-miR-145-5phsa-miR-133b _ Report assay

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
TMPRSS2-ERG NM_001135099.1 - - -

TicDB

Top
The fusion gene pair TMPRSS2--ERG information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
TMPRSS2 ERG 16254181 agcgcggcagGaagccttat
TMPRSS2 ERG 16575875 CGCTGGCCTACTCTGGAAGTTCagAACTCTCCTGATGAATGCAGTGT
TMPRSS2 ERG 16575875 CGGGGAGGACGAGAATCGGTGTggAAGCCTTATCAGTTATGAGT
TMPRSS2 ERG 16575875 GCAAGATGGCTTTGAACTCagAAGCCTTATCAGTTGTGAGTG
TMPRSS2 ERG 16575875 GCGCCGCCTGGAGCGCGGCAggAAGCCTTATCAGTTGTGAGT
TMPRSS2 ERG 16575875 GCTGGCCTACTCTGGAAGTTCagAAGCCTTATCAGTTGTGAGT
TMPRSS2 ERG 16951141 agcgcggcagCcgtcaggtt
TMPRSS2 ERG 16951141 agcgcggcagGaactctcct
TMPRSS2 ERG 16951141 agcgcggcagGaagccttat
TMPRSS2 ERG 16951141 agcgcggcagGttattccag
TMPRSS2 ERG 16951141 tgcacctcaaGaagccttat
TMPRSS2 ERG 16951141 tttgaactcaGaactctcct
TMPRSS2 ERG 16951141 tttgaactcaGaagccttat
TMPRSS2 ERG 16951141 tttgaactcaGttattccag
TMPRSS2 ERG 17032499 aactgataaggcttcCtgccgcgctccagg

