RUNX1--ETO

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

RUNX1 ETO

COSMIC

The fusion gene pair RUNX1--ETO information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair RUNX1--ETO information is not available in CHIMERKB (CHIMERDB 3.0) database.

ChimerPUB

Top
The fusion gene pair RUNX1--ETO information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
RUNX1_ETOt(8;21) / t(8;21)(q22;q22) / 12381450acute myeloid leukemia;myeloid leukemia;leukemia - - Uncommon chromosome changes may lead to the identification of leukemogenetic factors associated with t(8;21) since the AML1/RUNX1-ETO fusion gene resulting from the translocation is thought to be unable alone to induce leukemia.
RUNX1_ETOt(8;21) / t(8;21) / 24897507acute myeloid leukemia;myeloid leukemia;leukemia - - The RUNX1/ETO (RE) fusion protein, which originates from the t(8;21) chromosomal rearrangement, is one of the most frequent translocation products found in de novo acute myeloid leukemia (AML). /// Activating c-KIT mutations confer oncogenic cooperativity and rescue RUNX1/ETO-induced DNA damage and apoptosis in human primary CD34+ hematopoietic progenitors..
RUNX1_ETOt(8;21) / 16799637leukemia - - The t(8;21) chromosomal translocation that generates the fusion oncoprotein RUNX1-ETO predominates in leukemia patients of the French-American-British (FAB) class M2 subtype. /// "DEP and the HSP90 antagonist 17-allylamino-geldanamycin (17-AAG) both triggered RUNX1-ETO degradation, but without any additive or cooperative effects. " /// "Here, we show that RUNX1-ETO undergoes degradation in response to treatment with histone deacetylase inhibitors, one of which, depsipeptide (DEP), is currently undergoing phase II clinical testing in a variety of malignancies. " /// These compounds induce turnover of RUNX1-ETO without affecting the stability of RUNX1-ETO partner proteins. /// "In addition, RUNX1-ETO physically interacts with heat shock protein 90 (HSP90). " /// DEP treatment interrupts the association of RUNX1-ETO with HSP90 and induces proteasomal degradation of RUNX1-ETO.
RUNX1_ETOt(8;21) / t(8;21) / 25242324- - - Oncogenic transcription factors such as RUNX1/ETO, which is generated by the chromosomal translocation t(8;21), subvert normal blood cell development by impairing differentiation and driving malignant self-renewal. /// Our work demonstrates on a genome-wide level that the extent of impaired myeloid differentiation in t(8;21) is controlled by the dynamic balance between RUNX1/ETO and RUNX1 activities through the repression of transcription factors that drive differentiation. /// "Perturbation of this equilibrium in t(8;21) cells by RUNX1/ETO depletion leads to a global redistribution of transcription factor complexes within preexisting open chromatin, resulting in the formation of a transcriptional network that drives myeloid differentiation. " /// "Here, we use digital footprinting and chromatin immunoprecipitation sequencing (ChIP-seq) to identify the core RUNX1/ETO-responsive transcriptional network of t(8;21) cells. " /// "We show that the transcriptional program underlying leukemic propagation is regulated by a dynamic equilibrium between RUNX1/ETO and RUNX1 complexes, which bind to identical DNA sites in a mutually exclusive fashion. "
RUNX1_ETOt(8;21) / 23616623acute myeloid leukemia;myeloid leukemia;leukemia - - The activation of B-cell-specific genes, such as CD19 and PAX5, is a hallmark of t(8;21) acute myeloid leukemia (AML) which expresses the translocation product RUNX1/ETO. /// "In t(8;21) AML, PAX5 is not directly activated by RUNX1/ETO, but expression requires constitutive mitogen-activated protein (MAP) kinase signaling. "
