RARA--PML

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

RARA PML

COSMIC

The fusion gene pair RARA--PML information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair RARA--PML information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
RARA_PML-/-/ -/-/ - hg18 acute promyelocytic leukemia - 2170850 Oncogene; Receptor; Transcription_Factor OMIM
RARA_PML-/-/ -/-/ - hg18 promyelocytic leukemia - 8180390 Oncogene; Receptor; Transcription_Factor OMIM

ChimerPUB

Top
The fusion gene pair RARA--PML information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
RARA_PMLt(15;17) / t(15;17)(q22;q12) / 9276968acute promyelocytic leukemia;leukemia FISH - Identification of classic and complex t(15;17) and/or RAR alpha/PML gene fusion in APL by cytogenetic and dual color-FISH techniques.. /// "In this study, t(15;17) was identified cytogenetically by using the conventional cytogenetic technique, and its molecular counterpart RAR alpha/PML fusion on chromosome 17 on interphase nuclei was further confirmed by means of dual color- (DC-) fluorescence in situ hybridization (FISH) on serial bone marrow (BM) and peripheral blood (PB) samples from APL patients at different stages of the disease. " /// "Overall, our findings indicate that interphase DC-FISH analysis can be a useful technique as an adjunct to conventional cytogenetic investigation for detecting the presence of RAR alpha/PML fusion in APL.. "
RARA_PMLt(17;20)(q21;q12) / t(15;17)(q22;q21) / t(15;17) / 16772124acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - Acute promyelocytic leukemia (APL) is genetically characterized by a reciprocal translocation between chromosomes 15 and 17, the t(15;17)(q22;q21), which results in the fusion gene PML/RARA.
RARA_PMLt(12;15;17)(q24;q24;q11) / t(15;17)(q22;q21) / t(15;17)(q24;q11) / t(15;17) / 23292868acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - Acute promyelocytic leukemia (APL) is genetically characterized by a reciprocal translocation between chromosomes 15 and 17, t(15;17)(q22;q21), which results in the fusion gene PML-RARA. /// A PML/RARA chimeric gene on chromosome 12 in a patient with acute promyelocytic leukemia (M4) associated with a new variant translocation: t(12;15;17)(q24;q24;q11).. /// "This karyotypic interpretation was confirmed by FISH with the use of painting probes of chromosomes 12, 15, and 17 and a PML-RARA dual-color DNA probe. " /// PML-RARA transcripts were not evident on RT-PCR.
RARA_PMLt(15;17)(q22;q11) / t(1;9)(q25;q34) / t(9;17;15)(q34;q11;q22) / t(15;17) / 9096691acute promyelocytic leukemia;leukemia FISH - Variant complex translocations involving chromosomes 1, 9, 9, 15 and 17 in acute promyelocytic leukemia without RAR alpha/PML gene fusion rearrangement.. /// " Acute promyelocytic leukemia (APL;M3) is specifically characterized by a predominance of malignant promyelocytes having atypical reciprocal translocation involving chromosome 15 and 17 [t(15;17)(q22;q11)] resulting in the fusion of retinoic acid receptor alpha (RAR alpha) on chromosome 17 and the putative transcription factor gene PML, ie the translocation generates two fusion transcripts, PML/RAR alpha and RAR alpha/PML. " /// "However, chromosome 15q including the PML gene normally translocating to 17q and creating the RAR alpha/PML fusion gene, translocated to chromosome 9q. "
RARA_PMLt(15;17) / t(15;17)(q22;q21) / 12935927acute promyelocytic leukemia;leukemia FISH - This method uses a commercially available product with two different colored fluorescent probes to detect both PML/RARA gene fusion products (double fusion signal or dual-color fluorescence in situ hybridization [D-FISH]).
RARA_PMLt(15;17) / 7967757acute promyelocytic leukemia;leukemia FISH - Efficacy of fluorescence in situ hybridization for detecting PML/RARA gene fusion in treated and untreated acute promyelocytic leukemia..