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair TMPRSS2--ERG information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
PRAD 2A-A8VL-01A TMPRSS2__ERG 2 21:42866283/-1 21:39817544/-1 tier1 Out-of-frame 18086 NA
PRAD 2A-A8VT-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18087 NA
PRAD 2A-A8VV-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18088 NA
PRAD 2A-AAYU-01A TMPRSS2__ERG 2 21:42866283/-1 21:39817544/-1 tier1 Out-of-frame 18089 NA
PRAD 4L-AA1F-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18090 NA
PRAD CH-5739-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18091 NA
PRAD CH-5740-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18092 NA
PRAD CH-5741-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18093 NA
PRAD CH-5743-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier3 In-frame 18094 NA
PRAD CH-5746-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18095 NA
PRAD CH-5752-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18096 NA
PRAD CH-5764-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18097 NA
PRAD CH-5765-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18098 NA
PRAD CH-5768-01A TMPRSS2__ERG 2 21:42880008/-1 21:39956869/-1 tier1 5UTR-5UTR 18099 NA
PRAD CH-5769-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18100 NA
PRAD CH-5789-01A TMPRSS2__ERG 2 21:42866283/-1 21:39817544/-1 tier1 Out-of-frame 18101 NA
PRAD CH-5790-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18102 NA
PRAD CH-5791-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18103 NA
PRAD CH-5794-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18104 NA
PRAD EJ-5495-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18105 NA
PRAD EJ-5496-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18106 NA
PRAD EJ-5497-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18107 NA
PRAD EJ-5498-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18108 NA
PRAD EJ-5499-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18109 NA
PRAD EJ-5502-01A TMPRSS2__ERG 2 21:42860321/-1 21:39817544/-1 tier2 Out-of-frame 18110 NA
PRAD EJ-5506-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18111 NA
PRAD EJ-5507-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18112 NA
PRAD EJ-5508-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18113 NA
PRAD EJ-5512-01A TMPRSS2__ERG 2 21:42878372/-1 21:39817544/-1 tier1 NA 18114 NA
PRAD EJ-5516-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18115 NA
PRAD EJ-5521-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18116 NA
PRAD EJ-5522-01A TMPRSS2__ERG 2 21:42880008/-1 21:39956869/-1 tier1 5UTR-5UTR 18117 NA
PRAD EJ-5524-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18118 NA
PRAD EJ-5525-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18119 NA
PRAD EJ-5526-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18120 NA
PRAD EJ-5527-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18121 NA
PRAD EJ-5530-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18122 NA
PRAD EJ-5542-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18123 NA
PRAD EJ-7315-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18124 NA
PRAD EJ-7321-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18125 NA
PRAD EJ-7325-01B TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18126 NA
PRAD EJ-7327-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18127 NA
PRAD EJ-7328-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18128 NA
PRAD EJ-7783-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18129 NA
PRAD EJ-7784-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18130 NA
PRAD EJ-7785-01A TMPRSS2__ERG 2 21:42878372/-1 21:39795483/-1 tier2 NA 18131 NA
PRAD EJ-7793-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18132 NA
PRAD EJ-7797-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18133 NA
PRAD EJ-8469-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18134 NA
PRAD EJ-8472-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18135 NA
PRAD EJ-A46D-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18136 NA
PRAD EJ-A46F-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18137 NA
PRAD EJ-A65D-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18138 NA
PRAD EJ-A65F-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18139 NA
PRAD EJ-A7NF-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier4 5UTR-CDS 18140 NA
PRAD EJ-A8FO-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18141 NA
PRAD FC-7708-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18142 NA
PRAD G9-6329-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18143 NA
PRAD G9-6332-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18144 NA
PRAD G9-6342-01A TMPRSS2__ERG 2 21:42880008/-1 21:39795483/-1 tier1 5UTR-CDS 18145 NA
PRAD G9-6351-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18146 NA
PRAD G9-6353-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18147 NA
PRAD G9-6354-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18148 NA
PRAD G9-6356-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier4 5UTR-CDS 18149 NA
PRAD G9-6361-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18150 NA
PRAD G9-6362-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier2 5UTR-CDS 18151 NA
PRAD G9-6363-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18152 NA
PRAD G9-6364-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier2 5UTR-CDS 18153 NA
PRAD G9-6365-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18154 validated
PRAD G9-6373-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18155 NA
PRAD G9-6377-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18156 NA
PRAD G9-6384-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18157 NA
PRAD G9-6385-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18158 NA
PRAD G9-7509-01A TMPRSS2__ERG 2 21:42880008/-1 21:39956869/-1 tier1 5UTR-5UTR 18159 NA
PRAD G9-7525-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18160 NA
PRAD G9-A9S4-01A TMPRSS2__ERG 2 21:42878372/-1 21:39817544/-1 tier1 NA 18161 NA
PRAD G9-A9S7-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18162 NA
PRAD H9-A6BY-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18163 NA
PRAD HC-7077-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18164 NA
PRAD HC-7081-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18165 NA
PRAD HC-7209-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18166 NA
PRAD HC-7212-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18167 NA
PRAD HC-7213-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18168 NA
PRAD HC-7230-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18169 NA
PRAD HC-7231-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18170 NA
PRAD HC-7232-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18171 NA
PRAD HC-7744-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18172 validated
PRAD HC-7747-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18173 NA
PRAD HC-7818-01A TMPRSS2__ERG 2 21:42879877/-1 21:39956869/-1 tier1 5UTR-5UTR 18174 NA