RUNX1_ETOt(8;21) / t(16;21) / t(3;21) / t(12;21) / 16105753acute myeloid leukemia;myeloid leukemia;leukemia - - Runx1 has been identified in leukemia-associated chromosomal translocations, including t(8;21) (Runx1-ETO/MTG8), t(16;21) (Runx1-MTG16), t(3;21) (Runx1-Evi1), t(12;21) (TEL-Runx1), and t(X;21) (Runx1-Fog2).
RUNX1_ETOt(8;21) / t(8;21) / 23772668acute myeloid leukemia;myeloid leukemia;leukemia - - RUNX1-ETO induces a type I interferon response which negatively effects t(8;21)-induced increased self-renewal and leukemia development.. /// We report here that interferons (IFNs) and IFN-stimulated genes are a group of genes consistently up-regulated by RUNX1-ETO in both human and murine models. /// Addition of exogenous IFN in vitro significantly reduces the increase in self-renewal potential induced by both RUNX1-ETO and its leukemogenic splicing isoform RUNX1-ETO9a. /// "This translocation causes expression of the RUNX1-ETO (AML1-ETO) fusion protein, which cooperates with additional mutations in leukemia development. "
RUNX1_ETOt(8;21) / t(8;21) / 23865046acute myeloid leukemia;myeloid leukemia;leukemia - - Thus, the selective interference with NHR2-mediated oligomerization by peptides represents a challenging but promising strategy for the inhibition of the leukemogenic potential of RUNX1/ETO in t(8;21)-positive leukemia. /// The leukemia-associated fusion protein RUNX1/ETO is generated by the chromosomal translocation t(8;21) which appears in about 12% of all de novo acute myeloid leukemias (AMLs). /// Interference with RUNX1/ETO leukemogenic function by cell-penetrating peptides targeting the NHR2 oligomerization domain.. /// "In previous studies, we have shown that the intracellular expression of peptides containing the NHR2 domain inhibits RUNX1/ETO oligomerization, thereby preventing cell proliferation and inducing differentiation of RUNX1/ETO transformed cells. " /// "Here, we show that introduction of a recombinant TAT-NHR2 fusion polypeptide into the RUNX1/ETO growth-dependent myeloid cell line Kasumi-1 results in decreased cell proliferation and increased numbers of apoptotic cells. " /// Essential for the oncogenic potential of RUNX1/ETO is the oligomerization of the chimeric fusion protein through the nervy homology region 2 (NHR2) within ETO.
RUNX1_ETOt(8;21) / 22343733acute myeloid leukemia;myeloid leukemia;leukemia - - Depletion of RUNX1/ETO in t(8;21) AML cells leads to genome-wide changes in chromatin structure and transcription factor binding.. /// "To obtain insights into RUNX1/ETO-dependant alterations of the epigenetic landscape, we measured genome-wide RUNX1- and RUNX1/ETO-bound regions in t(8;21) cells and assessed to what extent the effects of RUNX1/ETO on the epigenome depend on its continued expression in established leukemic cells. " /// Combined global assessments of chromatin accessibility and kinetic gene expression data show that RUNX1/ETO controls the expression of important regulators of hematopoietic differentiation and self-renewal. /// "To this end, we determined dynamic alterations of histone acetylation, RNA Polymerase II binding and RUNX1 occupancy in the presence or absence of RUNX1/ETO using a knockdown approach. " /// "We show that selective removal of RUNX1/ETO leads to a widespread reversal of epigenetic reprogramming and a genome-wide redistribution of RUNX1 binding, resulting in the inhibition of leukemic proliferation and self-renewal, and the induction of differentiation. " /// This demonstrates that RUNX1/ETO represents a pivotal therapeutic target in AML.. /// The resultant RUNX1/ETO fusion protein is a leukemia-initiating transcription factor that interferes with RUNX1 function.
