SS18--SSX2

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

SS18 SSX2

COSMIC

The fusion gene pair SS18--SSX2 information is available in COSMIC database.

Link
SS18--SSX2

ChimerKB

Top
The fusion gene pair SS18--SSX2 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
SS18_SSX2-/1286/ -/439/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/1286+?/ -/439-?/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/1286+9829/ -/439/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/1286/ -/439-1995/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/1286+1984/ -/439-684/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/1286+1455/ -/439-1412/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/1286+4538/ -/439-606/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/1286+701/ -/389-6/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/1286/ -/313/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/1286+10808/ -/293/ Exonic hg19 - - - - Cosmic_recurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 16682293 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 7495284 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10397263 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10359553 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 11433527 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 16430486 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 11720441 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 14764066 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 11395555 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 11937885 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 16547469 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10935649 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15140553 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 12469233 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10070316 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15725802 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15735574 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 17175375 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 16723849 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 16778340 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 11826189 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 12201571 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 12505262 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10191774 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 9688183 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 7655467 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10217560 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 9785009 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 9846971 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 9950196 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10718206 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10935650 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 11422798 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 14744540 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15364967 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15105652 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15257548 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15350633 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15330802 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15747098 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 15163009 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 11308259 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 12004001 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 7539744 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10398111 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 9888710 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 10396284 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 12037676 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 12687023 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 20594581 - Cosmic_nonrecurrent
SS18_SSX2-/-/ -/-/ - hg19 synovial sarcoma - 22743288 - Cosmic_nonrecurrent
SS18_SSX2chr18/23612363/- chrX/52729628/- Exonic hg19 - - - - GenBank
SS18_SSX2chr18/23612363/- chrX/52786931/+ Exonic hg19 - - - - GenBank
SS18_SSX2-/0/ -/0/ Exonic hg18 - - - - TICdb
SS18_SSX2-/1088/ -/586/ Exonic hg18 - - - - TICdb
SS18_SSX2-/1452/ -/537/ Exonic hg18 - - - - TICdb
SS18_SSX2-/1469/ -/421/ Exonic hg18 - - - - TICdb
SS18_SSX2-/1984/ -/318/ Exonic hg18 - - - - TICdb
SS18_SSX2-/2006/ -/279/ Exonic hg18 - - - - TICdb
SS18_SSX2-/2251/ -/1700/ Exonic hg18 - - - - TICdb
SS18_SSX2-/4143/ -/1771/ Exonic hg18 - - - - TICdb
SS18_SSX2-/4538/ -/1401/ Exonic hg18 - - - - TICdb
SS18_SSX2-/-/ -/-/ - hg18 synovial sarcoma - 12037676 - OMIM
SS18_SSX2-/-/ -/-/ - hg18 sarcoma - 7539744 - OMIM
SS18_SSX2-/-/ -/-/ - hg18 synovial sarcoma - 10072425 - OMIM
SS18_SSX2-/-/ -/-/ - hg18 synovial sarcoma - 7539744 - OMIM

ChimerPUB

Top
The fusion gene pair SS18--SSX2 information is not available in CHIMERPUB (CHIMERDB 3.0) database.