PRAD HC-7819-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier2 5UTR-CDS 18175 NA
PRAD HC-8213-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18176 NA
PRAD HC-8257-01A TMPRSS2__ERG 2 21:42870046/-1 21:39956869/-1 tier1 CDS-5UTR 18177 NA
PRAD HC-8259-01A TMPRSS2__ERG 2 21:42878372/-1 21:39817544/-1 tier1 NA 18178 NA
PRAD HC-8260-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier4 5UTR-CDS 18179 NA
PRAD HC-8262-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18180 NA
PRAD HC-A48F-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18181 NA
PRAD HC-A632-01A TMPRSS2__ERG 2 21:42870046/-1 21:39956869/-1 tier1 CDS-5UTR 18182 NA
PRAD HC-A6HY-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18183 NA
PRAD HC-A76X-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18184 NA
PRAD HC-A8D0-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18185 NA
PRAD HC-A8D1-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18186 NA
PRAD J4-8198-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier2 5UTR-CDS 18187 NA
PRAD J4-A67K-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18188 NA
PRAD J4-A67L-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18189 NA
PRAD J4-A67R-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18190 NA
PRAD J4-A67S-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier2 5UTR-CDS 18191 NA
PRAD J4-A67T-01A TMPRSS2__ERG 2 21:42880008/-1 21:39956869/-1 tier1 5UTR-5UTR 18192 NA
PRAD J4-A6G1-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier2 5UTR-CDS 18193 NA
PRAD J4-A6M7-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18194 NA
PRAD J4-A83I-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18195 NA
PRAD J4-A83J-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier4 In-frame 18196 NA
PRAD J4-A83K-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18197 NA
PRAD J4-AATV-01A TMPRSS2__ERG 2 21:42879877/-1 21:39956869/-1 tier1 5UTR-5UTR 18198 NA
PRAD J9-A52B-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18199 NA
PRAD J9-A8CK-01A TMPRSS2__ERG 2 21:42879877/-1 21:39795483/-1 tier1 5UTR-CDS 18200 NA
PRAD J9-A8CM-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18201 NA
PRAD KC-A4BN-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18202 NA
PRAD KC-A4BR-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18203 NA
PRAD KC-A4BV-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18204 NA
PRAD KC-A7F6-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18205 NA
PRAD KK-A59Y-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18206 NA
PRAD KK-A6DY-01A TMPRSS2__ERG 2 21:42860321/-1 21:39817544/-1 tier1 Out-of-frame 18207 NA
PRAD KK-A6E1-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18208 NA
PRAD KK-A6E2-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18209 NA
PRAD KK-A6E4-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18210 NA
PRAD KK-A6E6-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18211 NA
PRAD KK-A7AU-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18212 NA
PRAD KK-A7B1-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18213 NA
PRAD KK-A7B2-01A TMPRSS2__ERG 2 21:42866283/-1 21:39817544/-1 tier1 Out-of-frame 18214 NA
PRAD KK-A7B4-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18215 NA
PRAD KK-A8I4-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18216 NA
PRAD KK-A8I8-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18217 NA
PRAD KK-A8IA-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18218 NA
PRAD KK-A8IC-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18219 NA
PRAD KK-A8IH-01A TMPRSS2__ERG 2 21:42866283/-1 21:39817544/-1 tier2 Out-of-frame 18220 NA
PRAD KK-A8II-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18221 NA
PRAD KK-A8IM-01A TMPRSS2__ERG 2 21:42880008/-1 21:39956869/-1 tier1 5UTR-5UTR 18222 NA
PRAD M7-A71Z-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18223 NA
PRAD MG-AAMC-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18224 NA
PRAD QU-A6IN-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18225 NA
PRAD TP-A8TT-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18226 NA
PRAD V1-A8MK-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18227 NA
PRAD V1-A8WS-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18228 NA
PRAD V1-A9O9-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18229 NA
PRAD V1-A9OY-01A TMPRSS2__ERG 2 21:42879877/-1 21:39956869/-1 tier2 5UTR-5UTR 18230 NA
PRAD V1-A9ZG-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18231 NA
PRAD VN-A88K-01A TMPRSS2__ERG 2 21:42870046/-1 21:39956869/-1 tier1 CDS-5UTR 18232 NA
PRAD VN-A88L-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18233 NA
PRAD VN-A88M-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18234 NA
PRAD VN-A88Q-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18235 NA
PRAD VP-A872-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18236 NA
PRAD VP-A875-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18237 NA
PRAD VP-A876-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18238 NA
PRAD VP-A879-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18239 NA
PRAD VP-A87C-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18240 NA
PRAD VP-A87D-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18241 NA
PRAD VP-A87K-01A TMPRSS2__ERG 2 21:42880008/-1 21:39795483/-1 tier1 5UTR-CDS 18242 NA
PRAD X4-A8KQ-01A TMPRSS2__ERG 2 21:42866283/-1 21:39817544/-1 tier1 Out-of-frame 18243 NA
PRAD XJ-A83F-01A TMPRSS2__ERG 2 21:42870046/-1 21:39795483/-1 tier1 Out-of-frame 18244 NA
PRAD XJ-A9DI-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18245 NA
PRAD XJ-A9DK-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18246 NA
PRAD XQ-A8TB-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18247 NA
PRAD YL-A8HJ-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18248 NA
PRAD YL-A8HK-01A TMPRSS2__ERG 2 21:42870046/-1 21:39956869/-1 tier1 CDS-5UTR 18249 NA
PRAD YL-A8HL-01A TMPRSS2__ERG 2 21:42880008/-1 21:39795483/-1 tier1 5UTR-CDS 18250 NA
PRAD YL-A8SA-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18251 NA
PRAD YL-A8SF-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18252 NA
PRAD YL-A8SL-01B TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18253 NA
PRAD YL-A8SP-01B TMPRSS2__ERG 2 21:42878372/-1 21:39817544/-1 tier1 NA 18254 NA
PRAD YL-A9WL-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier1 In-frame 18255 NA
PRAD YL-A9WX-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18256 NA
PRAD ZG-A8QZ-01A TMPRSS2__ERG 2 21:42870046/-1 21:39817544/-1 tier2 In-frame 18257 NA
PRAD ZG-A9L1-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18258 NA
PRAD ZG-A9L2-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18259 NA
PRAD ZG-A9L4-01A TMPRSS2__ERG 2 21:42879877/-1 21:39817544/-1 tier1 5UTR-CDS 18260 NA
PRAD ZG-A9LZ-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18261 NA
PRAD ZG-A9N3-01A TMPRSS2__ERG 2 21:42880008/-1 21:39817544/-1 tier1 5UTR-CDS 18262 NA

