RUNX1--RUNX1T1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

RUNX1 RUNX1T1

COSMIC

The fusion gene pair RUNX1--RUNX1T1 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair RUNX1--RUNX1T1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
RUNX1_RUNX1T1-/-/ -/-/ - hg18 acute myeloid leukemia - - Oncogene; Mitelman
RUNX1_RUNX1T1-/-/ -/-/ - hg18 acute myeloblastic leukemia - - Oncogene; Mitelman
RUNX1_RUNX1T1-/-/ -/-/ - hg18 acute myelomonocytic leukemia - - Oncogene; Mitelman
RUNX1_RUNX1T1-/-/ -/-/ - hg18 acute promyelocytic leukemia - - Oncogene; Mitelman
RUNX1_RUNX1T1-/-/ -/-/ - hg18 chronic myeloid leukemia - - Oncogene; Mitelman
RUNX1_RUNX1T1-/0/ -/0/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/0/ -/13257/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/0/ -/58534/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/1583/ -/39622/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/2103/ -/21522/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/4889/ -/11542/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/5295/ -/7225/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/7782/ -/10615/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/7826/ -/4466/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/7887/ -/10622/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/8047/ -/1934/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/8092/ -/1873/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/8604/ -/8475/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/9871/ -/10070/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/11159/ -/10787/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/12180/ -/6819/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/12217/ -/6942/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/12711/ -/8471/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/12845/ -/8488/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/13226/ -/6439/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/14679/ -/25764/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/15624/ -/2155/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/16255/ -/10428/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/16319/ -/10376/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/16451/ -/7038/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/20279/ -/10705/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/20279/ -/10718/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/20794/ -/3785/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/21307/ -/6296/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/21865/ -/6104/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/22879/ -/8364/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/22978/ -/8162/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/23683/ -/3636/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/24010/ -/12790/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/24129/ -/26057/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/24135/ -/6978/ Exonic hg18 - - - Oncogene; TICdb
RUNX1_RUNX1T1-/-/ -/-/ - hg18 acute myelogenous leukemia - 1391946 Oncogene; OMIM
RUNX1_RUNX1T1-/-/ -/-/ - hg18 leukemia - 10611307 Oncogene; OMIM

ChimerPUB

Top
The fusion gene pair RUNX1--RUNX1T1 information is not available in CHIMERPUB (CHIMERDB 3.0) database.