RUNX1_ETOt(8;21) / t(8;21) / 22031861acute myeloid leukemia;myeloid leukemia;leukemia - - Mechanistically, we further demonstrated that RUNX1-ETO, the t(8;21) fusion product, specifically bound the SFRP1 promoter and repressed its transcription via a consensus RUNX binding site.
RUNX1_ETOt(8;21) / t(8;21) / 24130502acute myeloid leukemia;chronic myeloid leukemia;myeloid leukemia;leukemia - - This identifies KLF6 as a novel mediator of t(8;21) target gene regulation, providing a new mechanism for RUNX1-ETO transcriptional control.. /// " Fusion protein RUNX1-ETO (AML1-ETO, RUNX1-RUNX1T1) is expressed as the result of the 8q22;21q22 translocation [t(8;21)], which is one of the most common chromosomal abnormalities found in acute myeloid leukemia. " /// "Furthermore, KLF6 is specifically upregulated by RUNX1-ETO in human leukemia cells. " /// Mechanisms of RUNX1-ETO target gene upregulation remain less well understood. /// RUNX1-ETO is thought to promote leukemia development through the aberrant regulation of RUNX1 (AML1) target genes.
RUNX1_ETOt(8;21) / inv(16) / inv(16) / 18663147acute myeloid leukemia;myeloid leukemia;leukemia - - We further demonstrated that this RUNX3 repression was mediated not by P2 methylation, but RUNX1-ETO and CBFbeta-MYH11, the fusion products of t(8;21) and inv(16), via a novel transcriptional mechanism that acts directly or indirectly in collaboration with RUNX1, on 2 conserved RUNX binding sites in the P1 promoter. /// "In in vitro studies, ectopically expressed RUNX1-ETO and CBFbeta-MYH11 also inhibited endogenous RUNX3 expression. "
RUNX1_ETOt(8;21) / 20023702- - - We found that OGG1 expression was significantly downregulated by the RUNX1-ETO fusion protein product of the t(8;21) chromosome translocation in normal haematopoietic progenitor cells and in patients with acute myeloid leukaemia (AML).
RUNX1_ETOt(8;21) / 15156180myeloproliferative disorder;leukemia - - RUNX1-ETO) fusion protein, which is found in t(8;21)+ AML. /// "The direct effects of AML1-ETO on human and murine HSCs, and the potentially cooperating events that may contribute to its leukemogenic properties, are discussed.. " /// Effects of the leukemia-associated AML1-ETO protein on hematopoietic stem and progenitor cells.. /// "In this review, we focus on the AML1-ETO (a.k.a. " /// "Expression of AML1-ETO in human hematopoietic stem cells (HSCs) preferentially enhances their maintenance, as opposed to their differentiation. "
RUNX1_ETOt(8;21) / 25867177acute myeloid leukemia;myeloid leukemia;leukemia - - RUNX1/ETO (RE), the t(8;21)-derived leukemic transcription factor associated with acute myeloid leukemia (AML) development, deregulates genes involved in differentiation, self-renewal and proliferation. /// RUNX1/ETO blocks selectin-mediated adhesion via epigenetic silencing of PSGL-1..
RUNX1_ETO- 19386523leukemia - - We also discuss the effect of RUNX1-ETO fusion gene on DNA methylation.
RUNX1_ETOt(8;21) / 17332359acute myeloid leukemia;myeloid leukemia;leukemia - - Targeting the oligomerization domain of ETO interferes with RUNX1/ETO oncogenic activity in t(8;21)-positive leukemic cells.. /// " About 12% of all de novo acute myeloid leukemias are characterized by the translocation t(8;21), which generates the oncogenic fusion protein RUNX1/ETO. " /// "Here, we show that the expression of a fusion peptide consisting of 128 amino acids (NC128), including the entire NHR2 domain of ETO, disrupts the stability of the RUNX1/ETO high molecular weight complexes, restores transcription of RUNX1/ETO target genes, and reverts the differentiation block induced by RUNX1/ETO in myeloid cells. " /// "RUNX1/ETO has a modular structure and contains several docking sites for heterologous proteins, including transcriptional co-repressors like N-CoR, SMART, and mSIN3A. " /// "RUNX1/ETO is found in high molecular weight complexes, which are crucial for the block in myeloid differentiation observed in RUNX1/ETO-transformed cells. " /// "In the presence of NC128, RUNX1/ETO-transformed cells lose their progenitor cell characteristics, are arrested in cell cycle progression, and undergo cell death. " /// Our results indicate that selective interference with the oligomerization domain of ETO could provide a promising strategy to inhibit the oncogenic properties of the leukemia-associated fusion protein RUNX1/ETO..