FusionCancer

Top
The fusion gene pair TMPRSS2--ERG information is available in FusionCancer Database.
Database_IDHead_gene_symbolHead_breakpoint_locationTail_gene_symbolTail_breakpoint_locationCancer_typeSRA
FUSC004187TMPRSS2chr21:42880084ERGchr21:39751949Prostate cancerERR031028
FUSC004187TMPRSS2chr21:42870046ERGchr21:39817544Prostate cancerERR031028
FUSC004187TMPRSS2chr21:42880084ERGchr21:39751949Prostate cancerSRR057630
FUSC004187TMPRSS2chr21:42880084ERGchr21:39751949Prostate cancerSRR057636
FUSC004187TMPRSS2chr21:42880008ERGchr21:39956869Prostate cancerSRR496580
FUSC004187TMPRSS2chr21:42880008ERGchr21:39956869Prostate cancerSRR496581
FUSC004187TMPRSS2chr21:42878372ERGchr21:40033583Prostate cancerSRR496582
FUSC004187TMPRSS2chr21:42879877ERGchr21:40033583Prostate cancerSRR496587
FUSC004187TMPRSS2chr21:42878372ERGchr21:40033583Prostate cancerSRR496588
FUSC004187TMPRSS2chr21:42879877ERGchr21:40033583Prostate cancerSRR496593
FUSC004187TMPRSS2chr21:42880008ERGchr21:39956869Prostate cancerSRR496597

ConjoinG

Top
The fusion gene pair TMPRSS2--ERG information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene TMPRSS2--ERG has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene TMPRSS2--ERG is found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016)

Bodymap2

Top
Fusion gene TMPRSS2--ERG is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene TMPRSS2--ERG is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene TMPRSS2--ERG was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair TMPRSS2--ERG information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene TMPRSS2--ERG is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene TMPRSS2--ERG has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene TMPRSS2 is a known oncogene according to ONGENE database.


The tail gene ERG is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene TMPRSS2 is cancer associated according to Bushman Cancer Gene database.


The tail gene ERG is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene TMPRSS2 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ERG is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene TMPRSS2--ERG is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene TMPRSS2--ERG is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair TMPRSS2--ERG information is available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