ChimerSEQ

Top
The fusion gene pair SS18--SSX2 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
SS18_SSX2chr18/23612362/- chrX/52789420/+ 18q11.2 Xp11.22 Exonic hg19 In-Frame Inter-chr SARC TCGA-FX-A8OO-01A - FusionScan
SS18_SSX2chr18/23615074/ chrX/52726465/ 18q11.2 Xp11.22 Exonic hg19 - Inter-chr NA S79332 - ChiTaRs
SS18_SSX2chr18/23670542/ chrX/52726465/ 18q11.2 Xp11.22 Exonic hg19 - Inter-chr NA AB300357 - ChiTaRs
SS18_SSX2chr18/23612422/ chrX/52726158/ 18q11.2 Xp11.22 Exonic hg19 - Inter-chr NA X79200 - ChiTaRs
SS18_SSX2chr18/23670542/ chrX/52727038/ 18q11.2 Xp11.22 Exonic hg19 - Inter-chr NA AF230662 - ChiTaRs
SS18_SSX2chr18/23612390/ chrX/52729539/ 18q11.2 Xp11.22 Exonic hg19 - Inter-chr NA AY138491 - ChiTaRs
SS18_SSX2chr18/23615074/ chrX/52729527/ 18q11.2 Xp11.22 Exonic hg19 - Inter-chr synovial sarcoma AB012575 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair SS18--SSX2 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AB012575SS18--SSX2 SS1818 23612363 23615074 - 1 237 100 SSX2X 52729527 52729630 - 236 339 99.1
Human S79332SS18--SSX2 SS1818 23612363 23615074 - 1 240 100 SSX2X 52726465 52729630 - 239 585 100
Human AB300357SS18--SSX2 SS1818 23612363 23670542 - 1 1146 99.9 SSX2X 52726465 52729630 - 1145 1491 100
Human X79200SS18--SSX2 SS1818 23612363 23612422 - 1 60 100 SSX2X 52726158 52729630 - 59 709 100
Human AB300356SS18--SSX2 SS1818 23612363 23670542 - 1 1239 99.9 SSX2X 52726465 52729630 - 1238 1584 100
Human AF230662SS18--SSX2 SS1818 23612363 23670542 - 4 1242 99.5 SSX2X 52727038 52729630 - 1241 1479 100
Human AY138491SS18--SSX2 SS1818 23607983 23612390 - 1 4408 100 SSX2X 52729539 52731444 - 4408 6309 99.9
Human AY138492SS18--SSX2 SS1818 23608220 23612390 - 1 4171 100 SSX2X 52729539 52729862 - 4172 4495 100
Human AY138490SS18--SSX2 SS1818 23610379 23612390 - 1 2012 100 SSX2X 52729539 52731318 - 2006 3783 99.8
Human AY138488SS18--SSX2 SS1818 23610111 23612390 - 1 2280 100 SSX2X 52729539 52729933 - 2280 2674 100
Human AY138493SS18--SSX2 SS1818 23610908 23612390 - 1 1483 100 SSX2X 52729539 52731097 - 1477 3031 99.9
Human AY138489SS18--SSX2 SS1818 23611274 23612390 - 1 1117 100 SSX2X 52729539 52731046 - 1116 2619 99.9

FARE-CAFE

Top
The fusion gene pair SS18--SSX2 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
SS18-SSX2 Synovial Sarcoma PCR,DNA sequencing,FISH,RT-PCR,Immunofluorescence,DOP-PCR t(X;18)(p11;q11) PubMed:17509396