RARA_PML- 12505266acute promyelocytic leukemia;leukemia FISH;PCR - Usually the gene fusion PML/RARA is located on chromosome 15. /// Cryptic translocation of PML/RARA on 17q. /// PCR showed a typical PML/RARA rearrangement in exon 1. /// "This case adds further information on alternative ways of rearrangement of the PML/RARA genes, possibly correlated with all-trans retinoic acid resistance.. "
RARA_PMLt(15;17) / t(15;17) / 15771903acute promyelocytic leukemia;leukemia FISH - Interphase FISH demonstrated that the fusion gene (PML/RARA) was present in almost all abnormal promyelocytes.
RARA_PMLt(15;17) / 12550769acute promyelocytic leukemia;leukemia FISH - We used RARA FISH at the initial diagnosis (16 cases) and follow-up of APL patients (21 cases) with t(15;17), though RARA FISH was originally designed to detect translocations involving the RARA gene rather than t(15;17), and compared the results with those of PML/RARA FISH. /// "In conclusion, we believe that once the PML/RARA rearrangement is confirmed either by G-banding or FISH, RARA FISH is more effective than PML/RARA during the follow-up of APL after treatment.. " /// "Although PML/RARA fluorescence in situ hybridization (FISH) can help, the major drawback of FISH is its high false positive rate, which reaches up to 5-10%. " /// "By conducting RARA FISH, we were able to significantly resolve the difficulty in interpreting results around cut-off value in PML/RARA FISH. " /// A reference range for PML/RARA and RARA FISH was set using 50 normal control specimens. /// "Using a RARA split probe, we were able to lower the reference range for RARA rearrangement down to 1.5%, which is significantly lower than that of PML/RARA (8%). " /// "Actually 74.2% (46/62 cases) of cases with positive signals of the PML/RARA rearrangement by the PML/RARA probe, showed absolutely negative results with the RARA split probe. " /// RARA fluorescence in situ hybridization overcomes the drawback of PML/RARA fluorescence in situ hybridization in follow-up of acute promyelocytic leukemia..
RARA_PMLt(15;17) / 21156244acute promyelocytic leukemia;leukemia FISH;PCR - Although a normal karyotype according to conventional cytogenetic analysis in association with cryptic t(15;17) has been infrequently reported in cases of acute promyelocytic leukemia (APL), a fluorescence in situ hybridization (FISH)-negative cryptic PML-RARA rearrangement is even more rare, with only 12 such APL cases of FISH-negative cryptic PML-RARA rearrangements in the literature. /// "Reported here is an additional clinical APL case with a FISH-negative cryptic PML-RARA rearrangement, confirmed by long-distance DNA polymerase chain reaction method. " /// FISH-negative cryptic PML-RARA rearrangement detected by long-distance polymerase chain reaction and sequencing analyses: a case study and review of the literature..
RARA_PMLt(15;17) / t(15;17) / 19893344acute promyelocytic leukemia;leukemia FISH;PCR - [Detection of PML/RARA rearrangement by reverse transcriptase-PCR and sequencing in a case of microgranular acute promyelocytic leukemia lacking t(15;17) on karyotype and FISH]..
RARA_PMLt(15;17) / t(15;17) (q22;q12) / 16797070acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - Identification of PML-RARA rearrangement by RT-PCR and sequencing in an acute promyelocytic leukemia without t(15;17) on G-banding and FISH.. /// "t(15;17) was not evident on FISH tests, while RT-PCR and cDNA sequencing revealed the presence of PML-RARA transcripts.. "
RARA_PMLt(15;17) / 15943185acute promyelocytic leukemia;leukemia FISH - We describe an unusual case of acute promyelocytic leukemia with +der(17)t(15;17) as the additional cytogenetic abnormality and with t(15;17) defined by fluorescence in situ hybridization (FISH) using a PML/RARA dual color, dual fusion translocation probe. /// "By performing a step-by-step, complementary approach to evaluate unusual chromosomal abnormalities, we detected RARA/PML fusion on a marker chromosome similar to chromosome 17.. "
RARA_PMLt(15;17) / t(15;17)(q22;q21) / t(15;17) / 26469919acute promyelocytic leukemia;leukemia FISH - He was diagnosed as low-risk APL according to the 2012 NCCN guideline on APL, with the expression of PML-RARA (bcr3 subtype) and the karyotype of 46,XY, der(15)t(15;17)(q22;q21),ider(17)(q10)t(15;17), which was further verified by FISH.