ChimerSEQ

Top
The fusion gene pair RUNX1--RUNX1T1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
RUNX1_RUNX1T1chr21/36231770/- chr8/93074937/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2819-03A Oncogene; FusionScan
RUNX1_RUNX1T1chr21/36231770/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2858-03A Oncogene; FusionScan
RUNX1_RUNX1T1chr21/36231770/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2806-03A Oncogene; FusionScan
RUNX1_RUNX1T1chr21/36231770/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2886-03A Oncogene; FusionScan
RUNX1_RUNX1T1chr21/36231770/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2819-03A Oncogene; FusionScan
RUNX1_RUNX1T1chr21/36231770/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2858-03A Oncogene; FusionScan
RUNX1_RUNX1T1chr21/36231770/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2875-03A Oncogene; FusionScan
RUNX1_RUNX1T1chr21/36231770/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2937-03A Oncogene; FusionScan
RUNX1_RUNX1T1chr21/36231770/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2950-03A Oncogene; FusionScan
RUNX1_RUNX1T1chr21/36231770/- chr8/93029590/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2806-03A Oncogene; TopHat-Fusion
RUNX1_RUNX1T1chr21/36231770/- chr8/93029590/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2858-03A Oncogene; TopHat-Fusion
RUNX1_RUNX1T1chr21/36231770/- chr8/93029590/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2858-03A Oncogene; TopHat-Fusion
RUNX1_RUNX1T1chr21/36231770/- chr8/93029590/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2875-03A Oncogene; TopHat-Fusion
RUNX1_RUNX1T1chr21/36231770/- chr8/93029658/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2875-03A Oncogene; TopHat-Fusion
RUNX1_RUNX1T1chr21/36231770/- chr8/93029590/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2886-03A Oncogene; TopHat-Fusion
RUNX1_RUNX1T1chr21/36231770/- chr8/93029590/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2937-03A Oncogene; TopHat-Fusion
RUNX1_RUNX1T1chr21/36231770/- chr8/93029590/- 21q22.12 8q21.3 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2950-03A Oncogene; TopHat-Fusion
RUNX1_RUNX1T1chr21/36231871/ chr8/93023003/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA D14822 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36231810/ chr8/92972023/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA S78158 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36231877/ chr8/93029501/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA Z35296 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36260987/ chr8/92972023/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA E07332 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36231810/ chr8/93016652/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA S78159 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36228674/ chr8/93080780/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA DQ177304 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36228336/ chr8/93077386/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA DQ177305 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36231871/ chr8/93016650/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA D14823 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36421226/ chr8/93006733/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA KJ189470 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36421539/ chr8/92972432/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA KJ189468 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36421226/ chr8/93006730/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA