SLC45A3--ERG

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

SLC45A3 ERG

COSMIC

The fusion gene pair SLC45A3--ERG information is available in COSMIC database.

Link
SLC45A3--ERG

ChimerKB

Top
The fusion gene pair SLC45A3--ERG information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
SLC45A3_ERG-/66/ -/312/ Exonic hg19 - - - - Cosmic_recurrent
SLC45A3_ERG-/-/ -/-/ - hg19 prostate cancer - 19649210 - Cosmic_nonrecurrent
SLC45A3_ERG-/-/ -/-/ - hg19 prostate cancer - 20118910 - Cosmic_nonrecurrent
SLC45A3_ERG-/-/ -/-/ - hg19 prostate cancer - 18794152 - Cosmic_nonrecurrent

ChimerPUB

Top
The fusion gene pair SLC45A3--ERG information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
SLC45A3_ERG- 20118910prostate cancer FISH;PCR - Prevalence of TMPRSS2-ERG and SLC45A3-ERG gene fusions in a large prostatectomy cohort.. /// This is the first study to describe the frequency of SLC45A3-ERG fusions in a large clinical cohort.
SLC45A3_ERG- 19649210prostate cancer FISH - This study demonstrates that most ERG-overexpressing prostate cancers harbor hormonally regulated TMPRSS2-ERG, SLC45A3-ERG, or NDRG1-ERG fusions. /// "Screening for known 5' partners, we determined that three cases harbored the SLC45A3-ERG fusion. "
SLC45A3_ERG- 24517914prostate cancer FISH - This genetic aberration, most commonly leading to the TMPRSS2-ERG fusion, but also SLC45A3-ERG or NDRG1-ERG fusions, all leading to an overexpression of a truncated ERG protein. /// "This genetic aberration, most commonly leading to the TMPRSS2-ERG fusion, but also SLC45A3-ERG or NDRG1-ERG fusions, all leading to an overexpression of a truncated ERG protein. "
SLC45A3_ERG- 22821757prostate cancer - - Loss of SLC45A3 protein (prostein) expression in prostate cancer is associated with SLC45A3-ERG gene rearrangement and an unfavorable clinical course.. /// "SLC45A3 showed a weaker expression in cancer as compared to benign tissue, which was pronounced in cases with SLC45A3-ERG fusion." /// This study provides first evidence that the expression of SLC45A3 protein is down regulated through SLC45A3-ERG fusion in prostate cancer. /// "SLC45A3 showed a weaker expression in cancer as compared to benign tissue, which was pronounced in cases with SLC45A3-ERG fusion. "
SLC45A3_ERG- 26959281pure red cell aplasia FISH;PCR;RT-PCR - TMPRSS2-ERG and SLC45A3-ERG by RT-PCR, FISH, and direct sequencing. /// "SLC45A3-ERG was found in 25 cases, 20 of them with concurrent TMPRSS2-ERG rearrangement: 11.5% GS??=??6, 22.2% GS??=??7, and 50% GS?????8 tumors (P??=??0.013). " /// "SLC45A3-ERG and TMPRSS2-ERG rearrangements and their association with ERG and PTEN expression and with clinical and pathological features have been analyzed in 80??rCa (PSMAR-Biobank, Barcelona, Spain). " /// Concurrent TMPRSS2-ERG and SLC45A3-ERG rearrangements plus PTEN loss are not found in low grade prostate cancer and define an aggressive tumor subset.. /// Subsequent development of SLC45A3-ERG results in higher ERG expression. /// Tumors with combined TMPRSS2-ERG/SLC45A3-ERG fusions plus PTEN loss should be excluded from watchful waiting and are candidates for intensive therapy.
SLC45A3_ERG- 19293179prostate cancer PCR - TMPRSS2-ERG, TMPRSS2-ETV1, and SLC45A3-ERG rearrangements account for roughly 90% of ETS fusion prostate cancer.

