SSX2--SS18

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

SSX2 SS18

COSMIC

The fusion gene pair SSX2--SS18 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair SSX2--SS18 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
SSX2_SS18-/438+280/ -/1287-12012/ Exonic hg19 - - - - Cosmic_recurrent
SSX2_SS18-/438+420/ -/1287-12550/ Exonic hg19 - - - - Cosmic_recurrent
SSX2_SS18-/438+1318/ -/1287-9312/ Exonic hg19 - - - - Cosmic_recurrent
SSX2_SS18-/388+1711/ -/1287-12732/ Exonic hg19 - - - - Cosmic_recurrent
SSX2_SS18-/-/ -/-/ - hg19 synovial sarcoma - 16682293 - Cosmic_nonrecurrent
SSX2_SS18-/-/ -/-/ - hg19 synovial sarcoma - 11433527 - Cosmic_nonrecurrent
SSX2_SS18-/-/ -/-/ - hg19 synovial sarcoma - 12687023 - Cosmic_nonrecurrent
SSX2_SS18-/-/ -/-/ - hg18 synovial sarcoma - 12037676 - OMIM
SSX2_SS18-/-/ -/-/ - hg18 sarcoma - 7539744 - OMIM
SSX2_SS18-/-/ -/-/ - hg18 synovial sarcoma - 10072425 - OMIM
SSX2_SS18-/-/ -/-/ - hg18 synovial sarcoma - 7539744 - OMIM

