TCF3--PBX1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

TCF3 PBX1

COSMIC

The fusion gene pair TCF3--PBX1 information is available in COSMIC database.

Link
TCF3--PBX1

ChimerKB

Top
The fusion gene pair TCF3--PBX1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
TCF3_PBX1-/-/ -/-/ - hg19 non small cell lung cancer - 23688269 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 - - 23688269 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 23859904 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 25861237 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 23317202 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 1967982 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 1671560 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 8286840 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 8683984 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 26264145 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 7734349 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 haematopoietic neoplasm - 7734349 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 23511488 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 8757523 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 22572394 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 9172811 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 8103813 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 8152250 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 1520867 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 7873385 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 7769844 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 19695702 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 19713226 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 21869488 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 7894030 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 17230064 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 22948124 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 25692130 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25692130 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 9408756 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 15650057 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 16261608 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 18455790 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 9256837 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 18633615 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 22226019 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 26266519 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/-/ -/-/ - hg19 lymphoid neoplasm - 12415113 Transcription_Factor Cosmic_nonrecurrent
TCF3_PBX1-/0/ -/0/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/584/ -/121009/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/933/ -/227776/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1171/ -/186072/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1176/ -/222751/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1178/ -/131507/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1178/ -/221019/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1178/ -/131500/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1179/ -/223213/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1180/ -/219636/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1180/ -/227501/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1180/ -/138995/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1180/ -/223978/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1182/ -/222750/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1182/ -/223204/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1182/ -/220035/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1182/ -/223978/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1182/ -/141022/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1183/ -/198002/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1183/ -/225775/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1183/ -/186439/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1183/ -/211273/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1183/ -/226763/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1183/ -/222916/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/1188/ -/222907/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/2072/ -/140289/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/2352/ -/122261/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/3096/ -/127825/ Exonic hg18 - - - Transcription_Factor TICdb
TCF3_PBX1-/3099/ -/142411/ Exonic hg18 - - - Transcription_Factor TICdb