RUNX1_ETOt(8;21) / 12576332leukemia - - By contrast, RUNX1-ETO inhibition of GATA function may constitute a potential mechanism for the blockade of erythroid and megakaryocytic differentiation seen in leukemias with t(8;21).. /// "By contrast, the RUNX1-ETO leukemic fusion protein potently repressed GATA-1-mediated transactivation. "
RUNX1_ETOt(8;21) / 26018585- - - This is also true for the t(8;21) translocation that gives rise to the RUNX1-ETO fusion protein and initiates the most common form of human AML. /// "Here we study the differentiation of mouse embryonic stem cells expressing an inducible RUNX1-ETO gene into blood cells as a model, combined with genome-wide analyses of transcription factor binding and gene expression. " /// "However, the response of the transcriptional network to RUNX1-ETO expression is developmental stage specific, highlighting the molecular mechanisms determining specific target cell expansion after an oncogenic hit. " /// "RUNX1-ETO interferes with both the activating and repressive function of its normal counterpart, RUNX1, at early and late stages of blood cell development. "
RUNX1_ETOt(8;21) / 20583973acute myeloid leukemia;myeloid leukemia;leukemia - - Among others, the RUNX1/ETO fusion protein, commonly found within acute myeloid leukemia cells carrying the translocation t(8;21), is currently intensively studied at the functional and structural level as well as in animal models. /// Molecular targeting of aberrant transcription factors in leukemia: strategies for RUNX1/ETO.. /// With a special focus on RUNX1/ETO we will discuss recent strategies to directly interfere with aberrant transcription factors to block their leukemogenic function..
RUNX1_ETOt(8;21) / 26060100acute myeloid leukemia;myeloid leukemia;leukemia - - While RUNX1 activates the LIFR general promoter, the oncogenic RUNX1-ETO fusion protein generated by the t(8;21) translocation commonly associated with acute myeloid leukemia represses promoter activity.
RUNX1_ETOt(8;21) / 21937700acute myeloid leukemia;myeloid leukemia;leukemia;sarcoma - - The t(8;21) RUNX1-ETO translocation is one of the most frequent cytogenetic abnormalities in acute myeloid leukemia (AML). /// "In RUNX1-ETO(+) patient samples, differing classes of activating c-KIT receptor tyrosine kinase mutations have been observed. " /// Analysis of reconstituted animals showed that RUNX1-ETO;c-Kit(D814V) coexpression resulted in 3 nonoverlapping phenotypes. /// "In contrast, RUNX1-ETO;c-Kit(T417I?418-419) coexpression promoted exclusively AML in a fraction (51%) of reconstituted mice. " /// "To test whether distinct subtypes of activating c-KIT mutations differ in their leukemogenic potential in association with RUNX1-ETO, we used a retroviral transduction/transplantation model to coexpress RUNX1-ETO with either c-Kit(D814V) or c-Kit(T417I?418-419) in murine hematopoietic stem/progenitor cells used to reconstitute lethally irradiated mice. "
RUNX1_ETOt(8;21) / t(8;21)(q22;q22) / 22461472- - - In this issue of Blood,Matsuura and colleagues provide evidence that loss of GMCSF signaling promotes leukemic progression in association with one of the most frequently observed cytogenetic abnormalities in AML, the t(8;21)(q22;q22) that generates the RUNX1-ETO fusion protein..