RARA_PMLt(15;17) / t(15;17) / 8111743acute promyelocytic leukemia;leukemia FISH - Fluorescence in situ hybridization (FISH) provides a sensitive and effective approach in identifying the RAR-alpha/PML fusion event in acute promyelocytic leukemia (APL) with the t(15;17). /// In the present study we describe the use of this assay for the identification of the RAR-alpha/PML fusion in bone marrow (BM) cells from three APL patients with complex t(15;17) translocations..
RARA_PMLt(15;17) / 22535601acute promyelocytic leukemia;leukemia FISH;PCR - Apart from a well-known FC pattern of hypergranular APL, we presented less common immunophenotypic variants of APL, which helps to identify an additional group of patients who would benefit from fast confirmatory FISH and/or PCR testing for t(15;17)/PML-RARA.. /// " A total of 97 acute promyelocytic leukemia (APL) patients with adequate flow cytometry (FC) data, bone marrow aspirates and presence of t(15;17)/PML-RARA by cytogenetics and/or FISH studies were analyzed for immunophenotypic pattern. "
RARA_PMLt(15;17) / 26823883acute promyelocytic leukemia;leukemia FISH - Isochromosome 17 in APL which usually bears an additional copy of RARA/PML fusion gene is considered to be a negative factor on its prognosis. /// Cryptic t(15;17) on i(17q) leads to an extra copy of PML/RARA rather than RARA/PML which may confer a worse prognosis.
RARA_PMLt(15;17)(q22;q21) / t(15;17) / t(11;17)(q23;q21) / t(11;17)(q13;q21) / t(2;17)(p21;q21) / 22090713acute promyelocytic leukemia;leukemia FISH - Among the complex variants of t(15;17), PML-RARA fusion followed by residual RARA insertion closed to PML-RARA on der(15) was unique and unusual. /// Forty cases (20%) had atypical PML-RARA and/or RARA variants. /// D-FISH with PML/RARA probe helped identification of RARA insertion to PML.
RARA_PMLdel(7q) / 15193435acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia;hematologic malignancy FISH - The genetic changes with especially large discrepancy rates at diagnosis were del(7q) (20.0%), PML/RARA (17.6%), and trisomy 21 (12.5%) and, at follow-up, BCR/ABL (28.2%) and AML1/ETO (24.4%).
RARA_PMLt(15;17) / t(15;17)(q22;q21) / 12885462acute myeloid leukemia;acute promyelocytic leukemia;leukemia FISH - Tetraploid acute promyelocytic leukemia with double t(15;17) and PML/RARA rearrangements detected by fluorescence in situ hybridization analysis.. /// "This report presents a unique case of APL with a tetraploid clone characterized by two t(15;17) without other chromosomal changes, as well as PML/RARA rearrangements confirmed fluorescence in situ hybridization. "
RARA_PMLt(1;17) / t(15;17)(q22;q21) / t(15;17) / 9266946- FISH - Acute promyelocytic leukaemia (APL) is characterized by t(15;17)(q22;q21) which results in the formation of two chimaeric genes, PML/RAR alpha and RAR alpha/PML, thought to play a role in leukaemogenesis.
RARA_PMLt(9;22) / t(15;17) / 19189637- FISH - Identification of parental chromosomes involved in translocations BCR-ABL, t(9;22) and PML-RARA, t(15;17).. /// "In this mini-review, we present our observations from specimens with translocations BCR-ABL, t(9;22) and PML-RARA, t(15;17). " /// In cases of translocation PML-RARA only 4 out of 21 (19.1%) specimens indicated an intragenomic involvement.
RARA_PMLt(15;17) / t(15;17) / 18328952acute promyelocytic leukemia;leukemia FISH - A PML/RARA dual-fusion probe did not reveal the RARA-PML fusion signal on the der(17q), usually detected in the typical t(15;17). /// Reverse transcriptase-polymerase chain reaction confirmed the absence of the fusion RARA-PML transcript.
RARA_PMLt(11;13)(q23;q14) / t(8;21)(q22;q22) / t(9;22)(q34;q11) / t(15;17)(q22;q11) / inv(16) (p13q22) / 15041229acute myeloid leukemia FISH - Reverse transcriptase polymerase chain reaction showed no concomitant positivity of AML1/ETO, BCR/ABL, PML/RARA, and CBFbeta/MYH11 resulting from t(8;21)(q22;q22), t(9;22)(q34;q11), t(15;17)(q22;q11), and inv(16) (p13q22), respectively.