ChimerPUB

Top
The fusion gene pair TCF3--PBX1 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
TCF3_PBX119p13.3 / t(1;19) / t(1;19) / t(13;19)(q14;p13) / t(12;19)(p13;p13) / 17311319acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - The t(1;19)(q23;p13.3) is one of the most common chromosomal abnormalities in B-cell precursor acute lymphoblastic leukemia (BCP-ALL) and usually gives rise to the TCF3-PBX1 fusion gene.
TCF3_PBX1t(1;19)(q23;p13) / t(1;19) / t(1;19) / 25729575acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - However, due to different translocation partner genes at chromosomes 1 and 19, distinct subtypes of hyperdiploid B-ALL with t(1;19)/der(19)t(1;19) are recognized based on the presence or absence of the TCF3-PBX1 fusion gene, but the cytogenetic and etiologic differences between the two remain understudied. /// "Fluorescence in situ hybridization (FISH) on previously G-banded metaphases using the LSI TCF3/PBX1 Dual Color, Dual Fusion Translocation Probe confirmed the presence of the TCF3-PBX1 gene fusion. " /// Such molecular studies may provide insight into the precise differences between TCF3-PBX1 positive and negative hyperdiploid B-ALL bearing the t(1;19)(q23;p13).. /// "The t(1;19)(q23;p13), which can result in the TCF3-PBX1 chimeric gene, is one of the most frequent translocations in B-acute lymphoblastic leukemia (B-ALL) and is observed in both adult and pediatric populations at an overall frequency of 6%." /// " The t(1;19)(q23;p13), which can result in the TCF3-PBX1 chimeric gene, is one of the most frequent translocations in B-acute lymphoblastic leukemia (B-ALL) and is observed in both adult and pediatric populations at an overall frequency of 6%. " /// "This case is one of only a few cases with both hyperdiploidy and a confirmed TCF3-PBX1 fusion, demonstrating the importance of using FISH for proper molecular classification of these cases in order to distinguish them from those with hyperdiploidy but no TCF3-PBX1 fusion gene. " /// A (1;19) translocation involving TCF3-PBX1 fusion within the context of a hyperdiploid karyotype in adult B-ALL: a case report and review of the literature.. /// This particular pattern with a TCF3-PBX1 fusion within the context of a hyperdiploid karyotype is seen in B-ALL and is usually associated with a poor outcome.
TCF3_PBX1t(1;19) / t(1;19) / 20302770acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - iFISH combined with CC and RT-PCR can increase the detection rate of t(1;19)/TCF3-PBX1 fusion gene.. /// " To explore the morphology, immunophenotype, cytogenetics and clinical features of TCF3-PBX1 fusion gene positive adult acute lymphoblastic leukemia (ALL). " /// "R banding was used to analyze conventional cytogenetics (CC), interphase fluorescence in situ hybridization (iFISH) and RT-PCR to detect the TCF3-PBX1 fusion gene, and flow cytometry to immunophenotype. " /// "TCF3-PBX1 fusion gene was detected by RT-PCR in 9 cases, and by iFISH in 17. " /// [A clinical and laboratory study of TCF3-PBX1 positive adult acute lymphoblastic leukemia.]..
TCF3_PBX1t(1;19) (q23;p13) / t(1;19) (q23;p13) / / 25116187acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - TCF3 rearrangement mostly t(1;19) (q23;p13)/ TCF3-PBX1 gene is associated with favorable outcome in acute lymphoblastic leukemia (ALL) upon treatment with intensification protocols; however, it is associated with higher incidence of central nervous system (CNS) relapse which may affect outcome of patients. /// TCF3 rearrangement mostly t(1;19) (q23;p13)/ TCF3-PBX1 gene is associated with favorable outcome in acute lymphoblastic leukemia (ALL) upon treatment with intensification protocols.
TCF3_PBX1- 23190578acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - Likewise, one each of cases with TCF3-PBX1 fusion and with PAX5 split signal seen by FISH was not visible by cytogenetics. /// "Eight common translocations and rearrangements, including ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, ETV6, TCF3, MLL, IGH@, and PAX5, were tested for using dual-color DNA probes." /// "Eight common translocations and rearrangements, including ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, ETV6, TCF3, MLL, IGH@, and PAX5, were tested for using dual-color DNA probes. " /// Two patients with BCR-ABL1 (6.3%) and one with TCF3-PBX1 (3.1%) translocations were also observed.
TCF3_PBX1t(1;19)(q23;p13) / t(1;19) / t(1;19) / 17593026- - - Characterisation of genomic translocation breakpoints and identification of an alternative TCF3/PBX1 fusion transcript in t(1;19)(q23;p13)-positive acute lymphoblastic leukaemias.. /// "We here report an alternative TCF3/PBX1 transcript, fusing exon 17 of TCF3 with exon 5 of PBX1, in a paediatric t(1;19)-positive ALL. " /// "Hence, ALLs with t(1;19) that test negative for TCF3/PBX1 should be analysed further before excluding this alternative fusion. " /// "Furthermore, we have characterised the genomic translocation breakpoints in eight TCF3/PBX1-positive ALLs. "
