TFG--ALK

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

TFG ALK

COSMIC

The fusion gene pair TFG--ALK information is available in COSMIC database.

Link
TFG--ALK

ChimerKB

Top
The fusion gene pair TFG--ALK information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
TFG_ALK-/755/ -/4080/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
TFG_ALK-/920+2559/ -/4080-940/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
TFG_ALK-/755+430/ -/4080-1687/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
TFG_ALK-/1061/ -/4080/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
TFG_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 17464320 Oncogene; Cosmic_nonrecurrent
TFG_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 11943732 Oncogene; Cosmic_nonrecurrent
TFG_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 10556217 Oncogene; Cosmic_nonrecurrent
TFG_ALK-/-/ -/-/ - hg19 non small cell lung cancer - 18083107 Oncogene; Cosmic_nonrecurrent
TFG_ALK-/0/ -/0/ Exonic hg18 - - - Oncogene; TICdb
TFG_ALK-/429/ -/249/ Exonic hg18 - - - Oncogene; TICdb
TFG_ALK-/2614/ -/992/ Exonic hg18 - - - Oncogene; TICdb

ChimerPUB

Top
The fusion gene pair TFG--ALK information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
TFG_ALK- 14631806anaplastic large cell lymphoma;anaplastic large cell lymphoma;lymphoma FISH;PCR - The morphological investigations are supplemented by karyotyping and/or by a demonstration of breakpoint at 2p23 harboring ALK gene (FISH), and by molecular detection of chimeric genes characteristic of ALK+ lymphomas (NPM-ALK, ATIC-ALK, TPM3-ALK, TFG-ALK, and some even rarer rearrangements). /// "The morphological investigations are supplemented by karyotyping and/or by a demonstration of breakpoint at 2p23 harboring ALK gene (FISH), and by molecular detection of chimeric genes characteristic of ALK+ lymphomas (NPM-ALK, ATIC-ALK, TPM3-ALK, TFG-ALK, and some even rarer rearrangements). "
TFG_ALKp23;q35 / t(1;2)(q25;p23) / t(2;3)(p23;q21) / 10807789lymphoma - - However, the ALK gene at 2p23 may also be involved in 2 variant translocations, namely t(1;2)(q25;p23) and t(2;3)(p23;q21), which create the TPM3-ALK and TFG-ALK fusion genes, respectively.
TFG_ALKt(2;5)(p23;q35) / t(1;2)(q25;p23) / t(2;3)(p23;q21) / t(2;17)(p23;q23) / inv(2)(p23q35) / 15208656anaplastic large cell lymphoma;lymphoma - - Recent studies demonstrated that ALK may also be involved in variant translocations, namely, t(1;2)(q25;p23), t(2;3)(p23;q21), t(2;17)(p23;q23) and inv(2)(p23q35), which create the TPM3-ALK, TFG-ALK5, CLTC-ALK, and ATIC-ALK fusion genes, respectively. /// "We stably transfected the cDNAs coding for NPM-ALK, TPM3-ALK, TFG-ALK, CLTC-ALK or ATIC-ALK into nonmalignant NIH3T3 cells. "
TFG_ALKt(2;5)(p23;q35) / t(2;3)(p23;q21) / t(2;5) / 10556217anaplastic large cell lymphoma;lymphoma - - In these cases, TFG was involved in 2 different fusion genes, TFG-ALK(S) and TFG-ALK(L), coding respectively 85-kD and 97-kD chimeric proteins. /// TRK-fused gene (TFG) is a new partner of ALK in anaplastic large cell lymphoma producing two structurally different TFG-ALK translocations..
TFG_ALK- 10994999anaplastic large cell lymphoma;non Hodgkin lymphoma;B cell lymphoma;lymphoma PCR;RT-PCR - Several t(2;5) variants have been described; in some instances, the breakpoints have been cloned and the genes forming a new fusion gene with ALK have been identified: ATIC-ALK, TFG-ALK and TPM3-ALK. /// "in some instances, the breakpoints have been cloned and the genes forming a new fusion gene with ALK have been identified: ATIC-ALK, TFG-ALK and TPM3-ALK. "
TFG_ALKt(2;5)(p23;q35) / t(2;17)(p23;q25) / t(2;11;2)(p23;p15;q31) / 12112524anaplastic large cell lymphoma;lymphoma - - While most of the ALK-positive ALCL (ALKomas) are characterized by the presence of the NPM-ALK fusion protein, the product of the t(2;5)(p23;q35), 10-20% of ALKomas contain variant ALK fusions, including ATIC-ALK, TFG-ALK, CLTC-ALK (previously designated CLTCL-ALK), TMP3-ALK, and MSN-ALK.
TFG_ALKt(2;5)(p23;q35) / 11943732anaplastic large cell lymphoma;lymphoma - - In addition, in common with NPM-ALK, the TFG-ALK proteins formed stable complexes with the signaling proteins Grb2, Shc, and PLC-gamma. /// Transfection experiments using NIH-3T3 fibroblasts showed a similar transforming efficiency of TFG-ALK variants compared with NPM-ALK. /// "In this study, we have identified a new ALK rearrangement in which the catalytic domain of ALK was fused to a larger fragment of the TFG gene (TFG-ALK(XL)), encoding for a fusion protein of 113 kd." /// "Genomic analysis of these three TFG-ALK rearrangements revealed that the TFG breakpoints occur at introns 3, 4, and 5, respectively, whereas the ALK breakpoints always occur in the same intron. " /// "These two rearrangements encoded chimeric proteins of 85 kd (TFG-ALK(S)) and 97 kd (TFG-ALK(L)), respectively. " /// Diversity of genomic breakpoints in TFG-ALK translocations in anaplastic large cell lymphomas: identification of a new TFG-ALK(XL) chimeric gene with transforming activity..
TFG_ALK- 18242762non small cell lung cancer;adenocarcinoma PCR;RT-PCR - To elucidate the role of fusions between ALK and other genes in pulmonary carcinogenesis, we examined 77 non-small cell lung carcinomas (NSCLCs) for EML4-, NPM-, TPM3-, CLTC-, ATIC-, and TFG-ALK fusion transcripts by RT-PCR and subsequent sequencing analysis. /// "Although no expression of NPM-, TPM3-, CLTC-, ATIC-, or TFG-ALK fusion transcripts were detected in any of the cases, expression of EML4-ALK fusion transcripts was detected in two (2.6%) of the 77 NSCLCs. " /// "EML4-ALK fusion transcripts, but no NPM-, TPM3-, CLTC-, ATIC-, or TFG-ALK fusion transcripts, in non-small cell lung carcinomas.. "
TFG_ALK- 25148236- PCR - We also detected oncogenic rearrangements not previously associated with FVPTC, including TFG-ALK and CREB3L2-PPAR?.