RUNX1_ETOt(8;21) / 22613795acute myeloid leukemia;myeloproliferative disorder;myeloid leukemia;leukemia - - Here we show that wild-type MPL expression is increased in a fraction of human AML samples expressing RUNX1-ETO, a fusion protein created by chromosome translocation t(8;21), and that up-regulation of Mpl expression in mice induces AML when coexpressed with RUNX1-ETO. /// Mpl expression is not regulated by RUNX1-ETO in mouse hematopoietic progenitors or leukemic cells. /// Thrombopoietin/MPL participates in initiating and maintaining RUNX1-ETO acute myeloid leukemia via PI3K/AKT signaling..
RUNX1_ETOt(8;21) / t(8;21)(q22;q22) / t(8;21) / 22223820acute myeloid leukemia;myeloid leukemia;leukemia - - In the present study, to evaluate whether LOS cooperates with t(8;21) in leukemogenesis, we first used a retroviral transduction/transplantation model to express RUNX1-ETO in hematopoietic cells from XO mice. /// "To determine whether GM-CSF signaling affects RUNX1-ETO leukemogenesis, hematopoietic stem/progenitor cells that lack GM-CSF signaling were used to express RUNX1-ETO and transplanted into lethally irradiated mice, and a high penetrance of AML was observed in recipients. " /// These results suggest a possible tumor-suppressor role of GM-CSF in RUNX1-ETO leukemia. /// The RUNX1-ETO fusion protein that is expressed by this translocation is poorly leukemogenic and requires additional mutations for transformation.
RUNX1_ETOt(8;21) / 20439113acute myeloid leukemia;myeloid leukemia;leukemia - - For example, the GM-CSF gene is activated by RUNX1, but is repressed by RUNX1-ETO. /// "In contrast, RUNX1-ETO, which cannot associate with CBP, is unable to transactivate the GM-CSF promoter and is associated with the generation of a repressive chromatin environment at the promoter.. " /// The resulting RUNX1-ETO fusion protein contributes to leukemic progression by directing aberrant association of transcriptional cofactors and epigenetic modifiers to RUNX1 target genes.
RUNX1_ETOt(8;21) / 26333776acute myeloid leukemia;myeloid leukemia;leukemia;hematologic malignancy - - Notably, long-term treatment of cells with Wnt3a induces the generation a frequent RUNX1-ETO translocation event.
RUNX1_ETOt(1;21)(p32;q22) / 25798834- - - GSEA analysis confirmed similar altered gene expression patterns in the truncated RUNX1 and RUNX1/ETO models, with both models showing alterations in genes involved in self-renewal and leukemogenesis, including homeobox genes, primitive erythroid genes and leukemogenic transcription factors. /// These effects are similar to but milder than those induced by the RUNX1/ETO fusion protein.
RUNX1_ETOt(8;21) / 22201794acute myeloid leukemia;myeloid leukemia;myelodysplastic syndrome;leukemia - - In this review, we detail the structural features, functions, and models used to study both RUNX1 and RUNX1-ETO in hematopoiesis over the past two decades.. /// RUNX1 and RUNX1-ETO: roles in hematopoiesis and leukemogenesis.. /// The RUNX1-ETO fusion protein is found in approximately 12% of all AML patients.
RUNX1_ETOt(4;21)(q21;q22) / t(4;21) / 22102704myelodysplastic syndrome;hematopoietic malignancy PCR;RT-PCR - More importantly, we explored and confirmed the possibility that this abrogation also prevented transactivation of RUNX1 target genes, perhaps confirming the genetic origin of the thrombocytopenia and the myelodysplastic features observed in our patient, and certainly mimicking what has been observed in the presence of the RUNX1/ETO fusion protein..
RUNX1_ETO- 23054644acute myeloid leukemia;myeloid leukemia;leukemia ISH - The mutations of TP53 and the fusion genes RUNX1/ETO, CBF?/MYH11, and PML/RAR? were all negative.

