TAF15--NR4A3

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

TAF15 NR4A3

COSMIC

The fusion gene pair TAF15--NR4A3 information is available in COSMIC database.

Link
TAF15--NR4A3

ChimerKB

Top
The fusion gene pair TAF15--NR4A3 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
TAF15_NR4A3-/570/ -/728/ Exonic hg19 - - - Receptor; Transcription_Factor Cosmic_recurrent
TAF15_NR4A3-/570+1130/ -/728/ Exonic hg19 - - - Receptor; Transcription_Factor Cosmic_recurrent
TAF15_NR4A3-/570+42/ -/728-811/ Exonic hg19 - - - Receptor; Transcription_Factor Cosmic_recurrent
TAF15_NR4A3-/570+659/ -/728-1311/ Exonic hg19 - - - Receptor; Transcription_Factor Cosmic_recurrent
TAF15_NR4A3-/-/ -/-/ - hg19 chondrosarcoma - 11679947 Receptor; Transcription_Factor Cosmic_nonrecurrent
TAF15_NR4A3-/-/ -/-/ - hg19 chondrosarcoma - 12378528 Receptor; Transcription_Factor Cosmic_nonrecurrent
TAF15_NR4A3-/-/ -/-/ - hg19 chondrosarcoma - 10537274 Receptor; Transcription_Factor Cosmic_nonrecurrent
TAF15_NR4A3-/-/ -/-/ - hg19 chondrosarcoma - 10602520 Receptor; Transcription_Factor Cosmic_nonrecurrent
TAF15_NR4A3-/-/ -/-/ - hg19 chondrosarcoma - 10602519 Receptor; Transcription_Factor Cosmic_nonrecurrent
TAF15_NR4A3-/-/ -/-/ - hg19 chondrosarcoma - 16220270 Receptor; Transcription_Factor Cosmic_nonrecurrent
TAF15_NR4A3-/-/ -/-/ - hg19 chondrosarcoma - 18580682 Receptor; Transcription_Factor Cosmic_nonrecurrent
TAF15_NR4A3-/0/ -/0/ Exonic hg18 - - - Receptor; Transcription_Factor TICdb
TAF15_NR4A3-/41/ -/428/ Exonic hg18 - - - Receptor; Transcription_Factor TICdb
TAF15_NR4A3-/42/ -/429/ Exonic hg18 - - - Receptor; Transcription_Factor TICdb
TAF15_NR4A3-/658/ -/905/ Exonic hg18 - - - Receptor; Transcription_Factor TICdb
TAF15_NR4A3-/659/ -/897/ Exonic hg18 - - - Receptor; Transcription_Factor TICdb
TAF15_NR4A3-/1132/ -/811/ Exonic hg18 - - - Receptor; Transcription_Factor TICdb
TAF15_NR4A3-/-/ -/-/ - hg18 extraskeletal myxoid chondrosarcoma - 10602519 Receptor; Transcription_Factor OMIM

ChimerPUB

Top
The fusion gene pair TAF15--NR4A3 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
TAF15_NR4A3t(9;22)(q22;q12) / t(9;17)(q22;q11) / 15262426chondrosarcoma;sarcoma FISH;PCR;RT-PCR - Extraskeletal myxoid chondrosarcoma (EMC) is a rare mesenchymal tumor cytogenetically characterized by reciprocal translocations, such as t(9;22)(q22;q12) and t(9;17)(q22;q11), which result in EWSR1/NR4A3 and TAF15/NR4A3 fusion genes (alias EWS/NOR1, TAF2N/NOR1), respectively. /// TAF15-NR4A3) expressed neither native NOR1 nor SIX3.
TAF15_NR4A3- 24746215chondrosarcoma;sarcoma FISH - Fluorescence in situ hybridization analysis showed EWSR1-NR4A3 gene fusion in 16 cases (62%), TAF15-NR4A3 gene fusion in 7 cases (27%), and TCF12-NR4A3 gene fusion in 1 case (4%). /// "Fluorescence in situ hybridization analysis showed EWSR1-NR4A3 gene fusion in 16 cases (62%), TAF15-NR4A3 gene fusion in 7 cases (27%), and TCF12-NR4A3 gene fusion in 1 case (4%). "
TAF15_NR4A3t(9;22) / t(9;17) / t(9;15) / t(9;3) / 24508382chondrosarcoma;sarcoma FISH;PCR;RT-PCR - Of the 34 samples evaluable for fusion transcripts, 23 yielded positive results for EWSR1-NR4A3, 10 for TAF15-NR4A3, and 1 for TCF12-NR4A3. /// "The samples from 42 patients with extraskeletal myxoid chondrosarcoma were examined for the presence of EWSR1-NR4A3, TAF15-NR4A3, TCF12-NR4A3, and TFG-NR4A3 fusion transcripts by using RT-PCR. "
TAF15_NR4A3- 24703573chondrosarcoma;sarcoma FISH - Interestingly, all responsive cases turned out to express the typical EWSR1-NR4A3 fusion, while refractory cases carried the alternative TAF15-NR4A3 fusion.
TAF15_NR4A3t(9;17) / t(9;22) / 14708728chondrosarcoma;sarcoma - - Molecular genetic analysis revealed a TAF15/NR4A3 fusion, a characteristic rearrangement occurring in about 25% of cytogenetically investigated EMC. /// "Molecular genetic analysis revealed a TAF15/NR4A3 fusion, a characteristic rearrangement occurring in about 25% of cytogenetically investigated EMC."