KJ189476 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36421539/ chr8/93006730/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA KJ189471 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36421226/ chr8/92972432/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA KJ189469 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36421539/ chr8/92992092/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA KJ189464 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36259444/ chr8/92992092/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr NA KJ189465 Oncogene; ChiTaRs
RUNX1_RUNX1T1chr21/36231771/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2806-03A Oncogene; PRADA
RUNX1_RUNX1T1chr21/36231771/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2819-03A Oncogene; PRADA
RUNX1_RUNX1T1chr21/36231771/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2858-03A Oncogene; PRADA
RUNX1_RUNX1T1chr21/36231771/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2875-03A Oncogene; PRADA
RUNX1_RUNX1T1chr21/36231771/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2886-03A Oncogene; PRADA
RUNX1_RUNX1T1chr21/36231771/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2937-03A Oncogene; PRADA
RUNX1_RUNX1T1chr21/36231771/- chr8/93029591/- 21q22.12 8q21.3 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2950-03A Oncogene; PRADA
RUNX1_RUNX1T1chr21/36260987/ chr8/92972035/ 21q22.12 8q21.3 Exonic hg19 - Inter-chr acute myeloid leukemia D13979 Oncogene; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair RUNX1--RUNX1T1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human D14822RUNX1--RUNX1T1 RUNX121 36231771 36231871 - 1 101 100 RUNX1T18 93023003 93029591 - 102 799 99.9
Human S78158RUNX1--RUNX1T1 RUNX121 36231771 36231810 - 1 40 100 RUNX1T18 92972023 93029591 - 41 2214 99.9
Human Z35296RUNX1--RUNX1T1 RUNX121 36231771 36231877 - 11 117 100 RUNX1T18 93029501 93029659 - 118 276 100
Human E07332RUNX1--RUNX1T1 RUNX121 36231771 36260987 - 1 2110 100 RUNX1T18 92972023 93029591 - 2111 4284 100
Human S78159RUNX1--RUNX1T1 RUNX121 36231771 36231810 - 1 40 100 RUNX1T18 93016652 93029591 - 41 1383 100
Human D13979RUNX1--RUNX1T1 RUNX121 36231771 36260987 - 1 2110 100 RUNX1T18 92972035 93029591 - 2111 4272 100
Human DQ177304RUNX1--RUNX1T1 RUNX121 36228050 36228674 - 13 637 99.7 RUNX1T18 93080780 93080836 - 637 693 100
Human DQ177305RUNX1--RUNX1T1 RUNX121 36228024 36228336 - 1 310 99.1 RUNX1T18 93077386 93077529 - 305 447 99.3
Human D14823RUNX1--RUNX1T1 RUNX121 36231771 36231871 - 1 101 100 RUNX1T18 93016650 93029591 - 102 1446 100
Human KJ189470RUNX1--RUNX1T1 RUNX121 36231771 36421226 - 1 193 100 RUNX1T18 93006733 93029591 - 194 723 99.5
Human KJ189468RUNX1--RUNX1T1 RUNX121 36421139 36421539 - 1 192 100 RUNX1T18 92972432 93029593 - 191 644 100
Human KJ189476RUNX1--RUNX1T1 RUNX121 36265222 36421226 - 1 127 100 RUNX1T18 93006730 93006852 - 127 249 100
Human KJ189471RUNX1--RUNX1T1 RUNX121 36259343 36421539 - 1 282 100 RUNX1T18 93006730 93017462 - 277 517 100
Human KJ189469RUNX1--RUNX1T1 RUNX121 36421139 36421226 - 1 88 100 RUNX1T18 92972432 92972747 - 87 402 99.7
Human KJ189467RUNX1--RUNX1T1 RUNX121 36421138 36421539 - 1 193 100 RUNX1T18 92972432 92999202 - 191 1054 99.8
Human KJ189464RUNX1--RUNX1T1 RUNX121 36265221 36421539 - 1 232 100 RUNX1T18 92992092 92992160 - 231 299 100
Human KJ189465RUNX1--RUNX1T1 RUNX121 36259338 36259444 - 1 107 99.1 RUNX1T18 92992092 93019671 - 97 987 99.9
Human KJ189475RUNX1--RUNX1T1 RUNX121 36421139 36421226 - 1 88 100 RUNX1T18 93006730 93006853 - 87 210 100
Human KJ189466RUNX1--RUNX1T1 RUNX121 36421139 36421539 - 1 192 99.5 RUNX1T18 92972432 92972747 - 191 506 99.7