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
SS18-SSX2 SS18-SSX2-Isoform1 SS18 23610894 0 0 SSX2 52731210 0 0 ACTTTTTAAAAAGTGAGATTCTGTCCATGTATTCCATCACTCAACAAATATTTATTCTCCATGTGTTTGATACTGCAGTAGGTCCTACGGAGGTAAAATAGTCAACCAGCTGTCTTGATCTTCCTTGACCTCACTTTAGCTATTGGCACATTTGCATTTGTCTATGAAGTTCAGATGTTGCTCACTAGGGCTTCACCCCATAGGGCCTGCTGGTGCTTCCAATGAGACACCCACTCTCTCAACAGGAAGGACCATCTGGTCTCTGCTGTGTTGCTGGGGC _ AY138493
SS18-SSX2 SS18-SSX2-Isoform2 SS18 _ _ 0 SSX2 52729611 0 1 CCTTATGGATATGACCAGTCTCCTTTCATGTGTAATAAACGGGCCGAAGACTTCCAGGGGAATGATTTGGATAATGACCCTAACCGTGGGAATCAGGTTGAACGTCCTCAGATGACTTTCGGCAGGCTCCAGGGAATCTCCCCGAAGATCATGCCCAAGAAGCCA _ S79894
SS18-SSX2 SS18-SSX2-Isoform3 SS18 _ _ 0 SSX2 52729608 0 1 ttatggatatgaccagAtcatgcccaagaagccagca _ 17509396
SS18-SSX2 SS18-SSX2-Isoform4 SS18 23607910 0 0 SSX2 52730111 0 0 TTTTTTCTTTATGGATTATGCTTTTGGGATCATGTGTAAGAAATCTTTACCTAACTGAAGGTCACAAAGATTTTCTCCTGTACTTTGTAACCAGAATTGGTATGGGTACCACCTCACTGAATTCCACATTGAATGTCGGTGCCCCAGTAGGGTAGTATGTCATATCTGGTACTGCTTTGTTTGCTGCCTAGATTAATTTCGGCAAACCAT _ AF404832
SS18-SSX2 SS18-SSX2-Isoform5 SS18 23610220 0 0 SSX2 52729833 0 0 TGTAGTTCAGTAAAGCAGAAGCATGGGGAAGAAGAGACAAGACTGGAGAGAGGTGTTGGAGTTAGCTTAGGAAGGCTCTTACAAGCCGTATTAGGGGACTTGAACTTTATACTCTTCTCCAAATCATCTGTATATCACACTCTCAATTACATGGAGATTTTTGCTGTTTGCAAGAATGTCAGTCCTAAAAGAGTGGGAAGATAAGCATTC _ AY138488
SS18-SSX2 SS18-SSX2-Isoform6 SS18 23611340 0 0 SSX2 52730972 0 0 ATGCAGTGGTAACTAGAATTTGAGGCATGAGCAGTTCTTTGATCAGCCCTCTCTCATGCCTACAACCATAGGGCCTGCTGGTGCTTCCAATGAGACACCCACTCTCTCAACAGGAAGGACCATCTGGTCTCTGCTGTGTT _ AY138489
SS18-SSX2 SS18-SSX2-Isoform7 SS18 23610500 0 0 SSX2 52731086 0 0 GGAACATATTGGGAAATAAGATAGACGTGGACTCAGTCTTTATGAACTTAAGTGTAGATGGCATACAGGTGGGTAAACATATGATATGATACAGTGTGATAAGTACTTAGATAAGGAAAGCTCCATGTGACTTGACACAAATCTTCTAAGTTCTCTGAGCTCCAGATTCCTGGTCCATGAAATGGAAGTAAAGAATTATAGTTCATGTTTTAGATCATAGTTATCAGCAACATAATAATAAAATGAGGCTATCGTGGTACAGAGATGTTAAAGAATTTTCCTGGGGCGCAGTGGCAGTGGTAGTCTAATCCAGAGCTCCAAGCCATTTAAAGCTCATTCACATTTGCATT _ AY138490
SS18-SSX2 SS18-SSX2-Isoform8 SS18 23608470 0 0 SSX2 52729764 0 0 CATTCATGGACAAGTCCCTGGGGACATTTTTCTTGGGTAAATACCTAGGAGTGGAATGGTTGGATCATATGATAGGTATATATTTAATTCAACAAACTGCCAGAATGTTTTCCGAAGTAGTTGTACCATTGTATATTCCTATCATTTTACATTCTTACCAGCAGTGTATGATTTCACCCATATCCTTGCTAACTCATTGCCAATATTTGGTATGAATCAGTCTTTTAAATTTTATTTATTCTAATAGGTGTAGTCCTAAAAGAGTGGGAAGATAAGCATTCTATCCCTGGAAACCATATTCACTTAGGCCATTCCTTTCCCTTCTAACCTCCCCTCCCAGGTTTCTCCTA _ AY138492
SS18-SSX2 SS18-SSX2-Isoform9 SS18 23612382 1 0 SSX2 52729605 0 _ _ _
SS18-SSX2 SS18-SSX2-Isoform10 SS18 23612382 1 0 SSX2 52729605 0 _ _ _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
SS18-SSX2 SS18-SSX2-Isoform1 1) GVQW
- 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-
SS18-SSX2 SS18-SSX2-Isoform2 - - 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-
SS18-SSX2 SS18-SSX2-Isoform3 1) GVQW
- 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-
SS18-SSX2 SS18-SSX2-Isoform4 1) GVQW
- 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-
SS18-SSX2 SS18-SSX2-Isoform5 - - 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-
SS18-SSX2 SS18-SSX2-Isoform6 1) GVQW
- 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-
SS18-SSX2 SS18-SSX2-Isoform7 1) GVQW
- 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-
SS18-SSX2 SS18-SSX2-Isoform8 1) GVQW
- 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-
SS18-SSX2 SS18-SSX2-Isoform9 1) GVQW
- 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-
SS18-SSX2 SS18-SSX2-Isoform10 1) GVQW
- 1) KRAB
-SS18 1) SSXT
-SSX2 1) KRAB
2) SSXRD
- 1) SSXT
-