5'Gene5'Chr5'Coordinate3'Gene3'Chr3'Coordinate# Spanning ReadsSPLICE JUNCTION?IN-FRAME?JUNCTION SEQUENCECASE NUMBERCAISISLibrary
TMPRSS22142880008ERG213981754487YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 15115255SI_8318
TMPRSS22142880008ERG21397954834YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 15115255SI_8318
TMPRSS22142879877ERG21398175449YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 15115255SI_8294
TMPRSS22142879877ERG213981754435YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 15115255SI_8318
TMPRSS22142879877ERG21397954831YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 15115255SI_8318
TMPRSS22142880008ERG2139817544442YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 29115065SI_6645
TMPRSS22142879877ERG213981754459YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 29115065SI_6645
TMPRSS22142870046ERG2139817544217YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 29115065SI_6645
TMPRSS22142880008ERG213981754477YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 397115151SI_7450
TMPRSS22142879877ERG213981754425YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 397115151SI_7450
TMPRSS22142870046ERG213981754488YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 397115151SI_7446
TMPRSS22142870046ERG2139817544136YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 397115151SI_7450
TMPRSS22142866407ERG2139817544141YESNOCGGAAAACCCCTATCCCGCACAGCCCACTGTGGTCCCCACTGTCTACGAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 397115151SI_7446
TMPRSS22142866407ERG2139817544126YESNOCGGAAAACCCCTATCCCGCACAGCCCACTGTGGTCCCCACTGTCTACGAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 397115151SI_7450
TMPRSS22142866283ERG2139817544176YESNOCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 397115151SI_7446
TMPRSS22142866283ERG2139817544262YESNOCGTCGTCTGCACGCAGCCCAAATCCCCATCCGGGACAGTGTGCACCTCAA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 397115151SI_7450
TMPRSS22142879877ERG213981754427YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 45115033SI_5668
TMPRSS22142879877ERG2139817544110YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 45115033SI_5688
TMPRSS22142879609ERG213986312368NONOGCCTGCCCTCCACGGCCCCCGCCTGGGAGCACCGGTGCGCCTTTTCTCTT GACAGTGTGCACATGATGCTCACCTTTGAGGAAGAAGAAACTGTTGAAAC 45115033SI_5668
TMPRSS22142879609ERG2139863123115NONOGCCTGCCCTCCACGGCCCCCGCCTGGGAGCACCGGTGCGCCTTTTCTCTT GACAGTGTGCACATGATGCTCACCTTTGAGGAAGAAGAAACTGTTGAAAC 45115033SI_5688
TMPRSS22142880008ERG2139817544380YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 59115041SI_5903
TMPRSS22142879877ERG213981754449YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 59115041SI_5845
TMPRSS22142879877ERG2139817544134YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 59115041SI_5903
TMPRSS22142870046ERG2139817544104YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 59115041SI_5845
TMPRSS22142870046ERG2139817544335YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 59115041SI_5903
TMPRSS22142880008ERG2139817544182YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 69115052SI_6644
TMPRSS22142879877ERG21398175448YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 69115052SI_6631
TMPRSS22142879877ERG2139817544158YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 69115052SI_6644
TMPRSS22142870046ERG213981754489YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 69115052SI_6631
TMPRSS22142870046ERG2139817544320YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 69115052SI_6644
TMPRSS22142880008ERG2139817544119YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 75115259SI_6566
TMPRSS22142879877ERG213981754415YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 75115259SI_6566
TMPRSS22142880008ERG2139817544237YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 85115128SI_6860
TMPRSS22142880008ERG21397954835YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 85115128SI_6860
TMPRSS22142879877ERG213981754470YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 85115128SI_6851
TMPRSS22142879877ERG2139817544197YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 85115128SI_6860
TMPRSS22142879877ERG21397954834YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 85115128SI_6860
TMPRSS22142880008ERG2139817544232YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 99115339SI_8557
TMPRSS22142879877ERG213981754421YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 99115339SI_8528
TMPRSS22142879877ERG213981754448YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 99115339SI_8557
TMPRSS22142880008ERG2139817544321YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1097115337SI_9053
TMPRSS22142879877ERG213981754431YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1097115337SI_8983
TMPRSS22142879877ERG213981754420YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1097115337SI_9053
TMPRSS22142880008ERG2139817544339YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 119115048SI_6296
TMPRSS22142879877ERG2139817544128YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 119115048SI_6296
TMPRSS22142879877ERG21397954832YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 119115048SI_6296
TMPRSS22142880008ERG213981754488YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1297115335SI_9052
TMPRSS22142879877ERG213981754418YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1297115335SI_8982
TMPRSS22142879877ERG213981754419YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1297115335SI_9052
TMPRSS22142880008ERG2139817544173YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 175115073SI_6072
TMPRSS22142879877ERG213981754412YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 175115073SI_6059
TMPRSS22142879877ERG213981754436YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 175115073SI_6072
TMPRSS22142870046ERG21398460446YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA TTAAACTCCATTGATGATGCACAGTTGACAAGAATTGCCCCTCCAAGATC 175115073SI_6059
TMPRSS22142870046ERG21398460447YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA TTAAACTCCATTGATGATGCACAGTTGACAAGAATTGCCCCTCCAAGATC 175115073SI_6072