TCF3_PBX1- 25273558acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - We show that the MYC and JunD transcriptional circuits are specifically deregulated after ETV6-RUNX1 and TCF3-PBX1 gene fusions, respectively. /// "Using as models three different chromosomal translocations-ETV6-RUNX1 (TEL-AML1), BCR-ABL1, and TCF3-PBX1 (E2A-PBX1)-frequently found in precursor-B-cell acute lymphoblastic leukemia (preB-ALL), we develop an approach to extract perturbed molecular interactions from gene expression changes. " /// "Through a novel approach combining gene expression and interactome data analysis, we provide new insight into TCF3-PBX1 and ETV6-RUNX1 acute lymphoblastic leukemia. " /// We also identified the bulk mRNA NXF1-dependent machinery as a direct target for the TCF3-PBX1 fusion protein.
TCF3_PBX1t(1;19) / 20699438acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Unsupervised clustering of gene expression profiling data revealed 8 unique cluster groups within these high-risk ALL patients, 2 of which were associated with known chromosomal translocations (t(1;19)(TCF3-PBX1) or MLL), and 6 of which lacked any previously known cytogenetic lesion.
TCF3_PBX1t(4;11) / t(4;11)(q21;q23) / t(1;19)(q23;p13) / 26030419lymphoblastic leukemia;leukemia - - The patient subsequently relapsed and cytogenetic assessment revealed an additional acquired t(1;19)(q23;p13) associated with the TCF3-PBX1 fusion.
TCF3_PBX1t(9;22) / t(4;11) / t(1;19) / t(12;21)(p13;q22) / 19713226acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - In the context of the German Multicenter Therapy Study Group for Adult Acute Lymphoblastic Leukemia (GMALL) we used reverse transcriptase polymerase chain reaction to investigate 441 cases of BCR-ABL- and MLL-AF4-negative B-precursor acute lymphoblastic leukemia for the TCF3-PBX1 (E2A-PBX1) and ETV6-RUNX1 (TEL-AML1) fusion transcripts generated by the t(1;19)(q23;p13.3) and t(12;21)(p13;q22) translocations. /// Clinical features and prognostic implications of TCF3-PBX1 and ETV6-RUNX1 in adult acute lymphoblastic leukemia.. /// We identified 23 adult patients with TCF3-PBX1 and ten with ETV6-RUNX1.
TCF3_PBX1t(1;19) / t(12;21) / t(8;21) / t(8;14) / t(9;22) / t(10;11) / t(15;17) / inv(16) / 15843827hematologic malignancy - - Using cDNA microarrays, we determined the gene expression profiles of 40 cell lines as well as of primary leukemias harboring 11q23/MLL rearrangements, t(1;19)[TCF3/PBX1], t(12;21)[ETV6/RUNX1], t(8;21)[RUNX1/CBFA2T1], t(8;14)[IGH@/MYC], t(8;14)[TRA@/MYC], t(9;22)[BCR/ABL1], t(10;11)[PICALM/MLLT10], t(15;17)[PML/RARA], or inv(16)[CBFB/MYH11].
TCF3_PBX1t(1;19)(q23;p13.3) / t(1;19)(q23;p13) / / 21534874acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - We compared the outcome of balanced and unbalanced der(19)t(1;19) cases and also patients with t(1;19)/TCF3-PBX1 versus patients without this translocation, to assess its prognostic value. /// "We compared the outcome of balanced and unbalanced der(19)t(1;19) cases and also patients with t(1;19)/TCF3-PBX1 versus patients without this translocation, to assess its prognostic value. " /// Patients with t(1;19)/TCF3-PBX1 presented a good outcome with no differences between balanced and unbalanced subgroups. /// "From January 1990 to December 2010, t(1;19)(q23;p13)/TCF3-PBX1 was detected in 48 cases. " /// "Thus, risk-adjustment therapy would not be necessary for cases with t(1;19)/TCF3-PBX1.. " /// The pEFS of patients with t(1;19)/TCF3-PBX1 was significantly superior to that of patients without t(1;19)/TCF3-PBX1 (p-value?<0.0001). /// Prognostic impact of t(1;19)/ TCF3-PBX1 in childhood acute lymphoblastic leukemia in the context of Berlin-Frankfurt-M?nster-based protocols.. /// "The probability of event-free survival (pEFS) (standard error) of patients with t(1;19)/TCF3-PBX1 was 85% (6%), for the unbalanced group 78% (10%), and 88% (8%) for the balanced. "
TCF3_PBX1- 22994759acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - TCF3-PBX1 fusion gene was associated with lymphadenopathy, SIL-TAL positive patients had frequent organomegaly and usually presented with a platelets count of less than 50 x10(9)/l. /// "22), TCF3-PBX1 (t 1. "
TCF3_PBX1t(9;22) / t(1;19) / t(9;22) / t(1;19) / 21157143lymphoblastic leukemia;leukemia - - We describe the first case of ider(9)(q10)t(9;22) in combination with TCF3-PBX1 negative t(1;19). /// "however, a few cases have identical translocations but no TCF3-PBX1 fusion, as was observed in our patient. "
