RET--NCOA4

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

RET NCOA4

COSMIC

The fusion gene pair RET--NCOA4 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair RET--NCOA4 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
RET_NCOA4-/2271/ -/1015-490/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
RET_NCOA4-/2368+?/ -/871-?/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
RET_NCOA4-/2368+?/ -/1015/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
RET_NCOA4-/-/ -/-/ - hg19 thyroid carcinoma - 8806700 Oncogene; Cosmic_nonrecurrent
RET_NCOA4-/-/ -/-/ - hg19 papillary thyroid carcinoma - 9482114 Oncogene; Cosmic_nonrecurrent
RET_NCOA4-/-/ -/-/ - hg19 papillary thyroid cancer - 8806699 Oncogene; Cosmic_nonrecurrent

ChimerPUB

Top
The fusion gene pair RET--NCOA4 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
RET_NCOA4- 25407564- FISH - RET/PTC rearrangement was detected using either RET break-apart FISH followed by multicolor FISH to confirm CCDC6/RET or NCOA4/RET fusions, or by multiplex qPCR to detect 14 RET/PTC subtypes with simultaneous RET mRNA expression. /// "Among 73 PTC patients with sufficient tissue available for FISH and multiplex qPCR, 10 cases were defined as RET/PTC positive by both assays, including eight CCDC6/RET and two NCOA4/RET fusions with relatively high RET mRNA. "
RET_NCOA4- 26660078colorectal cancer FISH - Three RTK fusions were identified: NCOA4-RET, ERBB2-GRB7, and ETV6-NTRK3.
RET_NCOA4- 26187428non small cell lung cancer;lung cancer - - Furthermore analysis of the clinical database revealed one additional NCOA4-RET rearrangement co-existing with activated EGFR mutation in an EGFR-mutated NSCLC patient who had progressed on afatinib.
RET_NCOA4- 23150706non small cell lung cancer;lung cancer;adenocarc PCR;ISH - Of the 13 patients, nine patients had KIF5B-RET, three patients had CCDC6-RET, and one patient had a novel NCOA4-RET fusion.

ChimerSEQ

Top
The fusion gene pair RET--NCOA4 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
RET_NCOA4chr10/43610184/+ chr10/51584616/+ 10q11.21 10q11.23 Exonic hg19 In-frame Intra-chr THCA TCGA-CE-A482-01A Oncogene; PRADA

ChiTaRS 2.1

Top
The fusion gene pair RET--NCOA4 information is not available in CHITARS database.

FARE-CAFE

Top
The fusion gene pair RET--NCOA4 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
RET-NCOA4 Papillary thyroid carcinomas PCR,DNA sequencing,Southern blot,Northernblot _ PubMed: 11318605

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
RET-NCOA4 RET-NCOA4-Isoform1 RET 43610594 0 1 NCOA4 _ 1 _ TCCTGGCCAGGCAGGCCTCTGCCCTCTCCTGGTGGTGGCCGGGCCGGGCGTGGTGGCTCACGCCTGTAATCCCA _ S74825
RET-NCOA4 RET-NCOA4-Isoform2 RET 43610087 1 1 NCOA4 51584126 1 0 ACCCATCTCCTCAGCTGAGATGACCTTCCGGAGGCCCGCTGTAAAGGCATATTACACCCTTTTCTATCAGATAAGAGTA _ S83049
RET-NCOA4 RET-NCOA4-Isoform3 RET __ __ 1 NCOA4 51583077 1 0 _ _ _
RET-NCOA4 RET-NCOA4-Isoform4 RET 43611450 0 1 NCOA4 __ 1 __ _ _ _
RET-NCOA4 RET-NCOA4-Isoform5 RET 43610601 0 1 NCOA4 __ 1 __ _ _ _
RET-NCOA4 RET-NCOA4-Isoform6 RET __ 1 NCOA4 51583925 1 0 _ _ _
RET-NCOA4 RET-NCOA4-Isoform7 RET 43610623 0 1 NCOA4 51583987 1 0 _ _ _
RET-NCOA4 RET-NCOA4-Isoform8 RET 43610939 0 1 NCOA4 51584075 1 0 _ _ _
RET-NCOA4 RET-NCOA4-Isoform9 RET 43611460 0 1 NCOA4 5228215 1 __ _ _ _
RET-NCOA4 RET-NCOA4-Isoform10 RET 43611332 0 1 NCOA4 __ 1 __ _ _ _
RET-NCOA4 RET-NCOA4-Isoform11 RET 43610922 0 1 NCOA4 __ 1 __ _ _ _
RET-NCOA4 RET-NCOA4-Isoform12 RET 43611518 0 1 NCOA4 __ 1 __ _ _ _
RET-NCOA4 RET-NCOA4-Isoform13 RET 43610305 0 1 NCOA4 51584462 1 0 _ _ _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
RET-NCOA4 RET-NCOA4-Isoform1 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
- -RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
2) ARA70
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform2 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
- -RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
2) ARA70
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform3 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
- -RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
2) ARA70
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform4 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
- -RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
2) ARA70
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform5 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform6 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform7 - - 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform8 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
- -RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
2) ARA70
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform9 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
- -RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
2) ARA70
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform10 - - 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform11 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform12 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
RET-NCOA4 RET-NCOA4-Isoform13 1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
- -RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
- 1) Pkinase_Tyr
2) ARA70
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
RET-NCOA4 hsa-miR-93-3phsa-miR-484hsa-miR-365a-3p hsa-miR-31-5phsa-miR-29a-3phsa-miR-215-5phsa-miR-192-5p NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
RET-NCOA4 NM_020630.4 1) SOX10_HUMAN
2) TRIM28_HUMAN
3) MITF_HUMAN
4) STAT1_HUMAN
5) ZNF263_HUMAN
6) P53_HUMAN
7) ESTROGEN RECEPTOR ALPHA_HUMAN
8) EGR1_HUMAN
9) FOS_HUMAN
10) CTCF_HUMAN
11) BRG1_HUMAN
12) TFAP2C_HUMAN
13) FOXA1_HUMAN
14) ESR1_HUMAN
15) ESR2_HUMAN
16) FOXP1_HUMAN
17) SPI1_HUMAN
- 1) 11032856
2) 17542650
3) 21258399
4) 19122651
5) 19887448
6) 21394211
7) 20547749
8) 20690147
9) 20139302
10) 21795385
11) 19505939
12) 21572391
13) 21572391
14) 20348243
15) 21235772
16) 21924763
17) 21241896

TicDB

Top
The fusion gene pair RET--NCOA4 information is not available in TicDB.

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair RET--NCOA4 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
THCA CE-A482-01A RET__NCOA4 0.22 10:43610184/1 10:51584616/1 tier1 In-frame 14569 NA

FusionCancer

Top
The fusion gene pair RET--NCOA4 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair RET--NCOA4 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene RET--NCOA4 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene RET--NCOA4 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene RET--NCOA4 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene RET--NCOA4 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene RET--NCOA4 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair RET--NCOA4 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene RET--NCOA4 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene RET--NCOA4 has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene RET is a known oncogene according to ONGENE database.


The tail gene NCOA4 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene RET is cancer associated according to Bushman Cancer Gene database.


The tail gene NCOA4 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene RET is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene NCOA4 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene RET--NCOA4 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene RET--NCOA4 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair RET--NCOA4 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene RET--NCOA4 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene RET--NCOA4 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair RET--NCOA4 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair RET--NCOA4 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair RET--NCOA4 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene RET--NCOA4 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair RET--NCOA4 information is not available in ChromothripsisDB database.