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
SS18-SSX2 _ hsa-miR-140-3phsa-miR-215-5phsa-miR-192-5phsa-miR-331-3phsa-miR-222-3p _

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
SS18-SSX2 NM_001007559.1 1) MITF_HUMAN
2) RB1_HUMAN
3) STAT1_HUMAN
4) RBL2_HUMAN
5) ZNF263_HUMAN
6) E2F4_HUMAN
7) ETS1_HUMAN
8) EGR1_HUMAN
9) FOS_HUMAN
10) GATA2_HUMAN
11) GATA3_HUMAN
12) CTCF_HUMAN
13) BRG1_HUMAN
14) TFAP2C_HUMAN
15) FOXA1_HUMAN
16) CEBPA_HUMAN
- 1) 21258399
2) 20385362
3) 19122651
4) 20385362
5) 19887448
6) 21247883
7) 20019798
8) 20690147
9) 20139302
10) 21808000
11) 21878914
12) 21795385
13) 19505939
14) 21572391
15) 21572391
16) 20219941

TicDB

Top
The fusion gene pair SS18--SSX2 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
SS18 SSX2 17509396 ttatggatatgaccagAtcatgcccaagaagccagca
SS18 SSX2 AF404832 TTTTTTCTTTATGGATTATGCTTTTGGGATCATGTGTAAGAAATCTTTACCTAACTGAAGGTCACAAAGATTTTCTCCTGTACTTTGTAACCAGAATTGGTATGGGTACCACCTCACTGAATTCCACATTGAATGTCGGTGCCCCAGTAGGGTAGTATGTCATATCTGGTACTGCTTTGTTTGCTGCCTAGATTAATTTCGGCAAACCAT
SS18 SSX2 AY138488 TGTAGTTCAGTAAAGCAGAAGCATGGGGAAGAAGAGACAAGACTGGAGAGAGGTGTTGGAGTTAGCTTAGGAAGGCTCTTACAAGCCGTATTAGGGGACTTGAACTTTATACTCTTCTCCAAATCATCTGTATATCACACTCTCAATTACATGGAGATTTTTGCTGTTTGCAAGAATGTCAGTCCTAAAAGAGTGGGAAGATAAGCATTC
SS18 SSX2 AY138489 ATGCAGTGGTAACTAGAATTTGAGGCATGAGCAGTTCTTTGATCAGCCCTCTCTCATGCCTACAACCATAGGGCCTGCTGGTGCTTCCAATGAGACACCCACTCTCTCAACAGGAAGGACCATCTGGTCTCTGCTGTGTT
SS18 SSX2 AY138490 GGAACATATTGGGAAATAAGATAGACGTGGACTCAGTCTTTATGAACTTAAGTGTAGATGGCATACAGGTGGGTAAACATATGATATGATACAGTGTGATAAGTACTTAGATAAGGAAAGCTCCATGTGACTTGACACAAATCTTCTAAGTTCTCTGAGCTCCAGATTCCTGGTCCATGAAATGGAAGTAAAGAATTATAGTTCATGTTTTAGATCATAGTTATCAGCAACATAATAATAAAATGAGGCTATCGTGGTACAGAGATGTTAAAGAATTTTCCTGGGGCGCAGTGGCAGTGGTAGTCTAATCCAGAGCTCCAAGCCATTTAAAGCTCATTCACATTTGCATT
SS18 SSX2 AY138492 CATTCATGGACAAGTCCCTGGGGACATTTTTCTTGGGTAAATACCTAGGAGTGGAATGGTTGGATCATATGATAGGTATATATTTAATTCAACAAACTGCCAGAATGTTTTCCGAAGTAGTTGTACCATTGTATATTCCTATCATTTTACATTCTTACCAGCAGTGTATGATTTCACCCATATCCTTGCTAACTCATTGCCAATATTTGGTATGAATCAGTCTTTTAAATTTTATTTATTCTAATAGGTGTAGTCCTAAAAGAGTGGGAAGATAAGCATTCTATCCCTGGAAACCATATTCACTTAGGCCATTCCTTTCCCTTCTAACCTCCCCTCCCAGGTTTCTCCTA
SS18 SSX2 AY138493 ACTTTTTAAAAAGTGAGATTCTGTCCATGTATTCCATCACTCAACAAATATTTATTCTCCATGTGTTTGATACTGCAGTAGGTCCTACGGAGGTAAAATAGTCAACCAGCTGTCTTGATCTTCCTTGACCTCACTTTAGCTATTGGCACATTTGCATTTGTCTATGAAGTTCAGATGTTGCTCACTAGGGCTTCACCCCATAGGGCCTGCTGGTGCTTCCAATGAGACACCCACTCTCTCAACAGGAAGGACCATCTGGTCTCTGCTGTGTTGCTGGGGC