TCF3_PBX1- 19587702acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - PAX5 complete loss seems to be a secondary event and is significantly associated with BCR-ABL1 or TCF3-PBX1 fusion genes and a lower white blood cell count.. /// PAX5 mutations occur frequently in adult B-cell progenitor acute lymphoblastic leukemia and PAX5 haploinsufficiency is associated with BCR-ABL1 and TCF3-PBX1 fusion genes: a GRAALL study..
TCF3_PBX1t(1;19)(q23;p13) / 22948124down syndrome - - Acute lymphoblastic leukemia with t(1;19)(q23;p13)/TCF3-PBX1 fusion in an adult male with Down Syndrome..
TCF3_PBX1t(1;19) / t(1;19) / 19282835precursor B cell leukemia - - Increased risk for CNS relapse in pre-B cell leukemia with the t(1;19)/TCF3-PBX1.. /// "These data suggest that with contemporary treatment, patients with the t(1;19) and TCF3/PBX1 fusion have a favorable overall outcome but increased risk of CNS relapse.. "
TCF3_PBX1p11-13;q11 / 26237075acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - In this study, genome-wide methylation analysis, using the Illumina Infinium HumanMethylation450 BeadChip platform, was carried out on 52 diagnostic patient samples from 4 genetic subtypes [ETV6-RUNX1, high hyperdiploidy (HeH), TCF3-PBX1 and dic(9;20)(p11-13;q11)] in a 1:1 case-control design with patients who went on to relapse (as cases) and patients achieving long-term remission (as controls). /// "conversely, TCF3-PBX1 and HeH were associated with hypomethylation. " /// We observed significant enrichment of the neuroactive ligand-receptor interaction pathway in TCF3-PBX1 as well as an enrichment of genes involved in immunity and infection pathways in ETV6-RUNX1 subtype.
TCF3_PBX1t(12;21) / t(1;19) / 21152005acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Folylpolyglutamate synthetase (FPGS) activity was higher in B vs T lineage ALL (p<0.005), MTX influx and FPGS activity were higher in hyperdiploid vs non-hyperdiploid ALL (p<0.03), MTX influx and FPGS activity were lower in the t(12;21) (ETV6-RUNX1) subtype (p<0.05), and the ratio of FPGS to ?-glutamyl hydrolase (GGH) activity was lower in the t(1;19) (TCF3-PBX1) subtype (p<0.03) than other genetic subtypes.
TCF3_PBX1t(9;22) / t(1;19) / t(4;11) / 24781017acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - None of the 106 patients with the t(9;22)/BCR-ABL1, t(1;19)/TCF3-PBX1 or t(4;11)/MLL-AFF1 had relapsed after 2 years from completion of therapy.
TCF3_PBX1t(1;19) / 19553647acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Risk factors for CNS relapse included the genetic abnormality t(1;19)(TCF3-PBX1), any CNS involvement at diagnosis, and T-cell immunophenotype.
TCF3_PBX1- 25551271acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Clinical features and prognostic significance of TCF3-PBX1 fusion gene in Chinese children with acute lymphoblastic leukemia by using a modified ALL-BFM-95 protocol.. /// " For children with precursor B (pre-B) acute lymphoblastic leukemia (ALL) with TCF3-PBX1 fusion gene, their prognosis has been a controversial topic. " /// "Clinical characteristics of 20 patients with TCF3-PBX1 fusion gene were analyzed retrospectively, which were classified to the intermediate-risk (IR) group according to Chinese Children Leukemia Group-2008 (CCLG-2008) risk-stratification criteria and protocol based on the backbone of BFM 95 trails. " /// "When intensive chemotherapy was used, the TCF3-PBX1 was associated with a favorable outcome in childhood pre-B ALL. " /// There were not cases with CNS relapse in the TCF3-PBX1 group. /// "The 5-year probability of event-free survival (EFS) rates were 84.4 ?? 15.6% and 73.5 ?? 15.6% in the TCF3-PBX1 group and the comparison group (P = .35), respectively. " /// Eighty five cases without TCF3-PBX1 in the same IR group were regarded as the comparison group.
TCF3_PBX1t(4;11) / t(9;11) / t(11;19) / t(12;21) / t(1;19) / 25137060leukemia PCR - We validated GIPFEL for the five most common gene fusions associated with childhood leukemia (MLL-AF4, MLL-AF9, MLL-ENL, ETV6-RUNX1, and TCF3-PBX1).
TCF3_PBX1- 23859904acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Frequency of the ETV6-RUNX1, BCR-ABL1, TCF3-PBX1, and MLL-AFF1 fusion genes in Guatemalan pediatric acute lymphoblastic leukemia patients and their ethnic associations.. /// "This study assesses whether an ethnic influence has an effect on the frequency of any of the four fusion genes: BCR-ABL1, ETV6-RUNX1, TCF3-PBX1, and MLL-AFF1 found in ALL. " /// 3 patients (2%) were TCF3-PBX1 positive.
TCF3_PBX1- 20620598acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - An international project was conducted to identify the common acute lymphoblastic leukemia (ALL)-specific fusion genes (ETV6-RUNX1,MLL-AF4,TCF3-PBX1, and BCR-ABL1) in developing countries to provide additional prognostic information at diagnosis.