ChimerSEQ

Top
The fusion gene pair TFG--ALK information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
TFG_ALKchr3/100451516/ chr2/29415640/ 3q12.2 2p23.2 Exonic hg19 - Inter-chr NA AF143407 Oncogene; ChiTaRs
TFG_ALKchr3/100448131/ chr2/29446395/ 3q12.2 2p23.2 Exonic hg19 - Inter-chr NA AF390891 Oncogene; ChiTaRs
TFG_ALKchr3/100455560/ chr2/29416090/ 3q12.2 2p23.2 Exonic hg19 - Inter-chr NA AF390893 Oncogene; ChiTaRs
TFG_ALKchr3/100447702/ chr2/29415640/ 3q12.2 2p23.2 Exonic hg19 - Inter-chr NA AF125093 Oncogene; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair TFG--ALK information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF143407TFG--ALK TFG3 100432486 100451516 + 13 636 100 ALK2 29415640 29446397 - 634 2777 100
Human AF390891TFG--ALK TFG3 100447703 100448131 + 1 430 99.3 ALK2 29446395 29448078 - 431 2117 99.3
Human AF390893TFG--ALK TFG3 100432530 100455560 + 1 721 100 ALK2 29416090 29446396 - 720 2412 100
Human AF125093TFG--ALK TFG3 100432486 100447702 + 13 471 100 ALK2 29415640 29446395 - 471 2612 100

FARE-CAFE

Top
The fusion gene pair TFG--ALK information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
TFG-ALK Anaplastic large cell lymphoma PCR,Western blot,FISH,DNA sequencing,RT-PCR,RACE t(2;3)(p23;q11-12) PubMed: 11943732

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
TFG-ALK TFG-ALK-Isoform1 TFG 100448131 0 1 ALK 29447951 0 0 TTAGTATAATAGATAAGTAATGAACCTTGGGAATTGAAAATCATTTCATGAATAATTACATAGTGTTGGAAGTATTTTCAGATCAGGGGGTTGGGGAAGCTCCTTCAGTGTCCATCACGATGGTGAAAGCTCGCCCCCACCCCTAGACGTCACTTCTAGCTCCCACATGCTTCCACCGGCGCAGCTCCTGTTTGGCTCCCACCCTATGTA _ AF390891
TFG-ALK TFG-ALK-Isoform2 TFG 100454130 0 1 ALK 29447236 0 0 TTATTTTGGCAATCATCAGTCTCTCTTGCATTACCACTATTATATCCTAGTTTAGGTTCTTATTAATACTTGGACTGTCAGCTGTCAACTGTGCCTAATACTGTGGTAATTAGAGCTCTTTAGGATTTTTCAAAACCATTTTATGTTGGTGAATTCATTTCATTGACAACCCTAGAGGGTGGGGAGTGGCAGTGGTTAGGGAAACAGGGC _ AF390892
TFG-ALK TFG-ALK-Isoform3 TFG 100455560 0 1 ALK 29446276 0 1 GCTTCCTCCTCCTCAGCAGCTCACCCACCAGGCGTTCAGCCACAGCAGCCACCATATACAGGAGCTCAGACTCAAGCAGGTCAGATTGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGC _ AF390893