FARE-CAFE

Top
The fusion gene pair RUNX1--RUNX1T1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
RUNX1/AML1-RUNX1T1/ETO Acute myelomonocytic leukemia (FAB type M4) Microscopy,Immunofluorescence t(8;21)(q22;q22) PubMed:10611307

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform1 RUNX1/AML1 _ _ 0 RUNX1T1/ETO _ 0 _ ccccgagaacctcgaaAtcgtactgagaagcact 18206543 _
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform2 RUNX1/AML1 36219615 0 0 RUNX1T1/ETO 93081341 0 0 ACTTTTAGAAATTTTACCTTTTTCCAAAAATAAAAAAATAGGGAATAAATATTGTATAT _ AY152446
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform3 RUNX1/AML1 36219554 0 0 RUNX1T1/ETO 93081251 0 0 TTGAATTTATTTAAAGATATCTGGGATACCCTTTTTAAATGTTGGAAACAAAAGAAGTAA _ AY152447
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform4 RUNX1/AML1 36208088 0 0 RUNX1T1/ETO 93084532 0 0 GAAACATAATAAACCAGATCATAGATCAAGGGGGGGGCAGCGGGCAGGCTGTTTCTCAATCTG _ AY152449
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform5 RUNX1/AML1 36207796 0 0 RUNX1T1/ETO 93075376 0 0 TTGTTTTGGTGAAGAGCATGATGAGGACACTTGCTATAAAAATGTTTGTAGGCTGTTTGGGAT _ AY152450
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform6 RUNX1/AML1 36226510 0 0 RUNX1T1/ETO 93081161 0 0 TATAGCAAACCTATTATATATGTGAACATGAGAAATACTATCCTTAGAATTCCCAGGCTCCA _ AY152452
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform7 RUNX1/AML1 36221920 0 0 RUNX1T1/ETO 93078088 0 0 AGTATGATTGACACATGGTATTACAGCTCCTTTGAATTAACTCACTTAATACCCACTGT _ AY152453
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform8 RUNX1/AML1 36220641 0 0 RUNX1T1/ETO 93077374 0 0 CTGCATGATACCTCTCTTGCTAGGGGATGTTTTTTATGAACGAAAAGTTATTCTGTCTGAGTA _ AY152455
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform9 RUNX1/AML1 36218960 0 0 RUNX1T1/ETO 93079683 0 0 GGCCTGACCTGGTGGAAAGACTGCGGGCCTGCCCGCAGAGTCCATTATTAACTTACTTT _ AY152457
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform10 RUNX1/AML1 36219060 0 0 RUNX1T1/ETO 93079722 0 0 GGAAGTCATTATTTAAAATATTTTAACATTGGAATCCGAACTGGAAACCACTGAAATTTGAGT _ AY152458
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform11 RUNX1/AML1 36218575 0 0 RUNX1T1/ETO 93081728 0 0 GTGACATGCTCTAAGTAGGGGAAATCTTCCTTTATATGTGGGCATAGATTTTGATAATTTG _ AY152459
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform12 RUNX1/AML1 36230217 0 0 RUNX1T1/ETO 93048539 0 0 GACCCTGATTCTTCTTTATGAGTGAAAAGCTTGAGAACACTTTCCTGTATATTTAGACATTTA _ AY152436
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform13 RUNX1/AML1 36217118 0 0 RUNX1T1/ETO 93062402 0 0 CTCAGTTGGCGTCTGTGACAGGAGAGATGCCCCCTAGATTTTCCTCCCCCTGATTTCTTC _ AY152460
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform14 RUNX1/AML1 36216180 0 0 RUNX1T1/ETO 93086005 0 0 GCCACGAATTCCTGGGCTCGAGCAATCCTCCCAGGGCTCACTGTCCATTTCTGTCTGGTGACT _ AY152462
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform15 RUNX1/AML1 36215485 0 0 RUNX1T1/ETO 93077791 0 0 TGTGTCTGTATGTGTTTACATGCATGCCTGTGTTGGGTTGTCAGAAAACAACTTATGTATTTG _ AY152463
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform16 RUNX1/AML1 36215526 0 0 RUNX1T1/ETO 93077765 0 0 TTTGCTTTTGTGGGAGCCCAGCATTTTGTTTTTGCTGTGTGTGTGTCCAGGTGTCTGTGTATG _ AY152464
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform17 RUNX1/AML1 36215355 0 0 RUNX1T1/ETO _ 0 _ TCGCTCTGTCGCTCAGGCTGGAGTGCACTGGCATGATGAATATAATCAAGTTCATCAAGAATT _ AY152465
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform18 RUNX1/AML1 36210978 0 0 RUNX1T1/ETO 93084407 0 0 CAAAATCATTTATTTCTTGGTGAGCCTTCTTTCCATTGTCATAAAACAGTAGCAAATCAAAGG _ AY152467