TCF3_PBX1- 19152679prostate cancer;leukemia - - Using this array, proof of principle was demonstrated by detection of known fusion genes (such as TCF3:PBX1, ETV6:RUNX1, and TMPRSS2:ERG) from all six positive controls consisting of leukemia cell lines and prostate cancer biopsies.
TCF3_PBX1- 25692130acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - The aims of this multicenter study were to determine the prevalence of the four most common gene rearrangements [ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, and MLL rearrangements] and to explore their relationship with mortality rates during the first year of treatment in ALL children from Mexico City. /// "ETV6-RUNX1 was detected in 21 (7.4%) patients, TCF3-PBX1 in 20 (7.1%) patients, BCR-ABL1 in 5 (1.8%) patients, and MLL rearrangements in 4 (1.4%) patients. " /// "ETV6-RUNX1 was detected in 21 (7.4%) patients, TCF3-PBX1 in 20 (7.1%) patients, BCR-ABL1 in 5 (1.8%) patients, and MLL rearrangements in 4 (1.4%) patients."
TCF3_PBX1t(2;8) / inv(4)(p16q25) / t(1;7)(q25;q32) / t(5;6)(q21;q21) / 26648836acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - We compared cytogenetic and RT-PCR results for BCR-ABL1, KMT2A-AFF1 and TCF3-PBX1 rearrangements in 497 children evaluated by both methods. /// "Since December 2002, RT-PCR determinations were systematically carried out for BCR-ABL1, KMT2A-AFF1, ETV6-RUNX1, and TCF3-PBX1 rearrangements in children, adding KMT2A-MLLT3 and KMT2A-MLLT1 in infants. "
TCF3_PBX1inv(16) / t(4;11) / t(11;19) / 23091311- PCR - Fifteen fusion transcripts were included: BCR-ABL1, PML-RARA, ZBTB16-RARA, RUNX1-RUNX1T1, CBFB-MYH11, DEK-NUP214, TCF3-PBX1, ETV6-RUNX1, MLL-AFF1, MLL-MLLT4, MLL-MLLT3, MLL-MLLT10, MLL-ELL, MLL-MLLT1, and MLL-MLLT6.
TCF3_PBX1- 22226019acute lymphoblastic leukemia;T ALL;lymphoblastic leukemia;leukemia PCR;RT-PCR - A total of 380 newly diagnosed children (including 50 infants and 44 T-ALL) were screened by RT-PCR; the incidence of recurrent rearrangements was: ETV6-RUNX1, 12.9%; TCF3-PBX1, 5.0%; BCR-ABL1, 1.6%; and MLL rearrangements, 10.5%. /// "TCF3-PBX1, 5.0%. "
TCF3_PBX1- 24811161acute lymphoblastic leukemia;chronic lymphocytic leukemia;lymphoblastic leukemia;leukemia;B cell lymphoma - - TCF3-PBX1), most mature B-cell lymphomas rely on BCR signaling provided by different stimuli, for example tonic B-cell signaling, chronic (auto)-antigen exposure, and self-binding properties of the BCR.
TCF3_PBX1- 23317202acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - 9), TCF3-PBX1 (t 1. /// "RFS with BCR-ABL, MLL-AF4, TCF3-PBX1 and SIL-TAL1 was less than 10 months (8.0, 3.6, 5.5 and 8.1 months, respectively). "
TCF3_PBX1- 20442364acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia;down syndrome - - We reviewed data from 2811 children with ALL enrolled in Children's Oncology Group P9900, which included prospective testing for the major cytogenetic lesions in childhood ALL: ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, and MLL translocations and trisomies of chromosomes 4 and 10.
TCF3_PBX1- 24135088acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia;hematopoietic malignancy - - Based on this observation, we propose this sequence is important for the oncogenesis of TCF3-PBX1 acute lymphoblastic leukemia.. /// Translocation junctions in TCF3-PBX1 acute lymphoblastic leukemia/lymphoma cluster near transposable elements.. /// "Based on this observation, we propose this sequence is important for the oncogenesis of TCF3-PBX1 acute lymphoblastic leukemia.. "
TCF3_PBX1- 26266519acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - TCF3-PBX1 (2.1?%) was associated with inferior outcome and higher central nervous system (CNS) relapse risk. /// "The most common FOs are BCR-ABL, MLL-AF4, ETV6-RUNX1, and TCF3-PBX1, all of which have important prognostic and drug selection implications. " /// "The most common FOs are BCR-ABL, MLL-AF4, ETV6-RUNX1, and TCF3-PBX1, all of which have important prognostic and drug selection implications."
TCF3_PBX1- 18024406acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - These data document that contemporary ALL-BFM treatment is highly effective in children with TCF3-PBX1 ALL. /// Patients with TCF3-PBX1 ALL treated on the ALL-BFM 86 trial had a poorer outcome than patients with TCF3-PBX1 ALL treated on later trials. /// "Of 859 children with ALL who were treated in ALL-BFM trials in Austria, 31 (3.6%) had a TCF3-PBX1 ALL. " /// Lessons from the analysis of children with TCF3-PBX1 ALL could help to identify treatment components essential for this leukemia subtype.