RARA_PMLt(15;17) / t(8;21) / inv(16) / 19959801acute myeloid leukemia;myeloid leukemia;leukemia FISH - Karyotype and array technology represent genome-wide screens, whereas the other methods target specific prognostic features such as t(15;17) PML-RARA, t(8;21) RUNX1-RUNX1T1, inv(16) CBFB-MYH11, 11q23 MLL rearrangement, FLT3 internal tandem duplication, or NPM1 mutation.
RARA_PMLdel(9)(q22) / t(15;17) / t(15;17) / t(8;21) / 10484977acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia FISH - FISH with cosmid DNA probes flanking the breakpoints of t(15;17) did not show the retinoic acid receptor alpha (RAR alpha)/PML fusion signal usually generated on the der(17) t(15;17).
RARA_PMLt(15;17) / 17375301acute myeloid leukemia;acute lymphoblastic leukemia;myeloid leukemia; FISH - For some leukemia subtypes such as AML M3/M3v with t(15;17)/PML-RARA or Philadelphia-positive ALL targeted therapy options are available.
RARA_PMLt(2;15;17)(q21;q22;q21) / 10913680acute promyelocytic leukemia;leukemia FISH - A PML/RARA chimeric gene on chromosome 2 in a patient with acute promyelocytic leukemia (M3) associated with a new variant translocation: t(2;15;17)(q21;q22;q21).. /// "The karyotypic interpretation was confirmed by fluorescence in situ hybridization (FISH) with the use of painting probes of chromosomes 2, 15, and 17 and a PML/RARA dual color DNA probe. " /// "These results suggest that the critical event in the development of APL is the formation of a PML/RARA chimeric gene, regardless of its locus in the genome.. "
RARA_PMLt(15;17) / 23370423acute promyelocytic leukemia;leukemia FISH - Rare reports of FISH-negative APL harboring cryptic rearrangements of PML-RARA detected by reverse transcriptase polymerase chain reaction or sequencing have been described. /// Modified array-based comparative genomic hybridization detects cryptic and variant PML-RARA rearrangements in acute promyelocytic leukemia lacking classic translocations.. /// PML-RARA translocations were identified by tCGH in both cases providing confirmation of the diagnosis of APL. /// These data emphasize the benefit of using complementary molecular methods including tCGH for detecting cryptic and variant PML-RARA translocations in unusual cases of APL.. /// "Here, we describe the detection of cryptic or variant PML-RARA rearrangements by translocation-based comparative genomic hybridization (tCGH), a recently described modification of traditional CGH technology that facilitates the detection of balanced translocations by means of the linear amplification of a potential translocation breakpoint region(s), in 2 unusual cases of APL. "
RARA_PMLdel(20q) / del(20)(q11.2) / 23130347acute myeloid leukemia;myeloid leukemia;leukemia FISH - Using FISH, other rearrangements such as BCR/ABL1, RUNX1/RUNX1T1, PML/RARA, CBFB/MYH11, and MLL were found to be negative.
RARA_PMLt(5;14)(q33;q32) / 25606057acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;myelodysplastic syndrome;leukemia FISH;PCR;RT-PCR - Break-apart FISH analysis demonstrated that rearrangement of PDGFRB at 5q33 was positive in 460 of 500 cells analyzed, while the PML-RARA rearrangement remained undetectable by RT-PCR.
RARA_PMLt(15;17) / 23607089- FISH - Given the need for rapid diagnosis of APL, it is important to be aware of the false negative rate for large PML/RARA FISH probes in the setting of masked rearrangements..