ChimerSEQ

Top
The fusion gene pair TAF15--NR4A3 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
TAF15_NR4A3chr17/34149837/ chr9/102590321/ 17q12 9q22.33 Exonic hg19 - Inter-chr chomdrosarcoma AF162670 Receptor; Transcription_Factor ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair TAF15--NR4A3 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF162670TAF15--NR4A3 TAF1517 34149703 34149837 + 1 135 100 NR4A39 102590321 102590456 + 134 269 100
Human AJ243810TAF15--NR4A3 TAF1517 34149745 34149837 + 1 93 100 NR4A39 102590321 102590404 + 92 175 100
Human AJ245932TAF15--NR4A3 TAF1517 34149752 34149837 + 1 86 100 NR4A39 102590321 102590480 + 85 244 100

FARE-CAFE

Top
The fusion gene pair TAF15--NR4A3 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
TAF15-NR4A3 Extraskeletal myxoid chondrosarcoma PCR t(9;17)(q22;q11) PubMed:12378528

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
TAF15-NR4A3 TAF15-NR4A3-Isoform1 TAF15 _ _ 1 NR4A3 102589010 1 0 CCCAGCATTTTGGGAGGCCGAGGTGGGCAGATCACGAGGTCAGGAgGCCCTCATCACCTTTTTTCAAGTCAAGATTTCAT 12378528 _
TAF15-NR4A3 TAF15-NR4A3-Isoform2 TAF15 34149879 0 1 NR4A3 102589511 1 0 CTCTATTATTATTTTTCCCCCTCTCAGTTTTATTAGTTAGAATTGGGATATATATATGT 12378528 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
TAF15-NR4A3 TAF15-NR4A3-Isoform1 - - 1) zf-C4
1) zf-C4 , Hormone_recep
TAF15 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) RAS , Ubiquitin
NR4A3 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) RAS , Ubiquitin
TAF15-NR4A3 TAF15-NR4A3-Isoform2 - - 1) zf-C4
1) zf-C4 , Hormone_recep
TAF15 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) RAS , Ubiquitin
NR4A3 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) RAS , Ubiquitin

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
TAF15-NR4A3 hsa-miR-124-3phsa-miR-10b-5phsa-miR-26b-5p hsa-miR-132-3phsa-miR-181a-5phsa-miR-24-3phsa-miR-16-5phsa-miR-877-3phsa-miR-615-3phsa-miR-501-5phsa-miR-320ahsa-miR-125b-5phsa-miR-10a-5phsa-miR-196a-5p Report assay,Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
TAF15-NR4A3 NM_003487.3 1) RB1_HUMAN
2) STAT1_HUMAN
3) RBL2_HUMAN
4) E2F4_HUMAN
5) PRDM14_HUMAN
6) ETS1_HUMAN
7) FOS_HUMAN
8) E2F1_HUMAN
9) TAL1_HUMAN
10) CTCF_HUMAN
11) BRG1_HUMAN
12) FOXA1_HUMAN
13) SETDB1_HUMAN
14) TRIM24_HUMAN
1) HIFALPHA
2) TRIM28_HUMAN
3) MITF_HUMAN
4) EGR1_HUMAN
5) GATA3_HUMAN
6) HNF4A_HUMAN
7) TFAP2C_HUMAN
8) CEBPA_HUMAN
9) ESR1_HUMAN
10) ESR2_HUMAN
11) MEIS1_HUMAN
12) FOXP1_HUMAN
1) 20385362
2) 19122651
3) 20385362
4) 21247883
5) 20953172
6) 20019798
7) 20139302
8) 21310950
9) 21795385
10) 21795385
11) 19505939
12) 21572391
13) 21430779
14) 21164480

TicDB

Top
The fusion gene pair TAF15--NR4A3 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
TAF15 NR4A3 12378528 CCCAGCATTTTGGGAGGCCGAGGTGGGCAGATCACGAGGTCAGGAgGCCCTCATCACCTTTTTTCAAGTCAAGATTTCAT
TAF15 NR4A3 12378528 CTCTATTATTATTTTTCCCCCTCTCAGTTTTATTAGTTAGAATTGGGATATATATATGT
TAF15 NR4A3 12378528 TTTCTTGCCTAACTCAGGTTTACAAATCAATGTGTATGCCCAACATGTGCCATTTTCTATAAGGATATGTGTGGCCTAAAGA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair TAF15--NR4A3 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair TAF15--NR4A3 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair TAF15--NR4A3 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene TAF15--NR4A3 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene TAF15--NR4A3 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene TAF15--NR4A3 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene TAF15--NR4A3 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene TAF15--NR4A3 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair TAF15--NR4A3 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene TAF15--NR4A3 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene TAF15--NR4A3 has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene TAF15 is a known oncogene according to ONGENE database.
The tail gene NR4A3 is not a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene TAF15 is cancer associated according to Bushman Cancer Gene database.


The tail gene NR4A3 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene TAF15 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene NR4A3 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene TAF15--NR4A3 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene TAF15--NR4A3 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair TAF15--NR4A3 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene TAF15--NR4A3 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene TAF15--NR4A3 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair TAF15--NR4A3 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair TAF15--NR4A3 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair TAF15--NR4A3 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
TAF15--NR4A3The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7

Cortex_Dataset

Top
Fusion gene TAF15--NR4A3 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair TAF15--NR4A3 information is not available in ChromothripsisDB database.