ChimerSEQ

Top
The fusion gene pair TCF3--PBX1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
TCF3_PBX1chr19/1621969/ chr1/164761730/ 19p13.3 1q23.3 Exonic hg19 - Inter-chr NA M31522 Transcription_Factor ChiTaRs
TCF3_PBX1chr19/1619803/ chr1/164761730/ 19p13.3 1q23.3 Exonic hg19 - Inter-chr acute myeloid leukemia;acute lymphoblastic lekemia;lymphoblastic lymphoma;acute non lymphocytic leukemia;B cell acute lymphoblastic leukemia AY311345 Transcription_Factor ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair TCF3--PBX1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AY311345TCF3--PBX1 TCF319 1619110 1619803 - 1 149 100 PBX11 164761730 164761798 + 149 217 100
Human M31522TCF3--PBX1 TCF319 1619110 1621969 - 1 625 99.9 PBX11 164761730 164816309 + 625 2049 99.8

FARE-CAFE

Top
The fusion gene pair TCF3--PBX1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
TCF3-PBX1 B-cell precursor ALL FISH,Southern blot,SSCP,PCR,DNA sequencing,LDI-PCR,Western blot,RT-PCR,Exontrapping,RACE,G-Banding t(1;19)(q23;p13) PubMed: 12415113

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
TCF3-PBX1 TCF3-PBX1-Isoform1 TCF3 1617949 0 0 PBX1 164760049 1 0 AGGCCAGGGCATCTCACCGCcgcatctgatccgtgcccATATGTGATGACGCTCAAACA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform2 TCF3 1617946 0 0 PBX1 164755464 1 0 CCAGGGCATCTCACCGCAGCtggagtccgCAGACATTTAGTGTCAGGGG 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform3 TCF3 1617922 0 0 PBX1 164755435 1 0 CCCAGTGTCCCCTGGGGGCAgggctTTTCTTAAGAGCAATATAATA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform4 TCF3 1616034 0 0 PBX1 _ 1 _ CCCTTTCATCTTGTGGTCCTtCTTGAATAGCTGGGATTACA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform5 TCF3 _ _ 0 PBX1 164664048 1 0 CTAAGCCAGGGCATCTCACCcgctcctATTCTAACTATTTCTCATTT 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform6 TCF3 _ _ 0 PBX1 164664055 1 0 CTAAGCCAGGGCATCTCACCcgctcctATTTCTCATTTCTCCTTCTT 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform7 TCF3 1617951 0 0 PBX1 164753567 1 0 CTAGGCCAGGGCATCTCACCttCCCATCCAGAAAGGCAGGGGC 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform8 TCF3 1617947 0 0 PBX1 164673570 1 0 GCCAGGGCATCTCACCGCAGaaccgaccgcgactaagcgaaacctccgaaatttcggatTTGCACAGCTTTCCCAGGGC 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform9 TCF3 1617947 0 0 PBX1 164756526 1 0 GCCAGGGCATCTCACCGCAGagacgggaccatcccGTTTCTCTCTCTCAGCTCAGC 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform10 TCF3 1617947 0 0 PBX1 164752583 1 0 GCCAGGGCATCTCACCGCAGtggggtcagcgGAGCTTGCCTGGAAGCATAGG 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform11 TCF3 _ _ 0 PBX1 164756506 1 0 GCCTGGGGGCAGAGCCGCTGtcgcccAGATAAAGAACAAGACAGAA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform12 TCF3 1617949 0 0 PBX1 164671543 1 0 AGGCCAGGGCATCTCACCGCtgacttggtcgctcgAAGAGGATACCCTGAGCTCAC 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform13 TCF3 1618196 0 0 PBX1 164760324 1 0 GGATTTCTGGCCCGAGCTGTaggctcCCACCCTACCCACACATTC 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform14 TCF3 1617950 0 0 PBX1 164755761 1 0 TAGGCCAGGGCATCTCACCGggttcggtctcggggCTAACCATGATGGTGGAAAGA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform15 TCF3 1617928 0 0 PBX1 164755279 1 0 TCCCCTGGGGGCAGAGCCGCctcaccgcacctttaAGCATGCTGTTGGGTAGAAG 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform16 TCF3 1617953 0 0 PBX1 164755299 1 0 TCCTAGGCCAGGGCATCTCAtccaGGCTCTGGTACAACTTGTAA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform17 TCF3 _ _ 0 PBX1 164653557 1 0 TGGAGCAGAGTAAGGAGAGGttaatgggtaacttttcggTTTGTGAAAGCATTGTAGAA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform18 TCF3 _ _ 0 PBX1 164654809 1 0 TGTTTTGTTTTGAGACAGGGccccctactgaaaccccCAAAGGGAAGAGGGTCCAGA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform19 TCF3 1616030 0 0 PBX1 _ 1 _ TTCATCTTGTGGTCCTTAATggccATTTTCTCATTTGACAAGTT 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform20 TCF3 _ _ 0 PBX1 _ 1 _ TTGCCAGGGCATCTCACCGCcaccaaatcaaaaTACCCTCTTCTGGTTATAATT 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform21 TCF3 _ _ 0 PBX1 164776777 1 0 ccgggcccggaccagGcggaagagacggaattt 17593026 _