TMPRSS22142870046ERG213981754463YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 175115073SI_6059
TMPRSS22142870046ERG2139817544133YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 175115073SI_6072
TMPRSS22142879877ERG213981754412YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1897115331SI_8981
TMPRSS22142879877ERG213981754433YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1897115331SI_9051
TMPRSS22142880008ERG2139795483827YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 199115050SI_6293
TMPRSS22142879877ERG213979548316YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 199115050SI_6279
TMPRSS22142879877ERG2139795483129YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 199115050SI_6293
TMPRSS22142880008ERG2139817544194YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 2097115147SI_7448
TMPRSS22142879877ERG213981754418YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 2097115147SI_7444
TMPRSS22142879877ERG213981754482YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 2097115147SI_7448
TMPRSS22142880008ERG2139817544116YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 215115129SI_6701
TMPRSS22142879877ERG21398175442YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 215115129SI_6690
TMPRSS22142879877ERG213981754432YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 215115129SI_6701
TMPRSS22142879877ERG213981754420YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 225115198SI_7405
TMPRSS22142880008ERG2139817544324YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 245115196SI_7263
TMPRSS22142879877ERG213981754414YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 245115196SI_7233
TMPRSS22142879877ERG2139817544115YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 245115196SI_7263
TMPRSS22142880008ERG2139817544209YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 255115023SI_4733
TMPRSS22142879877ERG213981754414YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 255115023SI_4733
TMPRSS22142880008ERG213981754490YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 2697115281SI_8559
TMPRSS22142879877ERG213981754416YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 2697115281SI_8530
TMPRSS22142879877ERG213981754410YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 2697115281SI_8559
TMPRSS22142880008ERG2139817544154YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 27611524706115247-T-A1
TMPRSS22142879877ERG213981754450YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 27611524706115247-T-A1
TMPRSS22142880008ERG2139817544387YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 285115261SI_7602
TMPRSS22142879877ERG213981754411YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 285115261SI_7590
TMPRSS22142879877ERG213981754445YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 285115261SI_7602
TMPRSS22142879877ERG21397954835YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 285115261SI_7602
TMPRSS22142870046ERG213984604442YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA TTAAACTCCATTGATGATGCACAGTTGACAAGAATTGCCCCTCCAAGATC 285115261SI_7590
TMPRSS22142870046ERG213984604420YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA TTAAACTCCATTGATGATGCACAGTTGACAAGAATTGCCCCTCCAAGATC 285115261SI_7602
TMPRSS22142870046ERG2139817544102YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 285115261SI_7590
TMPRSS22142870046ERG2139817544304YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 285115261SI_7602
TMPRSS22142880008ERG213981754453YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 46111515701115157-TA2
TMPRSS22142879877ERG213981754416YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 46111515701115157-TA2
TMPRSS22142880008ERG2139817544125YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 475115193SI_7596
TMPRSS22142879877ERG213981754415YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 475115193SI_7585
TMPRSS22142879877ERG213981754459YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 475115193SI_7596
TMPRSS22142870046ERG213981754423YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 475115193SI_7585
TMPRSS22142870046ERG213981754482YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 475115193SI_7596
TMPRSS22142880008ERG2139817544127YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 4897115131SI_7138
TMPRSS22142879877ERG213981754410YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 4897115131SI_7122
TMPRSS22142879877ERG213981754434YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 4897115131SI_7138
TMPRSS22142870046ERG21398460443YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA TTAAACTCCATTGATGATGCACAGTTGACAAGAATTGCCCCTCCAAGATC 4897115131SI_7122
TMPRSS22142870046ERG213981754451YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 4897115131SI_7122
TMPRSS22142870046ERG2139817544196YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 4897115131SI_7138
TMPRSS22142880008ERG2139817544131YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 4997115001SI_6299
TMPRSS22142879877ERG213981754432YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 4997115001SI_6299
TMPRSS22142880008ERG213981754439YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 5197115166SI_7690
TMPRSS22142880008ERG2139817544238YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 565115160SI_7212
TMPRSS22142880008ERG213979548316YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 565115160SI_7212
TMPRSS22142879877ERG213981754434YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 565115160SI_7203
TMPRSS22142879877ERG2139817544135YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 565115160SI_7212
TMPRSS22142879877ERG21397954834YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 565115160SI_7203
TMPRSS22142879877ERG21397954833YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 565115160SI_7212
TMPRSS22142880008ERG213981754476YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 57111515401115154-TA3
TMPRSS22142880008ERG21397954832YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 57111515401115154-TA3