SS18 SSX2 AY138494 CCATATGAAAGCCATGTGACTTGACACAAATCTTCTAAGTTCTCTGAGCTCCAGATTCCTGGTCCATGAAATGGAAGTAAAGAATTATAGTTCATGTTTTAGATCATAGTTATCATTAGATGGTCTTCTTTAGTTTCTATATTTCTGAAACATTTTGTTCCTCTCGCGTTTACATTGATTCATTCTTTATTGTTTTTATTGGTTTTCCTTTTTATTTTACCCTAATATCAATTCTTGACTCTGTATTTTTTTTTCTAGCCTCTGAATCATACTGCCCTCTATTTTCAGTATTCTTAGCTCTTACTTCTCAACCCAGTTTCAGCTCCTTTTTATCCAAATGTACAGAACAT
SS18 SSX2 AY138495 ATTTAATCCTTAAGAAGACATTGTTTCTATTATCTCCAAATAATCTAACTCAGATCTTGAGAAATATTCCTTCGGAAATATTATATATAAGTGTGAAGTACCAAGGATGAGCCAATATTAGCCAGGTAGATGTGGATGAT
SS18 SSX2 S79894 CCTTATGGATATGACCAGTCTCCTTTCATGTGTAATAAACGGGCCGAAGACTTCCAGGGGAATGATTTGGATAATGACCCTAACCGTGGGAATCAGGTTGAACGTCCTCAGATGACTTTCGGCAGGCTCCAGGGAATCTCCCCGAAGATCATGCCCAAGAAGCCA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair SS18--SSX2 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair SS18--SSX2 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair SS18--SSX2 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene SS18--SSX2 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene SS18--SSX2 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene SS18--SSX2 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene SS18--SSX2 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene SS18--SSX2 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair SS18--SSX2 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene SS18--SSX2 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene SS18--SSX2 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene SS18 is a known oncogene according to ONGENE database.


The tail gene SSX2 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene SS18 is cancer associated according to Bushman Cancer Gene database.


The tail gene SSX2 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene SS18 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene SSX2 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene SS18--SSX2 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene SS18--SSX2 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair SS18--SSX2 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene SS18--SSX2 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene SS18--SSX2 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair SS18--SSX2 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair SS18--SSX2 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair SS18--SSX2 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
SS18--SSX2The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7

Cortex_Dataset

Top
Fusion gene SS18--SSX2 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair SS18--SSX2 information is not available in ChromothripsisDB database.