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform19 RUNX1/AML1 36211518 0 0 RUNX1T1/ETO 93077448 0 0 TTTTCAGACCTGCCCTCTTCCTGTAACCCATTCCTTTTTTATTATACAATTTGGATGTTAGAG _ AY152468
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform20 RUNX1/AML1 36211492 0 0 RUNX1T1/ETO 93077488 0 0 CATTCACTTGCATAAATGCATTCATCATGTTGCCGCCCTGGCCGTGTGAGATTGGGCAAATGA _ AY152469
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform21 RUNX1/AML1 36210493 0 0 RUNX1T1/ETO 93081866 0 0 AAAGGCAGCTCGGGTATCAACGAGATATGCCCATTGATATAAAAGCAAATATACTATGCTGGG _ AY152470
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform22 RUNX1/AML1 36209907 0 0 RUNX1T1/ETO 93082089 0 0 GTACAATAATCCATAATTTTAATAAGATTATAACATTCGGGGGGCAAATGAGCCTTTTAACTG _ AY152471
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform23 RUNX1/AML1 36229644 0 0 RUNX1T1/ETO 93066708 0 0 TATGCTGTGTACCTGTATAAAGAGGTTATTAAACCTCTTGGCAGTCAGAGGGGAAAAAAGATG _ AY152437
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform24 RUNX1/AML1 36208923 0 0 RUNX1T1/ETO 93079808 0 0 TCTTCTTTACCCCAACTCGTAATGCCAGGCATAAAGACACTCTAATATTTTATTCTGTAGACA _ AY152472
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform25 RUNX1/AML1 36208793 1 0 RUNX1T1/ETO 93080031 0 1 AAGGCATTGGCACTATCAGAAACAATTTGTAAAGTTTGATCATCAGGAAGCCAAGGATCTATG _ AY152473
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform26 RUNX1/AML1 36207670 1 0 RUNX1T1/ETO 93081170 0 1 GAAGCTCACCAGATAGGCTGTAGCTACCTTTGTTTTTTGGACAAATACTATCCTTAGAATTCC _ AY152474
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform27 RUNX1/AML1 36207636 1 0 RUNX1T1/ETO 93081215 0 1 AAATATTATGCCAAAGTATGATGATGATGACTCACTCCAGTGGGCCTATTNTGCTGGGAATAT _ AY152475
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform28 RUNX1/AML1 36223971 1 0 RUNX1T1/ETO 93083693 0 1 CCACACCAGTGAGGTCAGGATCTAAACAGATCTAAGAATTTGGCTCTATTTTACACTTCTGG _ AY152476
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform29 RUNX1/AML1 36231871 1 0 RUNX1T1/ETO 93029483 0 1 AAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAATCGTACTGAGAAGCACTCCACAATGCCAGACTCACCTGTGGATGTGAAGACGCAATCTAGGCTGACTCCTCCAACAATGCCACCTCCCCCAACTACTCAAGGAGCTCC _ D14822
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform30 RUNX1/AML1 _ _ 0 RUNX1T1/ETO 93029539 0 1 GCCCCGAGAACCTCGAAATCGTACTGAGAAGCACTCCACAATGCCAGACTCACCTGTGGATGTGAAGACG _ S45790
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform31 RUNX1/AML1 36231841 1 0 RUNX1T1/ETO 93029606 0 1 AAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAATAAACCCCACTTGAAAAACTGAGGTGCTTAAGGAGTAAAATAATATGTTCCTG _ Z35296
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform32 RUNX1/AML1 36226882 0 0 RUNX1T1/ETO 93076651 0 0 GCTTAACTGTACTGAAATCCATTACAGAGATGAGGTGAAATCTCACTCTGTTGCCCATGCTGG _ AY152439
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform33 RUNX1/AML1 36223916 0 0 RUNX1T1/ETO 93077547 0 0 ATTGTATGACATGCCATAAGAAAAAAAAAACCCGGACTATGACAGTGTTTTGTACTGGAGAAC _ AY152440
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform34 RUNX1/AML1 36223989 0 0 RUNX1T1/ETO _ 0 _ GGGATATATTCTAGTTTTATAAAATATGATATCACTAATTTGAATGCCACACCAGTGAGGTC _ AY152441
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform35 RUNX1/AML1 36223751 0 0 RUNX1T1/ETO 93086232 0 0 TACTTTCATCTTCATTTTCCTCTCCTGTGAGACCTTGTTTTCCATGTGGCATTAAAAATTTA _ AY152442
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform36 RUNX1/AML1 36223679 0 0 RUNX1T1/ETO 93086320 0 0 GTATGTGTGGTGTGTGTACATACTTTAAACATAGCAAAAAGGGTAACAAAATATGGTCAGC _ AY152443
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform37 RUNX1/AML1 36223198 0 0 RUNX1T1/ETO 93079695 0 0 CTTGAAATCCTTCTGGAAATGAGAAAACTTTAGAAAGTACAGTCGTAGAGTCCATTA _ AY152444