TMPRSS22142879877ERG213981754434YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 57111515401115154-TA3
TMPRSS22142880008ERG213981754459YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 58611512206115122-T
TMPRSS22142870046ERG213981754442YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 58611512206115122-T
TMPRSS22142880008ERG2139817544129YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 749115173SI_7607
TMPRSS22142879877ERG213981754413YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 749115173SI_7607
TMPRSS22142880008ERG2139817544383YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 7597115007SI_6800
TMPRSS22142879877ERG213981754414YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 7597115007SI_6770
TMPRSS22142879877ERG213981754485YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 7597115007SI_6800
TMPRSS22142879877ERG21397954833YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 7597115007SI_6800
TMPRSS22142870046ERG213981754451YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 7597115007SI_6770
TMPRSS22142870046ERG2139817544228YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 7597115007SI_6800
TMPRSS22142880008ERG21398175441653YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 775115030SI_5555
TMPRSS22142880008ERG213979548318YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 775115030SI_5555
TMPRSS22142879877ERG2139817544173YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 775115030SI_5555
TMPRSS22142870046ERG213984604410YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA TTAAACTCCATTGATGATGCACAGTTGACAAGAATTGCCCCTCCAAGATC 775115030SI_5555
TMPRSS22142870046ERG2139817544438YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 775115030SI_5555
TMPRSS22142880008ERG213981754418YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 78611511706115117-T
TMPRSS22142880008ERG2139956869107YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GTTATTCCAGGATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGC 795115199SI_6573
TMPRSS22142879877ERG213995686935YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GTTATTCCAGGATCTTTGGAGACCCGAGGAAAGCCGTGTTGACCAAAAGC 795115199SI_6573
TMPRSS22142880008ERG213981754460YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 84111524401115244-TA4
TMPRSS22142879877ERG213981754414YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 84111524401115244-TA4
TMPRSS22142880008ERG2139817544615YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 855115256SI_7993
TMPRSS22142880008ERG21397954836YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 855115256SI_7993
TMPRSS22142879877ERG213981754417YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 855115256SI_7956
TMPRSS22142879877ERG2139817544115YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 855115256SI_7993
TMPRSS22142880008ERG2139817544194YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 869115108SI_6986
TMPRSS22142879877ERG213981754425YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 869115108SI_6986
TMPRSS22142880008ERG213981754471YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 895115026SI_4966
TMPRSS22142880008ERG21398175441358YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 895115026SI_4971
TMPRSS22142879877ERG213981754410YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 895115026SI_4966
TMPRSS22142879877ERG2139817544134YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 895115026SI_4971
TMPRSS22142879877ERG21397954834YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 895115026SI_4971
TMPRSS22142880008ERG213981754464YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 925115058SI_6218
TMPRSS22142880008ERG213981754417YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 925115058SI_6271
TMPRSS22142879877ERG213981754420YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 925115058SI_6218
TMPRSS22142879877ERG21398175448YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 925115058SI_6271
TMPRSS22142879877ERG21397954833YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 925115058SI_6218
TMPRSS22142870046ERG213981754440YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 925115058SI_6218
TMPRSS22142870046ERG213981754431YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 925115058SI_6271
TMPRSS22142879877ERG21399476713YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG CCGTCAGGTTCTGAACAGCTGGTAGATGGGCTGGCTTACTGAAGGACATG 935115158SI_7010
TMPRSS22142866407ERG213981754418YESNOGGAAAACCCCTATCCCGCACAGCCCACTGTGGTCCCCACTGTCTACGAGG AAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTAC 945115359SI_9124
TMPRSS22142866339ERG2139818719127NONOTACCCGTCCCCCGTGCCCCAGTACGCCCCGAGGGTCCTGACGCAGGCTTC TCTCAGATTTCTCATTTGGAGATGACAAGTTTGGACTGGAAGGGTCTGCG 945115359SI_9074
TMPRSS22142880008ERG213981754422YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 965115032SI_5665
TMPRSS22142880008ERG2139817544198YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 965115032SI_5684
TMPRSS22142879877ERG213981754423YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 965115032SI_5684
TMPRSS22142870046ERG21398460442YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA TTAAACTCCATTGATGATGCACAGTTGACAAGAATTGCCCCTCCAAGATC 965115032SI_5684
TMPRSS22142870046ERG213981754469YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 965115032SI_5665
TMPRSS22142870046ERG2139817544147YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 965115032SI_5684
TMPRSS22142870046ERG21397954834YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 965115032SI_5684
TMPRSS22142880008ERG2139817544177YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 979115341SI_8325
TMPRSS22142879877ERG21398175448YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 979115341SI_8300
TMPRSS22142879877ERG213981754427YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 979115341SI_8325
TMPRSS22142880008ERG21397756313YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 98111518301115183-TA2
TMPRSS22142879877ERG213979548337YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 98111518301115183-TA2