ChimerSEQ

Top
The fusion gene pair SLC45A3--ERG information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
SLC45A3_ERGchr1/205649521/- chr21/39817544/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-XJ-A9DQ-01A - FusionScan
SLC45A3_ERGchr1/205649521/- chr21/39817544/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-HC-7821-01A - FusionScan
SLC45A3_ERGchr1/205649521/- chr21/39817544/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-YL-A9WX-01A - FusionScan
SLC45A3_ERGchr1/205649521/- chr21/39817544/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-KK-A8I5-01A - FusionScan
SLC45A3_ERGchr1/205649521/- chr21/39817544/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-HC-A6AN-01A - FusionScan
SLC45A3_ERGchr1/205649521/- chr21/39817544/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-HC-7820-01A - FusionScan
SLC45A3_ERGchr1/205649521/- chr21/39817544/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-G9-7522-01A - FusionScan
SLC45A3_ERGchr1/205649521/- chr21/39817544/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-G9-6351-01A - FusionScan
SLC45A3_ERGchr1/205648939/- chr21/39817543/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-G9-6351-01A - TopHat-Fusion
SLC45A3_ERGchr1/205649521/- chr21/39817543/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-G9-6351-01A - TopHat-Fusion
SLC45A3_ERGchr1/205649521/- chr21/39817543/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-HC-7820-01A - TopHat-Fusion
SLC45A3_ERGchr1/205649521/- chr21/39817543/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-KK-A8I5-01A - TopHat-Fusion
SLC45A3_ERGchr1/205649521/- chr21/39817543/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-J4-A83N-01A - TopHat-Fusion
SLC45A3_ERGchr1/205649521/- chr21/39817543/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-HC-7821-01A - TopHat-Fusion
SLC45A3_ERGchr1/205649521/- chr21/39817543/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-G9-7522-01A - TopHat-Fusion
SLC45A3_ERGchr1/205649521/- chr21/39817543/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-HC-A6AN-01A - TopHat-Fusion
SLC45A3_ERGchr1/205649521/- chr21/39817543/- 1q32.1 21q22.2 Exonic hg19 5'UTR-5'UTR Inter-chr PRAD TCGA-HC-7748-01A - TopHat-Fusion

ChiTaRS 2.1

Top
The fusion gene pair SLC45A3--ERG information is not available in CHITARS database.

FARE-CAFE

Top
The fusion gene pair SLC45A3--ERG information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
SLC45A3-ERG Prostate Cancer qPCR,RT-PCR,RACE,PCR,FISH,DNA sequencing _ PubMed:19649210

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
SLC45A3-ERG SLC45A3-ERG SLC45A3 _ _ 0 ERG _ 0 _ gcgcgcctcggccagGaagccttatcagtt 19649210 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
SLC45A3-ERG SLC45A3-ERG - - - -SLC45A3 1) MFS_1
-ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
SLC45A3-ERG hsa-miR-133a-3phsa-miR-145-5phsa-miR-133b hsa-miR-138-5phsa-miR-126-3phsa-miR-126-5phsa-miR-32-5p Report assay

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
SLC45A3-ERG NM_033102.2 1) STAT1_HUMAN
2) E2F4_HUMAN
3) ESTROGEN RECEPTOR ALPHA_HUMAN
4) FOS_HUMAN
5) CTCF_HUMAN
6) BRG1_HUMAN
7) HNF4A_HUMAN
8) EPAS1_HUMAN
9) TFAP2C_HUMAN
10) FOXA1_HUMAN
11) CEBPA_HUMAN
12) ESR1_HUMAN
13) FOXP1_HUMAN
14) NR1H3_HUMAN
15) SETDB1_HUMAN
- 1) 19122651
2) 21247883
3) 20547749
4) 20139302
5) 21795385
6) 19505939
7) 21646355
8) 21447827
9) 21572391
10) 21572391
11) 20219941
12) 21235772
13) 21924763
14) 22292898
15) 21430779

TicDB

Top
The fusion gene pair SLC45A3--ERG information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
SLC45A3 ERG 19649210 gcgcgcctcggccagGaagccttatcagtt