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform1 - - - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) Runt
2) RunxI
3) TAFH
4) NHR2
5) zf-MYND
1) Runt , CBF_beta
2) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform2 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform3 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform4 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform5 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform6 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform7 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform8 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform9 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform10 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform11 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform12 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform13 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform14 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform15 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform16 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform17 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform18 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform19 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform20 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform21 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform22 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform23 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform24 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform25 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform26 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform27 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform28 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform29 1) Runt
2) RunxI
1) Runt , CBF_beta
- -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform30 - - - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) Runt
2) RunxI
3) TAFH
4) NHR2
5) zf-MYND
1) Runt , CBF_beta
2) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform31 1) Runt
2) RunxI
1) Runt , CBF_beta
- -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform32 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform33 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform34 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform35 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform36 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform37 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
RUNX1/AML1-RUNX1T1/ETO hsa-miR-106b-5phsa-miR-183-5phsa-miR-103a-3phsa-miR-16-5phsa-let-7e-5p hsa-miR-27a-3phsa-miR-17-5phsa-miR-20a-5phsa-miR-106a-5phsa-miR-423-5p Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
RUNX1/AML1-RUNX1T1/ETO NM_001001890.2 1) MITF_HUMAN
2) HIF1A_HUMAN
3) STAT1_HUMAN
4) RB1_HUMAN
5) RBL2_HUMAN
6) ZNF263_HUMAN
7) E2F4_HUMAN
8) P53_HUMAN
9) RUNX1_HUMAN
10) PRDM14_HUMAN
11) ESTROGEN RECEPTOR ALPHA_HUMAN
12) ETS1_HUMAN
13) EGR1_HUMAN
14) FOS_HUMAN
15) GATA2_HUMAN
16) GATA3_HUMAN
17) E2F1_HUMAN
18) SOX2_HUMAN
19) TAL1_HUMAN
20) CTCF_HUMAN
21) BRG1_HUMAN
22) HNF4A_HUMAN
23) TFAP2C_HUMAN
24) FOXA1_HUMAN
25) CEBPA_HUMAN A
26) STAT6_HUMAN A
27) ESR1_HUMAN A
28) ESR2_HUMAN A
29) AR_HUMAN A
30) MEIS1_HUMAN A
31) FOXP1_HUMAN A
32) NR1H3_HUMAN A
33) SETDB1_HUMAN A
34) SPI1_HUMAN A
35) TAL1_HUMAN A
36) TRIM24_HUMAN A
37) VDR_HUMAN
- 1) 21258399
2) 19828020
3) 19122651
4) 20385362
5) 20385362
6) 19887448
7) 21247883
8) 21394211
9) 20019798
10) 20953172
11) 20547749
12) 20019798
13) 20690147
14) 20139302
15) 21808000
16) 21878914
17) 21310950
18) 21211035
19) 21795385
20) 21795385
21) 19505939
22) 21646355
23) 21572391
24) 21572391
25) 20219941 A
26) 21828071 A
27) 20348243 A
28) 21235772 A
29) 21572438 A
30) 21241896 A
31) 21924763 A
32) 22292898 A
33) 21430779 A
34) 21241896 A
35) 21241896 A
36) 21164480 A
37) 21846776