TCF3-PBX1 TCF3-PBX1-Isoform22 TCF3 1619174 1 0 PBX1 164761730 1 0 CGCGGCCCTCCCCAGCCAGCCAGGCACCCTCCCTGACCTGTCTCGGCCTCCCGACTCCTACAGTGTTTTGAGTATCCGAGGAGCCCAGGAGGAGGAACCCACAGACCCCCAGCTGATGCGGCTGGACAACATGCTGTTAG _ M31522
TCF3-PBX1 TCF3-PBX1-Isoform23 TCF3 1617958 0 0 PBX1 _ 1 _ ATCACTCCTAGGCCAGGGCAaactgaCCTACAAATAGGTGAAAGTT 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform24 TCF3 1617057 0 0 PBX1 164672808 1 0 ATCTCTTGATGTGCTGAAGCaggccGCTGTTGGCTAACTGGTCGTCTCAGCTGAA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform25 TCF3 _ _ 0 PBX1 _ 1 _ CAGGGCATCTCACCGCAGCcccagggtaagggccttccctatgaaagagccagccacaaaAGACACTAGTAGTATTTTA 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform26 TCF3 _ _ 0 PBX1 164759311 1 1 CCAGGGCATCTCACCGCAGCaaggaggggtaggtccGCTGGGCGCTGCTGCCAGAT 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform27 TCF3 1617946 0 0 PBX1 164718987 1 0 CCAGGGCATCTCACCGCAGCacgcccgaaatatCATGGCTTAGGAGAACCGTG 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform28 TCF3 1617946 0 0 PBX1 164743821 1 0 CCAGGGCATCTCACCGCAGCagCAAGTGAGGGCGGAGTTTGC 12415113 _
TCF3-PBX1 TCF3-PBX1-Isoform29 TCF3 1617946 0 0 PBX1 _ 1 _ CCAGGGCATCTCACCGCAGCtTGCTTTATGCTTTAAGCTTT 12415113 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
TCF3-PBX1 TCF3-PBX1-Isoform1 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform2 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform4 1) HLH
1) HLH , Myc-LZ , PAS , LIM
- -TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3-PBX1 TCF3-PBX1-Isoform5 - - 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) HLH
1) HLH , Myc-LZ , PAS , LIM
TCF3-PBX1 TCF3-PBX1-Isoform6 - - 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) HLH
1) HLH , Myc-LZ , PAS , LIM
TCF3-PBX1 TCF3-PBX1-Isoform7 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform8 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform9 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform10 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform11 - - 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) HLH
1) HLH , Myc-LZ , PAS , LIM
TCF3-PBX1 TCF3-PBX1-Isoform12 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform13 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform14 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform15 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform16 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform17 - - 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) HLH
1) HLH , Myc-LZ , PAS , LIM
TCF3-PBX1 TCF3-PBX1-Isoform18 - - 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) HLH
1) HLH , Myc-LZ , PAS , LIM
TCF3-PBX1 TCF3-PBX1-Isoform19 1) HLH
1) HLH , Myc-LZ , PAS , LIM
- -TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3-PBX1 TCF3-PBX1-Isoform20 - - - -TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) HLH
2) PBC
3) Homeobox
1) HLH , Myc-LZ , PAS , LIM
2) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3-PBX1 TCF3-PBX1-Isoform21 - - 1) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) HLH
2) PBC
1) HLH , Myc-LZ , PAS , LIM
TCF3-PBX1 TCF3-PBX1-Isoform22 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform23 1) HLH
1) HLH , Myc-LZ , PAS , LIM
- -TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3-PBX1 TCF3-PBX1-Isoform24 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform25 - - - -TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) HLH
2) PBC
3) Homeobox
1) HLH , Myc-LZ , PAS , LIM
2) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3-PBX1 TCF3-PBX1-Isoform26 - - 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) HLH
1) HLH , Myc-LZ , PAS , LIM
TCF3-PBX1 TCF3-PBX1-Isoform27 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform28 1) HLH
1) HLH , Myc-LZ , PAS , LIM
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
- -
TCF3-PBX1 TCF3-PBX1-Isoform29 1) HLH
1) HLH , Myc-LZ , PAS , LIM
- -TCF3 1) HLH
1) HLH , Myc-LZ , PAS , LIM
PBX1 1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N
1) PBC
2) Homeobox
1) Homeobox , Pou , SBP_bac_1 , SRF-TF , CUT , HNF-1_N