RARA_PMLt(9;22) / t(15;17) / t(15;17) / 11750052chronic myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia FISH - In these patients FISH could efficiently detect 1-14.5% of residual cells with PML-RARA (patients mean MRD 5%, controls mean MRD 3.5%, P=.02). /// "On the contrary, 5 of 7 patients with either absence or low percentage of PML-RARA positive cells remained in complete remission for 11-24 months. "
RARA_PMLt(15;17)(q22;q12) / t(15;17) / t(15;17) / 9792295- FISH - Morphologically identified myeloblasts were relocated on the smear after FISH and were found to be PML/RARA positive in 91%, abnormal promyelocytes in 97%. /// HLA-DR-positive cells contained a PML/RARA rearrangement in 24% of cells in one case and were negative in the two other cases investigated. /// "Erythroblasts, lymphocytes and plasma cells did not show a PML/RARA rearrangement. " /// "Accordingly, all cells expressing CD3 or CD19 were PML/RARA negative. " /// CD34 positive precursor cells identified by FICTION were PML/RARA positive in 97%. /// The low proportion of PML/RARA-positive PMN points to the impairment of blast cell differentiation beyond the promyelocyte stage but also emphasizes the existence of normal residual haemopoietic stem cells from which PML/RARA-negative PMN must be derived..
RARA_PMLt(15;17) / t(15;17) / 15036889acute myeloid leukemia;acute promyelocytic leukemia;leukemia FISH - however, a promyelocytic leukemia-retinoic acid receptor alpha (PML/RARA) fusion transcript of the bcr3-type was detected with reverse transcriptase-polymerase chain reaction analysis, and a single PML/RARA fusion signal was observed with fluorescence in situ hybridization analysis.
RARA_PMLt(15;17)(q22;q21) / t(15;17) / 10564584acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - The clinical and hematological profiles expressed by the two patients carrying these unexpected types of PML/RARA rearrangement did not differ significantly from that commonly seen in other APLs with the exception of the poor outcome. /// "In patient 1, RT-PCR analysis of the reciprocal RARA/PML junction showed a smaller transcript than that expected in bcr1 cases, while in patient 2 no amplified fragment was obtained. " /// " In the present article, two new types of PML/RARA junctions are described. " /// "By using different sets of primers, reverse transcriptase polymerase chain reaction (RT-PCR) of PML/RARA junctions showed atypical larger bands compared with those generated from the three classical PML breakpoints already described. "
RARA_PMLt(2;11)(q37;q23) / 19445675acute myeloid leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - Cytogenetics, fluorescence in situ hybridization (FISH) and molecular studies (RT-PCR, qRT-PCR and qMSP) were used to characterize 58 acute myeloid leukemia patients (AML) at diagnosis selected to represent the major AML genetic subgroups: CBFB-MYH11 (n = 13), PML-RARA (n = 12).
RARA_PMLt(15;17) / 25639817acute promyelocytic leukemia;leukemia FISH - The aim of this project was to validate earlier time frames for the Abbott Molecular Vysis LSI promyelocytic leukemia (PML)/ retinoic acid receptor alpha (RARA) fluorescence in situ hybridization (FISH) probe (ASR 6-16 h).
RARA_PMLt(8;16) / inv(11) / 15899384acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - One year later, while PML-RARA negative on FISH and RT-PCR, the patient presented with thrombocytopenia. /// FISH using dual-color translocation probes for PML (promyelocytic leukemia) and RARA (retinoic acid receptor-alpha) showed fusion signal for PML-RARA on both arms of i(17q). /// The patient attained complete remission (CR) with all-trans retinoic acid treatment and became PML-RARA negative.
RARA_PMLt(15;17)(q22;q12) / t(15;17) / 22982005acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - A dual color dual fusion PML-RARA FISH probe set identified a small, extra PML signal in a chromosome other than 15 or 17. /// "Microarray, gene sequencing, and reverse transcriptase-polymerase chain reaction analyses of a cryptic PML-RARA translocation.. "
RARA_PML- 24561214acute promyelocytic leukemia;leukemia FISH;PCR - Cytogenetically cryptic and FISH-negative PML/RARA rearrangement in acute promyelocytic leukemia detected only by PCR: an exceedingly rare phenomenon..
RARA_PML- 21120205hematologic malignancy;hematologic malignancy FISH - Interphase FISH was performed using the following probes: BCR/ABL1, AML1/ETO, PML/RARA, CBFB, MLL, EGR1, CEP8, and D7S486 for AML.