TicDB

Top
The fusion gene pair RUNX1--RUNX1T1 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
RUNX1 RUNX1T1 18206543 ccccgagaacctcgaaAtcgtactgagaagcact
RUNX1 RUNX1T1 AY152436 GACCCTGATTCTTCTTTATGAGTGAAAAGCTTGAGAACACTTTCCTGTATATTTAGACATTTA
RUNX1 RUNX1T1 AY152437 TATGCTGTGTACCTGTATAAAGAGGTTATTAAACCTCTTGGCAGTCAGAGGGGAAAAAAGATG
RUNX1 RUNX1T1 AY152439 GCTTAACTGTACTGAAATCCATTACAGAGATGAGGTGAAATCTCACTCTGTTGCCCATGCTGG
RUNX1 RUNX1T1 AY152440 ATTGTATGACATGCCATAAGAAAAAAAAAACCCGGACTATGACAGTGTTTTGTACTGGAGAAC
RUNX1 RUNX1T1 AY152441 GGGATATATTCTAGTTTTATAAAATATGATATCACTAATTTGAATGCCACACCAGTGAGGTC
RUNX1 RUNX1T1 AY152442 TACTTTCATCTTCATTTTCCTCTCCTGTGAGACCTTGTTTTCCATGTGGCATTAAAAATTTA
RUNX1 RUNX1T1 AY152443 GTATGTGTGGTGTGTGTACATACTTTAAACATAGCAAAAAGGGTAACAAAATATGGTCAGC
RUNX1 RUNX1T1 AY152444 CTTGAAATCCTTCTGGAAATGAGAAAACTTTAGAAAGTACAGTCGTAGAGTCCATTA
RUNX1 RUNX1T1 AY152446 ACTTTTAGAAATTTTACCTTTTTCCAAAAATAAAAAAATAGGGAATAAATATTGTATAT
RUNX1 RUNX1T1 AY152447 TTGAATTTATTTAAAGATATCTGGGATACCCTTTTTAAATGTTGGAAACAAAAGAAGTAA
RUNX1 RUNX1T1 AY152449 GAAACATAATAAACCAGATCATAGATCAAGGGGGGGGCAGCGGGCAGGCTGTTTCTCAATCTG
RUNX1 RUNX1T1 AY152450 TTGTTTTGGTGAAGAGCATGATGAGGACACTTGCTATAAAAATGTTTGTAGGCTGTTTGGGAT
RUNX1 RUNX1T1 AY152452 TATAGCAAACCTATTATATATGTGAACATGAGAAATACTATCCTTAGAATTCCCAGGCTCCA
RUNX1 RUNX1T1 AY152453 AGTATGATTGACACATGGTATTACAGCTCCTTTGAATTAACTCACTTAATACCCACTGT
RUNX1 RUNX1T1 AY152455 CTGCATGATACCTCTCTTGCTAGGGGATGTTTTTTATGAACGAAAAGTTATTCTGTCTGAGTA
RUNX1 RUNX1T1 AY152457 GGCCTGACCTGGTGGAAAGACTGCGGGCCTGCCCGCAGAGTCCATTATTAACTTACTTT
RUNX1 RUNX1T1 AY152458 GGAAGTCATTATTTAAAATATTTTAACATTGGAATCCGAACTGGAAACCACTGAAATTTGAGT
RUNX1 RUNX1T1 AY152459 GTGACATGCTCTAAGTAGGGGAAATCTTCCTTTATATGTGGGCATAGATTTTGATAATTTG
RUNX1 RUNX1T1 AY152460 CTCAGTTGGCGTCTGTGACAGGAGAGATGCCCCCTAGATTTTCCTCCCCCTGATTTCTTC
RUNX1 RUNX1T1 AY152462 GCCACGAATTCCTGGGCTCGAGCAATCCTCCCAGGGCTCACTGTCCATTTCTGTCTGGTGACT
RUNX1 RUNX1T1 AY152463 TGTGTCTGTATGTGTTTACATGCATGCCTGTGTTGGGTTGTCAGAAAACAACTTATGTATTTG
RUNX1 RUNX1T1 AY152464 TTTGCTTTTGTGGGAGCCCAGCATTTTGTTTTTGCTGTGTGTGTGTCCAGGTGTCTGTGTATG
RUNX1 RUNX1T1 AY152465 TCGCTCTGTCGCTCAGGCTGGAGTGCACTGGCATGATGAATATAATCAAGTTCATCAAGAATT
RUNX1 RUNX1T1 AY152467 CAAAATCATTTATTTCTTGGTGAGCCTTCTTTCCATTGTCATAAAACAGTAGCAAATCAAAGG
RUNX1 RUNX1T1 AY152468 TTTTCAGACCTGCCCTCTTCCTGTAACCCATTCCTTTTTTATTATACAATTTGGATGTTAGAG
RUNX1 RUNX1T1 AY152469 CATTCACTTGCATAAATGCATTCATCATGTTGCCGCCCTGGCCGTGTGAGATTGGGCAAATGA
RUNX1 RUNX1T1 AY152470 AAAGGCAGCTCGGGTATCAACGAGATATGCCCATTGATATAAAAGCAAATATACTATGCTGGG
RUNX1 RUNX1T1 AY152471 GTACAATAATCCATAATTTTAATAAGATTATAACATTCGGGGGGCAAATGAGCCTTTTAACTG
RUNX1 RUNX1T1 AY152472 TCTTCTTTACCCCAACTCGTAATGCCAGGCATAAAGACACTCTAATATTTTATTCTGTAGACA
RUNX1 RUNX1T1 AY152473 AAGGCATTGGCACTATCAGAAACAATTTGTAAAGTTTGATCATCAGGAAGCCAAGGATCTATG
RUNX1 RUNX1T1 AY152474 GAAGCTCACCAGATAGGCTGTAGCTACCTTTGTTTTTTGGACAAATACTATCCTTAGAATTCC
RUNX1 RUNX1T1 AY152475 AAATATTATGCCAAAGTATGATGATGATGACTCACTCCAGTGGGCCTATTNTGCTGGGAATAT
RUNX1 RUNX1T1 AY152476 CCACACCAGTGAGGTCAGGATCTAAACAGATCTAAGAATTTGGCTCTATTTTACACTTCTGG
RUNX1 RUNX1T1 D14822 AAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAATCGTACTGAGAAGCACTCCACAATGCCAGACTCACCTGTGGATGTGAAGACGCAATCTAGGCTGACTCCTCCAACAATGCCACCTCCCCCAACTACTCAAGGAGCTCC
RUNX1 RUNX1T1 S45790 GCCCCGAGAACCTCGAAATCGTACTGAGAAGCACTCCACAATGCCAGACTCACCTGTGGATGTGAAGACG
RUNX1 RUNX1T1 Z35296 AAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAATAAACCCCACTTGAAAAACTGAGGTGCTTAAGGAGTAAAATAATATGTTCCTG