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
TFG-ALK TFG-ALK-Isoform1 1) PB1
1) PX , SH3_1 , PB1 , Pkinase
1) MAM
2) Gly_rich
1) ig , Astacin , MATH
TFG 1) PB1
1) PX , SH3_1 , PB1 , Pkinase
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
- -
TFG-ALK TFG-ALK-Isoform2 1) PB1
1) PX , SH3_1 , PB1 , Pkinase
1) MAM
2) Gly_rich
1) ig , Astacin , MATH
TFG 1) PB1
1) PX , SH3_1 , PB1 , Pkinase
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
- -
TFG-ALK TFG-ALK-Isoform3 1) PB1
1) PX , SH3_1 , PB1 , Pkinase
1) MAM
2) Gly_rich
1) ig , Astacin , MATH
TFG 1) PB1
1) PX , SH3_1 , PB1 , Pkinase
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
- -

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
TFG-ALK hsa-miR-132-3p hsa-miR-192-5phsa-miR-877-3phsa-miR-193b-3phsa-miR-106a-5phsa-miR-92a-3p Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
TFG-ALK NM_001007565.2 1) RB1_HUMAN
2) STAT1_HUMAN
3) RBL2_HUMAN
4) E2F4_HUMAN
5) P53_HUMAN
6) ETS1_HUMAN
7) FOS_HUMAN
8) CTCF_HUMAN
9) BRG1_HUMAN
10) HNF4A_HUMAN
11) FOXA1_HUMAN
1) TRIM28_HUMAN
2) MITF_HUMAN
3) RUNX1_HUMAN
4) PRDM14_HUMAN
5) ESTROGEN RECEPTOR ALPHA_HUMAN
6) EGR1_HUMAN
7) GATA3_HUMAN
8) E2F1_HUMAN
9) SOX2_HUMAN
10) TFAP2C_HUMAN
11) ESR1_HUMAN
12) NR1H3_HUMAN
13) SETDB1_HUMAN
1) 20385362
2) 19122651
3) 20385362
4) 21247883
5) 21394211
6) 20019798
7) 20139302
8) 21795385
9) 19505939
10) 21646355
11) 21572391

TicDB

Top
The fusion gene pair TFG--ALK information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
TFG ALK AF390891 TTAGTATAATAGATAAGTAATGAACCTTGGGAATTGAAAATCATTTCATGAATAATTACATAGTGTTGGAAGTATTTTCAGATCAGGGGGTTGGGGAAGCTCCTTCAGTGTCCATCACGATGGTGAAAGCTCGCCCCCACCCCTAGACGTCACTTCTAGCTCCCACATGCTTCCACCGGCGCAGCTCCTGTTTGGCTCCCACCCTATGTA
TFG ALK AF390892 TTATTTTGGCAATCATCAGTCTCTCTTGCATTACCACTATTATATCCTAGTTTAGGTTCTTATTAATACTTGGACTGTCAGCTGTCAACTGTGCCTAATACTGTGGTAATTAGAGCTCTTTAGGATTTTTCAAAACCATTTTATGTTGGTGAATTCATTTCATTGACAACCCTAGAGGGTGGGGAGTGGCAGTGGTTAGGGAAACAGGGC
TFG ALK AF390893 GCTTCCTCCTCCTCAGCAGCTCACCCACCAGGCGTTCAGCCACAGCAGCCACCATATACAGGAGCTCAGACTCAAGCAGGTCAGATTGAAGTGTACCGCCGGAAGCACCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGC

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair TFG--ALK information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair TFG--ALK information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair TFG--ALK information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene TFG--ALK has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene TFG--ALK is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene TFG--ALK is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene TFG--ALK is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene TFG--ALK was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair TFG--ALK information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene TFG--ALK is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene TFG--ALK has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene TFG is a known oncogene according to ONGENE database.


The tail gene ALK is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene TFG is cancer associated according to Bushman Cancer Gene database.


The tail gene ALK is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene TFG is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ALK is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene TFG--ALK is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene TFG--ALK is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair TFG--ALK information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene TFG--ALK is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene TFG--ALK has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair TFG--ALK information is available in Klijn Dataset.

Cell lineGene 5'Gene 3'Read evidenceKinaseChromosome 5'Position 5'Chromosome 3'Position 3'Fusion type DNAFusion type RNAFusion protein lengthTissueKnown Fusion
SCC-3TFGALK15Y3100463775229446394TranslocinFrame836LymphoidFull fusion known

Fimereli_Dataset

Top
The fusion gene pair TFG--ALK information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair TFG--ALK information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene TFG--ALK is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair TFG--ALK information is not available in ChromothripsisDB database.