TMPRSS22142870046ERG2139795483679YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 98111518301115183-TA2
TMPRSS22142879877ERG213981754420YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 995115197SI_7237
TMPRSS22142879877ERG213981754485YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 995115197SI_7267
TMPRSS22142870046ERG213984604419YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA TTAAACTCCATTGATGATGCACAGTTGACAAGAATTGCCCCTCCAAGATC 995115197SI_7237
TMPRSS22142870046ERG2139817544247YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 995115197SI_7237
TMPRSS22142870046ERG2139817544520YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 995115197SI_7267
TMPRSS22142870046ERG21397954838YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 995115197SI_7267
TMPRSS22142880008ERG21398175444YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1005115258SI_6061
TMPRSS22142879877ERG21398175442YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1005115258SI_6061
TMPRSS22142879877ERG21398175446YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1005115258SI_6074
TMPRSS22142880008ERG213981754428YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 10297115095SI_7139
TMPRSS22142879877ERG213981754431YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 10297115095SI_7139
TMPRSS22142879877ERG21397954833YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 10297115095SI_7139
TMPRSS22142880008ERG2139817544128YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 103611523406115234-T-A1
TMPRSS22142879877ERG213981754420YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 103611523406115234-T-A1
TMPRSS22142870046ERG2139817544251YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 103611523406115234-T-A1
TMPRSS22142880008ERG213981754431YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1089115069SI_6579
TMPRSS22142879877ERG213981754414YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1089115069SI_6579
TMPRSS22142870046ERG21398175444YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1089115069SI_6562
TMPRSS22142870046ERG213981754415YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1089115069SI_6579
TMPRSS22142880008ERG2139817544158YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1095115186SI_6698
TMPRSS22142879877ERG213981754428YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1095115186SI_6698
TMPRSS22142879877ERG21398175449YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1095115186SI_6848
TMPRSS22142870046ERG21398175448YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1115115028SI_5258
TMPRSS22142870046ERG213981754447YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1129115055SI_6294
TMPRSS22142880008ERG2139817544516YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1249115176SI_6648
TMPRSS22142879877ERG213981754413YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1249115176SI_6634
TMPRSS22142879877ERG2139817544109YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1249115176SI_6648
TMPRSS22142880008ERG2139817544672YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1339115037SI_5849
TMPRSS22142879877ERG2139817544252YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1339115037SI_5849
TMPRSS22142879877ERG21397954832YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 1339115037SI_5849
TMPRSS22142843733ERG213986550110YESNOTGGTTAGGGCAGGAACAGCACCCTGGAATACCCCACTCTCCTCTTTACTC CGTTGAAAGTCAGAGGCTTCTGCAGCTTCATCAGCGCAATGTCATTGTTC 1339115037SI_5857
TMPRSS22142879877ERG213981754415YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1349115060SI_6347
TMPRSS22142870046ERG213981754439YESYESACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1349115060SI_6347
TMPRSS22142870046ERG21397954831YESNOACCTATCATTACTCGATGCTGTTGATAACAGCAAGATGGCTTTGAACTCA GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 1349115060SI_6347
TMPRSS22142880008ERG213981754447YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1359115066SI_6560
TMPRSS22142880008ERG2139817544251YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1359115066SI_6577
TMPRSS22142879877ERG21398175449YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1359115066SI_6560
TMPRSS22142879877ERG213981754444YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1359115066SI_6577
TMPRSS22142880008ERG2139817544161YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 13697115074SI_6803
TMPRSS22142879877ERG21398175446YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 13697115074SI_6773
TMPRSS22142879877ERG213981754432YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 13697115074SI_6803
TMPRSS22142879877ERG21397954834YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCA 13697115074SI_6803
TMPRSS22142880008ERG213981754436YESNOAGGCGGAGGCGGAGGGCGAGGGGCGGGGAGCGCCGCCTGGAGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1375115254SI_7848
TMPRSS22142879877ERG213981754415YESNOCCCTGCCCCGCCCGGAGGTGAAAGCGGGTGTGAGGAGCGCGGCGCGGCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1375115254SI_7848

Pancreases_Dataset

Top
Fusion gene TMPRSS2--ERG is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene TMPRSS2--ERG has been found in a healthy sample. It has been found in GTEx database of healthy tissues (thru FusionAnnotator). A candidate fusion gene having this label has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair TMPRSS2--ERG information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair TMPRSS2--ERG information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair TMPRSS2--ERG is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
TMPRSS2--ERGDevelopment and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumorshttps://doi.org/10.1016/j.jmoldx.2018.03.007

Cortex_Dataset

Top
Fusion gene TMPRSS2--ERG is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair TMPRSS2--ERG information is available in ChromothripsisDB database.

FusionGeneChromothripsisDB IDPubMedIDDisease
TMPRSS2--ERGCTDB0021 23615946 Prostate cancer
TMPRSS2--ERGCTDB0263 22927308 Prostate cancer