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair SLC45A3--ERG information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
PRAD EJ-A7NG-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier4 5UTR-CDS 16238 NA
PRAD G9-6351-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier1 5UTR-CDS 16239 NA
PRAD G9-7522-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier1 5UTR-CDS 16240 non-validated
PRAD HC-7748-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier1 5UTR-CDS 16241 NA
PRAD HC-7752-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier4 5UTR-CDS 16242 NA
PRAD HC-7820-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier1 5UTR-CDS 16243 NA
PRAD HC-7821-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier1 5UTR-CDS 16244 NA
PRAD HC-A6AN-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier1 5UTR-CDS 16245 NA
PRAD J4-A83N-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier1 5UTR-CDS 16246 NA
PRAD KK-A8I5-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier1 5UTR-CDS 16247 NA
PRAD XJ-A9DQ-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier1 5UTR-CDS 16248 NA
PRAD YL-A9WX-01A SLC45A3__ERG 0.6 1:205649522/-1 21:39817544/-1 tier4 5UTR-CDS 16249 NA

FusionCancer

Top
The fusion gene pair SLC45A3--ERG information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair SLC45A3--ERG information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene SLC45A3--ERG has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene SLC45A3--ERG is found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016)

Bodymap2

Top
Fusion gene SLC45A3--ERG is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene SLC45A3--ERG is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene SLC45A3--ERG was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair SLC45A3--ERG information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene SLC45A3--ERG is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene SLC45A3--ERG has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene SLC45A3 is not a known oncogene according to ONGENE database.


The tail gene ERG is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene SLC45A3 is cancer associated according to Bushman Cancer Gene database.


The tail gene ERG is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene SLC45A3 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ERG is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene SLC45A3--ERG is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene SLC45A3--ERG is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair SLC45A3--ERG information is available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

5'Gene5'Chr5'Coordinate3'Gene3'Chr3'Coordinate# Spanning ReadsSPLICE JUNCTION?IN-FRAME?JUNCTION SEQUENCECASE NUMBERCAISISLibrary
SLC45A31205649522ERG2139817544603YESNOAACCAGCCTGCACGCGCTGGCTCCGGGTGACAGCCGCGCGCCTCGGCCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 73611512906115129-T-C1
SLC45A31205642827ERG213982009324NONOTACTGAGTCTGACTTGGAGCCCTCTCTTTATAAATGGGACTGATCACAGA TGCCAGATGTGAGAATGGATTCCTTCCCCTACAAACACACACTTAAGCTT 73611512906115129-T-C1
SLC45A31205649522ERG213981754434YESNOAACCAGCCTGCACGCGCTGGCTCCGGGTGACAGCCGCGCGCCTCGGCCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 959115175SI_7594
SLC45A31205649522ERG2139817544128YESNOAACCAGCCTGCACGCGCTGGCTCCGGGTGACAGCCGCGCGCCTCGGCCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 959115175SI_7608
SLC45A31205649522ERG213981754481YESNOAACCAGCCTGCACGCGCTGGCTCCGGGTGACAGCCGCGCGCCTCGGCCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 1229115104SI_6865
SLC45A31205649522ERG2139817544186YESNOAACCAGCCTGCACGCGCTGGCTCCGGGTGACAGCCGCGCGCCTCGGCCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 13197115315SI_8668
SLC45A31205649522ERG2139817544185YESNOAACCAGCCTGCACGCGCTGGCTCCGGGTGACAGCCGCGCGCCTCGGCCAG GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 13197115315SI_8702
SLC45A31205648940ERG213981754410YESNOGCCGCGGCGCCGCGGGGTGCTCAGGCCCAGGCCGGCTTTCTTGAGGAAGA GAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTA 13197115315SI_8668

Pancreases_Dataset

Top
Fusion gene SLC45A3--ERG is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene SLC45A3--ERG has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair SLC45A3--ERG information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair SLC45A3--ERG information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair SLC45A3--ERG information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene SLC45A3--ERG is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair SLC45A3--ERG information is not available in ChromothripsisDB database.