ChimerPUB

Top
The fusion gene pair SSX2--SS18 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
SSX2_SS18p11.2;q11.2 / 22976541synovial sarcoma;sarcoma FISH - Over 90 % of SS cases are characterized by the t(X;18)(p11.2;q11.2) translocation, which results mainly in the formation of oncogenic SS18-SSX1 or SS18-SSX2 fusions. /// "We detected SS18-SSX1 transcript in 22 (55 %) patients and SS18-SSX2 transcript in 17 (42.5 %) patients, while in one patient, none of SS18-SSX1/2 fusion transcripts were identified. " /// "Among the cases under study, two tumors carried novel SS18-SSX1 and SS18-SSX2 variant translocations that were allegedly created by an alternative splicing, and in additional case, an unusual translocation variant previously described by other group was found. "
SSX2_SS18- 22743288chondrosarcoma;synovial sarcoma;sarcoma FISH - This is the first reported case of a remarkable soft tissue sarcoma that exhibits overlapping morphologic features between SS and EMC and that also harbors a combination of SS18-SSX2 and EWS-NR4A3 gene fusions. /// "Furthermore, reverse transcriptase-polymerase chain reaction studies of both the primary tumor and the recurrence confirmed the presence of both SS18-SSX2 and EWSR1-NR4A3 (exon 3) gene fusions, characteristic of SS and EMC, respectively. "
SSX2_SS18p11.2;q11.2 / 15208645synovial sarcoma;sarcoma FISH;PCR - In order to obtain an alternative tool to diagnose and follow this malignancy, we developed a fluorescence in situ hybridization (FISH) assay that could distinguish between the two most common fusion genes, that is, SS18-SSX1 and SS18-SSX2.
SSX2_SS18p11;q11 / 12696068synovial sarcoma;sarcoma FISH;PCR;RT-PCR - The three fusion genes that have been detected thus far, SS18/SSX1, SS18/SSX2, and SS18/SSX4, account for more than 95% of the synovial sarcomas.
SSX2_SS18- 21536237bone cyst FISH;PCR;RT-PCR - Reverse-transcription polymerase chain reaction (RT-PCR) for the SS18-SSX1 and SS18-SSX2 translocations, identity testing, and SS18 FISH were performed on cytogenetic monolayer cultures and formalin-fixed paraffin-embedded (FFPE) tissue.
SSX2_SS18- 24061517synovial sarcoma;sarcoma FISH - Ten cases carried an SS18-SSX2 fusion transcript, and 5 cases showed an SS18-SSX1 transcript by reverse transcription polymerase chain reaction.
SSX2_SS18- 23623359synovial sarcoma;sarcoma FISH - Our new FISH assay has several advantages, including its applicability to paraffin-embedded samples, discrimination of the SS18-SSX1 and SS18-SSX2 translocations particularly in cases with aneuploidy, and potentially detecting translocations in all cases of synovial sarcoma, even with variant translocations.
SSX2_SS18- 17334349mesothelioma;synovial sarcoma FISH;PCR;RT-PCR - Synovial Sarcoma consistently harbors t(X;18) resulting in SS18-SSX1, SS18-SSX2 and rarely SS18-SSX4 fusion transcripts. /// "SS18-SSX fusion products were found in 126 (96%) cases (74 SS18-SSX1, 52 SS18-SSX2), using quantitative and 120 by conventional reverse transcriptase-polymerase chain reaction (RT-PCR). " /// SS18-SSX1 was present in 56 monophasic and 18 biphasic synovial sarcoma: SS18-SSX2 was detected in 41 monophasic and 11 biphasic synovial sarcoma.
SSX2_SS18- 25699170gastrointestinal cancer FISH;PCR - A fusion transcript was amplified in eight cases: either SS18-SSX2 or SS18-SSX1 respectively in four cases each.
SSX2_SS18- 20594581synovial sarcoma;sarcoma FISH - Subsequently, SS18-SSX1 and SS18-SSX2 were examined by reverse transcription polymerase chain reaction. /// "Because synovial sarcoma consistently carries a specific chromosomal translocation, t(X;18), and its derivative chimeric gene, either SS18-SSX1 or SS18-SSX2, detecting these abnormalities by reverse transcription polymerase chain reaction or fluorescence in situ hybridization has been recognized as a powerful aid for diagnosis. "
SSX2_SS18p11.2;q11.2 / 17471153synovial sarcoma;sarcoma FISH - Digoxigenin-labeled cRNA probes flanking the fusion points of SS18-SSX1 and SS18-SSX2 were generated by in vitro transcription, and hybridized signals were detected by a streptavidin-biotin complex method after chemical enhancement with BT.
SSX2_SS18p11.2;q11.2 / 22550415synovial sarcoma;sarcoma - - Over 90% of SS cases are characterized by the t(X;18)(p11.2;q11.2) translocation, which results mainly in the formation of SS18-SSX1 or SS18-SSX2 fusion genes.
SSX2_SS18- 19417583synovial sarcoma;sarcoma - - Reverse transcriptase polymerase chain reaction for the SS18/SSX1 and SS18/SSX2 fusion genes and fluorescent in-situ hybridization for SYT rearrangement was performed.
SSX2_SS18- 16152617synovial sarcoma;sarcoma - - Supervised analysis based on gene fusion type in 12 SS with SS18/SSX1 and 9 with SS18/SSX2 revealed significant differences in gene expression profiles. /// "In conclusion, our findings demonstrate differentially expressed genes for the 2 major gene fusion variants in SS, SS18/SSX1 and SS18/SSX2, and thereby suggest that these result in different downstream effects.. "
SSX2_SS18- 15163009synovial sarcoma;sarcoma PCR;RT-PCR - RT-PCR analysis and sequence analysis demonstrated the presence of SS18/SSX2 fusion gene.
SSX2_SS18- 24022186synovial sarcoma;sarcoma - - HEK 293T and NIH 3T3 cell lines were transfected with the SS18-SSX1 or SS18-SSX2 gene to determine the respective involvement of these fusion genes in cell proliferation and invasion. /// "Overall survival was significantly better among SS18-SSX2 cases (P=0.001), FNCLCC grade 2 cases (P<0.001), and UICC stage 1 or 2 (P<0.001) by univariate and multivariate survival analysis. "

ChimerSEQ

Top
The fusion gene pair SSX2--SS18 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
SSX2_SS18chrX/52731674/ chr18/23610113/ Xp11.22 18q11.2 Exonic hg19 - Inter-chr NA AY138495 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair SSX2--SS18 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AY138495SSX2--SS18 SSX2X 52731351 52731674 - 1 324 100 SS1818 23610113 23610357 - 324 568 100
Human AY138494SSX2--SS18 SSX2X 52731210 52731674 - 1 465 100 SS1818 23610113 23610894 - 466 1247 100

FARE-CAFE

Top
The fusion gene pair SSX2--SS18 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
SSX2-SS18 A)Bifocal Synovial Sarcoma,B)Synovial Sarcoma A)FISH,B)PCR,DNA sequencing,FISH,RT-PCR,Immunofluorescence,DOP-PCR t(X;18) PubMed:17509396