ChimerSEQ

Top
The fusion gene pair RUNX1--ETO information is not available in CHIMERSEQ (CHIMERDB 3.0) database.

ChiTaRS 2.1

Top
The fusion gene pair RUNX1--ETO information is not available in CHITARS database.

FARE-CAFE

Top
The fusion gene pair RUNX1--ETO information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
RUNX1/AML1-RUNX1T1/ETO Acute myelomonocytic leukemia (FAB type M4) Microscopy,Immunofluorescence t(8;21)(q22;q22) PubMed:10611307

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform1 RUNX1/AML1 _ _ 0 RUNX1T1/ETO _ 0 _ ccccgagaacctcgaaAtcgtactgagaagcact 18206543 _
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform2 RUNX1/AML1 36219615 0 0 RUNX1T1/ETO 93081341 0 0 ACTTTTAGAAATTTTACCTTTTTCCAAAAATAAAAAAATAGGGAATAAATATTGTATAT _ AY152446
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform3 RUNX1/AML1 36219554 0 0 RUNX1T1/ETO 93081251 0 0 TTGAATTTATTTAAAGATATCTGGGATACCCTTTTTAAATGTTGGAAACAAAAGAAGTAA _ AY152447
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform4 RUNX1/AML1 36208088 0 0 RUNX1T1/ETO 93084532 0 0 GAAACATAATAAACCAGATCATAGATCAAGGGGGGGGCAGCGGGCAGGCTGTTTCTCAATCTG _ AY152449
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform5 RUNX1/AML1 36207796 0 0 RUNX1T1/ETO 93075376 0 0 TTGTTTTGGTGAAGAGCATGATGAGGACACTTGCTATAAAAATGTTTGTAGGCTGTTTGGGAT _ AY152450
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform6 RUNX1/AML1 36226510 0 0 RUNX1T1/ETO 93081161 0 0 TATAGCAAACCTATTATATATGTGAACATGAGAAATACTATCCTTAGAATTCCCAGGCTCCA _ AY152452
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform7 RUNX1/AML1 36221920 0 0 RUNX1T1/ETO 93078088 0 0 AGTATGATTGACACATGGTATTACAGCTCCTTTGAATTAACTCACTTAATACCCACTGT _ AY152453
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform8 RUNX1/AML1 36220641 0 0 RUNX1T1/ETO 93077374 0 0 CTGCATGATACCTCTCTTGCTAGGGGATGTTTTTTATGAACGAAAAGTTATTCTGTCTGAGTA _ AY152455
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform9 RUNX1/AML1 36218960 0 0 RUNX1T1/ETO 93079683 0 0 GGCCTGACCTGGTGGAAAGACTGCGGGCCTGCCCGCAGAGTCCATTATTAACTTACTTT _ AY152457
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform10 RUNX1/AML1 36219060 0 0 RUNX1T1/ETO 93079722 0 0 GGAAGTCATTATTTAAAATATTTTAACATTGGAATCCGAACTGGAAACCACTGAAATTTGAGT _ AY152458
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform11 RUNX1/AML1 36218575 0 0 RUNX1T1/ETO 93081728 0 0 GTGACATGCTCTAAGTAGGGGAAATCTTCCTTTATATGTGGGCATAGATTTTGATAATTTG _ AY152459
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform12 RUNX1/AML1 36230217 0 0 RUNX1T1/ETO 93048539 0 0 GACCCTGATTCTTCTTTATGAGTGAAAAGCTTGAGAACACTTTCCTGTATATTTAGACATTTA _ AY152436
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform13 RUNX1/AML1 36217118 0 0 RUNX1T1/ETO 93062402 0 0 CTCAGTTGGCGTCTGTGACAGGAGAGATGCCCCCTAGATTTTCCTCCCCCTGATTTCTTC _ AY152460
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform14 RUNX1/AML1 36216180 0 0 RUNX1T1/ETO 93086005 0 0 GCCACGAATTCCTGGGCTCGAGCAATCCTCCCAGGGCTCACTGTCCATTTCTGTCTGGTGACT _ AY152462
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform15 RUNX1/AML1 36215485 0 0 RUNX1T1/ETO 93077791 0 0 TGTGTCTGTATGTGTTTACATGCATGCCTGTGTTGGGTTGTCAGAAAACAACTTATGTATTTG _ AY152463
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform16 RUNX1/AML1 36215526 0 0 RUNX1T1/ETO 93077765 0 0 TTTGCTTTTGTGGGAGCCCAGCATTTTGTTTTTGCTGTGTGTGTGTCCAGGTGTCTGTGTATG _ AY152464
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform17 RUNX1/AML1 36215355 0 0 RUNX1T1/ETO _ 0 _ TCGCTCTGTCGCTCAGGCTGGAGTGCACTGGCATGATGAATATAATCAAGTTCATCAAGAATT _ AY152465
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform18 RUNX1/AML1 36210978 0 0 RUNX1T1/ETO 93084407 0 0 CAAAATCATTTATTTCTTGGTGAGCCTTCTTTCCATTGTCATAAAACAGTAGCAAATCAAAGG _ AY152467