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
TCF3-PBX1 hsa-miR-124-3phsa-miR-21-5phsa-miR-877-3phsa-miR-149-5p hsa-miR-17-5phsa-miR-615-3phsa-miR-342-3phsa-miR-320a Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
TCF3-PBX1 NM_001136139.2 - - -

TicDB

Top
The fusion gene pair TCF3--PBX1 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
TCF3 PBX1 12415113 AGGCCAGGGCATCTCACCGCcgcatctgatccgtgcccATATGTGATGACGCTCAAACA
TCF3 PBX1 12415113 AGGCCAGGGCATCTCACCGCtgacttggtcgctcgAAGAGGATACCCTGAGCTCAC
TCF3 PBX1 12415113 ATCACTCCTAGGCCAGGGCAaactgaCCTACAAATAGGTGAAAGTT
TCF3 PBX1 12415113 ATCTCTTGATGTGCTGAAGCaggccGCTGTTGGCTAACTGGTCGTCTCAGCTGAA
TCF3 PBX1 12415113 CAGGGCATCTCACCGCAGCcccagggtaagggccttccctatgaaagagccagccacaaaAGACACTAGTAGTATTTTA
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCaaggaggggtaggtccGCTGGGCGCTGCTGCCAGAT
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCacgcccgaaatatCATGGCTTAGGAGAACCGTG
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCagCAAGTGAGGGCGGAGTTTGC
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCtTGCTTTATGCTTTAAGCTTT
TCF3 PBX1 12415113 CCAGGGCATCTCACCGCAGCtggagtccgCAGACATTTAGTGTCAGGGG
TCF3 PBX1 12415113 CCCAGTGTCCCCTGGGGGCAgggctTTTCTTAAGAGCAATATAATA
TCF3 PBX1 12415113 CCCTTTCATCTTGTGGTCCTtCTTGAATAGCTGGGATTACA
TCF3 PBX1 12415113 CTAAGCCAGGGCATCTCACCcgctcctATTCTAACTATTTCTCATTT
TCF3 PBX1 12415113 CTAAGCCAGGGCATCTCACCcgctcctATTTCTCATTTCTCCTTCTT
TCF3 PBX1 12415113 CTAGGCCAGGGCATCTCACCttCCCATCCAGAAAGGCAGGGGC
TCF3 PBX1 12415113 GCCAGGGCATCTCACCGCAGaaccgaccgcgactaagcgaaacctccgaaatttcggatTTGCACAGCTTTCCCAGGGC
TCF3 PBX1 12415113 GCCAGGGCATCTCACCGCAGagacgggaccatcccGTTTCTCTCTCTCAGCTCAGC
TCF3 PBX1 12415113 GCCAGGGCATCTCACCGCAGtggggtcagcgGAGCTTGCCTGGAAGCATAGG
TCF3 PBX1 12415113 GCCTGGGGGCAGAGCCGCTGtcgcccAGATAAAGAACAAGACAGAA
TCF3 PBX1 12415113 GGATTTCTGGCCCGAGCTGTaggctcCCACCCTACCCACACATTC
TCF3 PBX1 12415113 GGGCATTCTATCACCCAATAaagaagggcGCGGCTCTGCCCCCAGGGGAC
TCF3 PBX1 12415113 TAGGCCAGGGCATCTCACCGggttcggtctcggggCTAACCATGATGGTGGAAAGA
TCF3 PBX1 12415113 TCCCCTGGGGGCAGAGCCGCctcaccgcacctttaAGCATGCTGTTGGGTAGAAG
TCF3 PBX1 12415113 TCCTAGGCCAGGGCATCTCAtccaGGCTCTGGTACAACTTGTAA
TCF3 PBX1 12415113 TGGAGCAGAGTAAGGAGAGGttaatgggtaacttttcggTTTGTGAAAGCATTGTAGAA
TCF3 PBX1 12415113 TGTTTTGTTTTGAGACAGGGccccctactgaaaccccCAAAGGGAAGAGGGTCCAGA
TCF3 PBX1 12415113 TTCATCTTGTGGTCCTTAATggccATTTTCTCATTTGACAAGTT
TCF3 PBX1 12415113 TTGCCAGGGCATCTCACCGCcaccaaatcaaaaTACCCTCTTCTGGTTATAATT
TCF3 PBX1 17593026 ccgggcccggaccagGcggaagagacggaattt
TCF3 PBX1 M31522 CGCGGCCCTCCCCAGCCAGCCAGGCACCCTCCCTGACCTGTCTCGGCCTCCCGACTCCTACAGTGTTTTGAGTATCCGAGGAGCCCAGGAGGAGGAACCCACAGACCCCCAGCTGATGCGGCTGGACAACATGCTGTTAG

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair TCF3--PBX1 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair TCF3--PBX1 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair TCF3--PBX1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene TCF3--PBX1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene TCF3--PBX1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene TCF3--PBX1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene TCF3--PBX1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene TCF3--PBX1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair TCF3--PBX1 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene TCF3--PBX1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene TCF3--PBX1 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene TCF3 is a known oncogene according to ONGENE database.


The tail gene PBX1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene TCF3 is cancer associated according to Bushman Cancer Gene database.


The tail gene PBX1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene TCF3 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene PBX1 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene TCF3--PBX1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene TCF3--PBX1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair TCF3--PBX1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene TCF3--PBX1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene TCF3--PBX1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair TCF3--PBX1 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair TCF3--PBX1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair TCF3--PBX1 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene TCF3--PBX1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair TCF3--PBX1 information is not available in ChromothripsisDB database.