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
SSX2-SS18 SSX2-SS18-Isoform1 SSX2 52731324 0 0 SS18 23610660 0 0 CCATATGAAAGCCATGTGACTTGACACAAATCTTCTAAGTTCTCTGAGCTCCAGATTCCTGGTCCATGAAATGGAAGTAAAGAATTATAGTTCATGTTTTAGATCATAGTTATCATTAGATGGTCTTCTTTAGTTTCTATATTTCTGAAACATTTTGTTCCTCTCGCGTTTACATTGATTCATTCTTTATTGTTTTTATTGGTTTTCCTTTTTATTTTACCCTAATATCAATTCTTGACTCTGTATTTTTTTTTCTAGCCTCTGAATCATACTGCCCTCTATTTTCAGTATTCTTAGCTCTTACTTCTCAACCCAGTTTCAGCTCCTTTTTATCCAAATGTACAGAACAT _ AY138494
SSX2-SS18 SSX2-SS18-Isoform2 SSX2 52731394 0 0 SS18 23610261 0 0 ATTTAATCCTTAAGAAGACATTGTTTCTATTATCTCCAAATAATCTAACTCAGATCTTGAGAAATATTCCTTCGGAAATATTATATATAAGTGTGAAGTACCAAGGATGAGCCAATATTAGCCAGGTAGATGTGGATGAT _ AY138495
SSX2-SS18 SSX2-SS18-Isoform3 SSX2 52731095 0 SS18 23610913 0 0 _ _ _
SSX2-SS18 SSX2-SS18-Isoform4 SSX2 52731095 0 SS18 23610913 0 0 _ _ _
SSX2-SS18 SSX2-SS18-Isoform5 SSX2 52731313 0 SS18 23610379 0 0 _ _ _
SSX2-SS18 SSX2-SS18-Isoform6 SSX2 52730235 0 SS18 23607826 0 0 _ _ _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
SSX2-SS18 SSX2-SS18-Isoform1 1) SSXRD
- 1) SSXT
-SSX2 1) KRAB
2) SSXRD
-SS18 1) SSXT
- - -
SSX2-SS18 SSX2-SS18-Isoform2 1) SSXRD
- 1) SSXT
-SSX2 1) KRAB
2) SSXRD
-SS18 1) SSXT
- - -
SSX2-SS18 SSX2-SS18-Isoform3 1) SSXRD
- 1) SSXT
-SSX2 1) KRAB
2) SSXRD
-SS18 1) SSXT
- - -
SSX2-SS18 SSX2-SS18-Isoform4 1) SSXRD
- 1) SSXT
-SSX2 1) KRAB
2) SSXRD
-SS18 1) SSXT
- - -
SSX2-SS18 SSX2-SS18-Isoform5 1) SSXRD
- 1) SSXT
-SSX2 1) KRAB
2) SSXRD
-SS18 1) SSXT
- - -
SSX2-SS18 SSX2-SS18-Isoform6 1) SSXRD
- 1) SSXT
-SSX2 1) KRAB
2) SSXRD
-SS18 1) SSXT
- - -

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
SSX2-SS18 hsa-miR-140-3phsa-miR-215-5phsa-miR-192-5phsa-miR-331-3phsa-miR-222-3p _ Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
SSX2-SS18 NM_001278697.1 - 1) MITF_HUMAN
2) RB1_HUMAN
3) STAT1_HUMAN
4) RBL2_HUMAN
5) ZNF263_HUMAN
6) E2F4_HUMAN
7) ETS1_HUMAN
8) EGR1_HUMAN
9) FOS_HUMAN
10) GATA2_HUMAN
11) GATA3_HUMAN
12) CTCF_HUMAN
13) BRG1_HUMAN
14) TFAP2C_HUMAN
15) FOXA1_HUMAN
16) CEBPA_HUMAN
-

TicDB

Top
The fusion gene pair SSX2--SS18 information is not available in TicDB.

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair SSX2--SS18 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair SSX2--SS18 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair SSX2--SS18 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene SSX2--SS18 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene SSX2--SS18 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene SSX2--SS18 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene SSX2--SS18 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene SSX2--SS18 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair SSX2--SS18 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene SSX2--SS18 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene SSX2--SS18 has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene SSX2 is a known oncogene according to ONGENE database.


The tail gene SS18 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene SSX2 is cancer associated according to Bushman Cancer Gene database.


The tail gene SS18 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene SSX2 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene SS18 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene SSX2--SS18 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene SSX2--SS18 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair SSX2--SS18 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene SSX2--SS18 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene SSX2--SS18 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair SSX2--SS18 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair SSX2--SS18 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair SSX2--SS18 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene SSX2--SS18 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair SSX2--SS18 information is not available in ChromothripsisDB database.