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair RUNX1--RUNX1T1 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
LAML AB-2806-03A RUNX1__RUNX1T1 0.56 21:36231771/-1 8:93029591/-1 tier1 In-frame 15182 NA
LAML AB-2819-03A RUNX1__RUNX1T1 0.56 21:36231771/-1 8:93029591/-1 tier1 In-frame 15183 NA
LAML AB-2858-03A RUNX1__RUNX1T1 0.56 21:36231771/-1 8:93029591/-1 tier1 In-frame 15184 NA
LAML AB-2875-03A RUNX1__RUNX1T1 0.56 21:36231771/-1 8:93029591/-1 tier1 In-frame 15185 NA
LAML AB-2886-03A RUNX1__RUNX1T1 0.56 21:36231771/-1 8:93029591/-1 tier1 In-frame 15186 NA
LAML AB-2937-03A RUNX1__RUNX1T1 0.56 21:36231771/-1 8:93029591/-1 tier1 In-frame 15187 NA
LAML AB-2950-03A RUNX1__RUNX1T1 0.56 21:36231771/-1 8:93029591/-1 tier1 In-frame 15188 NA

FusionCancer

Top
The fusion gene pair RUNX1--RUNX1T1 information is available in FusionCancer Database.
Database_IDHead_gene_symbolHead_breakpoint_locationTail_gene_symbolTail_breakpoint_locationCancer_typeSRA
FUSC000021RUNX1chr21:36260986RUNX1T1chr8:92967194Acute myeloid leukemiaSRR449360
FUSC000021RUNX1chr21:36231771RUNX1T1chr8:93029591Acute myeloid leukemiaSRR449360
FUSC000021RUNX1chr21:36231771RUNX1T1chr8:93074937Acute myeloid leukemiaSRR449360
FUSC000021RUNX1chr21:36231770RUNX1T1chr8:93029590Acute myeloid leukemiaSRR449360

ConjoinG

Top
The fusion gene pair RUNX1--RUNX1T1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene RUNX1--RUNX1T1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene RUNX1--RUNX1T1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene RUNX1--RUNX1T1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene RUNX1--RUNX1T1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene RUNX1--RUNX1T1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair RUNX1--RUNX1T1 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene RUNX1--RUNX1T1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene RUNX1--RUNX1T1 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene RUNX1 is a known oncogene according to ONGENE database.


The tail gene RUNX1T1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene RUNX1 is cancer associated according to Bushman Cancer Gene database.


The tail gene RUNX1T1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene RUNX1 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene RUNX1T1 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene RUNX1--RUNX1T1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene RUNX1--RUNX1T1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair RUNX1--RUNX1T1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene RUNX1--RUNX1T1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene RUNX1--RUNX1T1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair RUNX1--RUNX1T1 information is available in Klijn Dataset.

Cell lineGene 5'Gene 3'Read evidenceKinaseChromosome 5'Position 5'Chromosome 3'Position 3'Fusion type DNAFusion type RNAFusion protein lengthTissueKnown Fusion
Kasumi-1RUNX1RUNX1T193N2136231771893029591TranslocinFrame779LymphoidFull fusion known

Fimereli_Dataset

Top
The fusion gene pair RUNX1--RUNX1T1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair RUNX1--RUNX1T1 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene RUNX1--RUNX1T1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair RUNX1--RUNX1T1 information is not available in ChromothripsisDB database.