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform19 RUNX1/AML1 36211518 0 0 RUNX1T1/ETO 93077448 0 0 TTTTCAGACCTGCCCTCTTCCTGTAACCCATTCCTTTTTTATTATACAATTTGGATGTTAGAG _ AY152468
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform20 RUNX1/AML1 36211492 0 0 RUNX1T1/ETO 93077488 0 0 CATTCACTTGCATAAATGCATTCATCATGTTGCCGCCCTGGCCGTGTGAGATTGGGCAAATGA _ AY152469
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform21 RUNX1/AML1 36210493 0 0 RUNX1T1/ETO 93081866 0 0 AAAGGCAGCTCGGGTATCAACGAGATATGCCCATTGATATAAAAGCAAATATACTATGCTGGG _ AY152470
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform22 RUNX1/AML1 36209907 0 0 RUNX1T1/ETO 93082089 0 0 GTACAATAATCCATAATTTTAATAAGATTATAACATTCGGGGGGCAAATGAGCCTTTTAACTG _ AY152471
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform23 RUNX1/AML1 36229644 0 0 RUNX1T1/ETO 93066708 0 0 TATGCTGTGTACCTGTATAAAGAGGTTATTAAACCTCTTGGCAGTCAGAGGGGAAAAAAGATG _ AY152437
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform24 RUNX1/AML1 36208923 0 0 RUNX1T1/ETO 93079808 0 0 TCTTCTTTACCCCAACTCGTAATGCCAGGCATAAAGACACTCTAATATTTTATTCTGTAGACA _ AY152472
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform25 RUNX1/AML1 36208793 1 0 RUNX1T1/ETO 93080031 0 1 AAGGCATTGGCACTATCAGAAACAATTTGTAAAGTTTGATCATCAGGAAGCCAAGGATCTATG _ AY152473
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform26 RUNX1/AML1 36207670 1 0 RUNX1T1/ETO 93081170 0 1 GAAGCTCACCAGATAGGCTGTAGCTACCTTTGTTTTTTGGACAAATACTATCCTTAGAATTCC _ AY152474
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform27 RUNX1/AML1 36207636 1 0 RUNX1T1/ETO 93081215 0 1 AAATATTATGCCAAAGTATGATGATGATGACTCACTCCAGTGGGCCTATTNTGCTGGGAATAT _ AY152475
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform28 RUNX1/AML1 36223971 1 0 RUNX1T1/ETO 93083693 0 1 CCACACCAGTGAGGTCAGGATCTAAACAGATCTAAGAATTTGGCTCTATTTTACACTTCTGG _ AY152476
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform29 RUNX1/AML1 36231871 1 0 RUNX1T1/ETO 93029483 0 1 AAGCTTCACTCTGACCATCACTGTCTTCACAAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAATCGTACTGAGAAGCACTCCACAATGCCAGACTCACCTGTGGATGTGAAGACGCAATCTAGGCTGACTCCTCCAACAATGCCACCTCCCCCAACTACTCAAGGAGCTCC _ D14822
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform30 RUNX1/AML1 _ _ 0 RUNX1T1/ETO 93029539 0 1 GCCCCGAGAACCTCGAAATCGTACTGAGAAGCACTCCACAATGCCAGACTCACCTGTGGATGTGAAGACG _ S45790
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform31 RUNX1/AML1 36231841 1 0 RUNX1T1/ETO 93029606 0 1 AAACCCACCGCAAGTCGCCACCTACCACAGAGCCATCAAAATCACAGTGGATGGGCCCCGAGAACCTCGAAATAAACCCCACTTGAAAAACTGAGGTGCTTAAGGAGTAAAATAATATGTTCCTG _ Z35296
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform32 RUNX1/AML1 36226882 0 0 RUNX1T1/ETO 93076651 0 0 GCTTAACTGTACTGAAATCCATTACAGAGATGAGGTGAAATCTCACTCTGTTGCCCATGCTGG _ AY152439
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform33 RUNX1/AML1 36223916 0 0 RUNX1T1/ETO 93077547 0 0 ATTGTATGACATGCCATAAGAAAAAAAAAACCCGGACTATGACAGTGTTTTGTACTGGAGAAC _ AY152440
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform34 RUNX1/AML1 36223989 0 0 RUNX1T1/ETO _ 0 _ GGGATATATTCTAGTTTTATAAAATATGATATCACTAATTTGAATGCCACACCAGTGAGGTC _ AY152441
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform35 RUNX1/AML1 36223751 0 0 RUNX1T1/ETO 93086232 0 0 TACTTTCATCTTCATTTTCCTCTCCTGTGAGACCTTGTTTTCCATGTGGCATTAAAAATTTA _ AY152442
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform36 RUNX1/AML1 36223679 0 0 RUNX1T1/ETO 93086320 0 0 GTATGTGTGGTGTGTGTACATACTTTAAACATAGCAAAAAGGGTAACAAAATATGGTCAGC _ AY152443
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform37 RUNX1/AML1 36223198 0 0 RUNX1T1/ETO 93079695 0 0 CTTGAAATCCTTCTGGAAATGAGAAAACTTTAGAAAGTACAGTCGTAGAGTCCATTA _ AY152444