RARA_PML- 8956873acute promyelocytic leukemia;leukemia FISH - GTL-banding and FISH with probes for PML, RARA and chromosome 15 specific paint raise the possibility of PML-RARA fusion on the abnormal chromosome 19 in the complex translocation. /// "RARA-PML fusion was not evident by FISH, but the RARA signal was split in 74.5% of cells. "
RARA_PMLdel(11)(q21q23) / p22;q23q23 / 15188459hematologic malignancy FISH;PCR;RT-PCR - Alternate and cytogenetically undetectable mechanisms of fusion transcript generation have been documented for BCR-AB1, AML1-ETO, PML-RARA, NPM/ALK, and MLL-MLLT2 (AF4).
RARA_PMLt(15;17;17)(q22;q23;q21) / t(15;17;17) / 12885460acute myeloid leukemia;acute promyelocytic leukemia;leukemia FISH - Fluorescence in situ hybridization (FISH) analysis using the PML-RARA DNA probe showed a positive signal pattern (fusion) in 100% of 200 total interphase and metaphase cells examined, confirming the presence of the PML-RARA rearrangement. /// "These studies showed that the PML-RARA fusion was present, but the complementary fusion RARA-PML, which is usually detectable, was absent. "
RARA_PMLt(15;17) / t(15;17)(q22;q12) / del(6) / t(15;17) / 21474981acute promyelocytic leukemia;leukemia FISH - FISH signals from a dual color dual fusion translocation PML-RARA probe were consistent with the results of conventional cytogenetics.
RARA_PMLt(15;17)(q22;q12) / t(15;17) / 16056248sweet syndrome FISH - Nuclei were extracted from core biopsies of the formalin-fixed paraffin-embedded tissue and fluorescence in situ hybridization was performed using a dual color, dual fusion PML / RARA probe.
RARA_PML- 16405439acute promyelocytic leukemia;leukemia FISH - We report a unique case of a PML/RARA positive APL patient exhibiting extensive monocytic differentiation after ATRA therapy as documented by morphology, flow cytometry, and FISH studies. /// We discuss potential dual capability for granulocytic/monocytic differentiation of PML/RARA positive APL cells and implications of monocytic differentiation in the management of APL patients treated with ATRA.. /// The resultant fusion protein (PML/RARA) is thought to block differentiation of bone marrow cells arrested at the promyelocytic stage.
RARA_PMLt(15;17) / 25692052acute promyelocytic leukemia;leukemia FISH - High-Risk Microgranular Acute Promyelocytic Leukemia with a Five-Way Complex Translocation Involving PML-RARA..
RARA_PML- 25666852acute promyelocytic leukemia;leukemia;sarcoma FISH - Flow cytometry indicated presence of 92.4% of immature myeloid cells with t (15: 17) and q (22: 12) mutations, and FISH analysis for PML-RARA demonstrated a long-form fusion transcript, positive for APL.
RARA_PML- 17960172- FISH - The presence of a single PML-RARA isoform lacking exon 5 in FISH-negative APL samples..
RARA_PML- 22402611acute promyelocytic leukemia;leukemia FISH - Acute promyelocytic leukemia with trisomy 8 showing normal PML-RARA FISH signal patterns: diagnostic application of long-distance polymerase chain reaction in molecularly discrepant leukemia cases..
RARA_PML- 17556074acute myeloid leukemia;acute lymphoblastic leukemia;myeloid leukemia; FISH - The incidence of submicroscopic deletions in patients with chromosomal rearrangements was the highest in the TEL/AML1 rearrangement (65.0%), followed by BCR/ABL (10.9%), MLL (5.6%), AML/ETO (4.0%), and PML/RARA (0.0%).
RARA_PML9p21.3 / 17p13.1 / 12p13.2 / 5p15.33 / 21544632acute promyelocytic leukemia;leukemia FISH - Gain or loss of genes plays important roles in leukemogenesis of APL via cooperation with PML-RARA.
RARA_PMLt(15;17)(q22;q12) / 19950129acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - RT-PCR and FISH were positive for PML-retinoic acid receptor-alpha in 169 of 172 (98%) and 90 of 94 (96%) cases, respectively.
RARA_PML- 23806810acute myeloid leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - Two patients demonstrated two molecular rearrangements simultaneously, with BCR-ABL1 implicated in both, in addition to RUNX1-MECOM in one patient and PML-RARA in another.
RARA_PML- 11996797acute promyelocytic leukemia;leukemia FISH - This finding was confirmed by fluorescence in situ hybridization using the PML-RARA DNA probe and whole chromosome paints 15 and 17.