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform1 - - - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) Runt
2) RunxI
3) TAFH
4) NHR2
5) zf-MYND
1) Runt , CBF_beta
2) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform2 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform3 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform4 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform5 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform6 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform7 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform8 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform9 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform10 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform11 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform12 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform13 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform14 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform15 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform16 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform17 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform18 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform19 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform20 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform21 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform22 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform23 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform24 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform25 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform26 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform27 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform28 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform29 1) Runt
2) RunxI
1) Runt , CBF_beta
- -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform30 - - - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) Runt
2) RunxI
3) TAFH
4) NHR2
5) zf-MYND
1) Runt , CBF_beta
2) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform31 1) Runt
2) RunxI
1) Runt , CBF_beta
- -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform32 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform33 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform34 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform35 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform36 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
RUNX1/AML1-RUNX1T1/ETO RUNX1/AML1-RUNX1T1/ETO-Isoform37 1) RunxI
- - -RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
RUNX1T1/ETO 1) TAFH
2) NHR2
3) zf-MYND
1) NHR2
1) TAFH
2) NHR2
3) zf-MYND
1) NHR2

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
RUNX1/AML1-RUNX1T1/ETO hsa-miR-106b-5phsa-miR-183-5phsa-miR-103a-3phsa-miR-16-5phsa-let-7e-5p hsa-miR-27a-3phsa-miR-17-5phsa-miR-20a-5phsa-miR-106a-5phsa-miR-423-5p Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
RUNX1/AML1-RUNX1T1/ETO NM_001001890.2 1) MITF_HUMAN
2) HIF1A_HUMAN
3) STAT1_HUMAN
4) RB1_HUMAN
5) RBL2_HUMAN
6) ZNF263_HUMAN
7) E2F4_HUMAN
8) P53_HUMAN
9) RUNX1_HUMAN
10) PRDM14_HUMAN
11) ESTROGEN RECEPTOR ALPHA_HUMAN
12) ETS1_HUMAN
13) EGR1_HUMAN
14) FOS_HUMAN
15) GATA2_HUMAN
16) GATA3_HUMAN
17) E2F1_HUMAN
18) SOX2_HUMAN
19) TAL1_HUMAN
20) CTCF_HUMAN
21) BRG1_HUMAN
22) HNF4A_HUMAN
23) TFAP2C_HUMAN
24) FOXA1_HUMAN
25) CEBPA_HUMAN A
26) STAT6_HUMAN A
27) ESR1_HUMAN A
28) ESR2_HUMAN A
29) AR_HUMAN A
30) MEIS1_HUMAN A
31) FOXP1_HUMAN A
32) NR1H3_HUMAN A
33) SETDB1_HUMAN A
34) SPI1_HUMAN A
35) TAL1_HUMAN A
36) TRIM24_HUMAN A
37) VDR_HUMAN
- 1) 21258399
2) 19828020
3) 19122651
4) 20385362
5) 20385362
6) 19887448
7) 21247883
8) 21394211
9) 20019798
10) 20953172
11) 20547749
12) 20019798
13) 20690147
14) 20139302
15) 21808000
16) 21878914
17) 21310950
18) 21211035
19) 21795385
20) 21795385
21) 19505939
22) 21646355
23) 21572391
24) 21572391
25) 20219941 A
26) 21828071 A
27) 20348243 A
28) 21235772 A
29) 21572438 A
30) 21241896 A
31) 21924763 A
32) 22292898 A
33) 21430779 A
34) 21241896 A
35) 21241896 A
36) 21164480 A
37) 21846776

TicDB

Top
The fusion gene pair RUNX1--ETO information is not available in TicDB.

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair RUNX1--ETO information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair RUNX1--ETO information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair RUNX1--ETO information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene RUNX1--ETO has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene RUNX1--ETO is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene RUNX1--ETO is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene RUNX1--ETO is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene RUNX1--ETO was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair RUNX1--ETO information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene RUNX1--ETO is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene RUNX1--ETO has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene RUNX1 is a known oncogene according to ONGENE database.


The tail gene ETO is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene RUNX1 is cancer associated according to Bushman Cancer Gene database.


The tail gene ETO is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene RUNX1 is proto-oncogene or tumor suppresor gene according to Uniprot database.
The tail gene ETO is not a proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene RUNX1--ETO is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene RUNX1--ETO is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair RUNX1--ETO information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene RUNX1--ETO is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene RUNX1--ETO has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair RUNX1--ETO information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair RUNX1--ETO information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair RUNX1--ETO information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene RUNX1--ETO is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair RUNX1--ETO information is not available in ChromothripsisDB database.