RARA_PML- 10792399- FISH - Rapid detection of BCR/ABL and PML/RARA using fluorescence in situ hybridization in cytospin preparations..
RARA_PML- 21422114acute myeloid leukemia;myeloid leukemia;leukemia;hematologic malignancy FISH - P=0.001), PML-RARA rearrangements (11/83, 13.3% versus 4/203, 2.0%.
RARA_PML- 17350466malignant meningioma FISH - FISH with LSI 9p21, CEP9, LSI PML/RARA, and CGH confirmed the karyotype complexity in this case.
RARA_PMLt(5;17;15)(q11;q21;q22) / t(15;17)(q22;q21) / t(5;17;15)(q11;q12;q22) / t(15;17) / 18558288acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - The two chimeric genes, PML/RARA and RARA/PML, are thought to play a role in leukemogenesis.
RARA_PMLt(11;17) / 8018944acute promyelocytic leukemia;leukemia PCR;RT-PCR - (3) APL is not a homogeneous disease in that among 50 patients studied at the molecular level, although a PML-RARA fusion gene was detected in 45 cases, one had a variant translocation t(11;17) bearing fusion gene PLZF-RARA, one presented no obvious structural alteration of the PML gene while the RARA gene was rearranged, and three patients had no rearrangement of either PML or RARA genes. /// (5) It seems likely that the fusion gene PML-RARA plays an important role in APL leukemogenesis and in its response to the ATRA treatment..
RARA_PMLt(15;17) / 8385249acute promyelocytic leukemia;leukemia PCR;RT-PCR - Chromosome translocation t(15;17) specifically found in acute promyelocytic leukemia (APL) results in cleavage in the introns of PML gene on chromosome 15 and in the intron of the retinoic acid receptor alpha (RAR alpha) gene on chromosome 17, creation and expression of PML-RAR alpha and RAR alpha-PML fusion genes.
RARA_PMLt(15;17) / t(9;22) / t(11;17) / t(5;17) / 8819070chronic myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia;disseminated intra - - The t(15;17) leads to the formation of two reciprocal fusion genes, PML/RARA on chromosome 15 and RARA/PML on chromosome 17. /// "In contrast, recent molecular analysis of APL cases with cytogenetically normal chromosomes 15 and 17 revealed the occurrence of submicroscopic translocations, leading to the formation of non reciprocal fusion genes, either PML/RARA or RARA/PML only. "
RARA_PMLt(15;17) / 11807007acute promyelocytic leukemia;leukemia - - Acute promyelocytic leukemia (APL) is characterized by the specific chromosome translocation t(15;17) with promyelocytic leukemia-retinoic acid receptor-alpha (PML-RARA) fusion gene and the ability to undergo terminal differentiation as an effect of all-trans retinoic acid (ATRA).
RARA_PMLt(15;17) / 24053202acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia - - The specific translocation t(15;17), which results in the fusion gene PML-RARA is the diagnostic and pathomechanistic hallmark of APL.
RARA_PMLt(15;17) / 20224268acute promyelocytic leukemia;leukemia - - Isochromosome der(17)(q10)t(15;17) in acute promyelocytic leukemia resulting in an additional copy of the RARA-PML fusion gene: report of 4 cases and review of the literature.. /// "The data presented in this study demonstrated that ider(17q), which resulted in an extra RARA-PML fusion gene, was more frequent in males than females (male/female ratio of 2.12/1), was associated with a rather low initial white blood cell count and did not confer an adverse prognosis in APL patients treated with all-trans-retinoic acid and chemotherapy. " /// Cases of overrepresentation of the RARA-PML fusion gene and ider(17q) cases may help in elucidating the role of RARA-PML in leukemogenesis..
RARA_PMLt(15;17) / 9624536acute promyelocytic leukemia;leukemia - - Acute promyelocytic leukemia (APL) is characterized by the t(15;17) cytogenetic abnormality leading to the expression of two fusion genes, PML/RARA and RARA/PML, and by its sensitivity to all-trans retinoic acid (ATRA) differentiating treatment. /// In vitro response to all-trans retinoic acid of acute promyelocytic leukemias with nonreciprocal PML/RARA or RARA/PML fusion genes.. /// "These insertions lead to the formation of potentially functional, nonreciprocal, PML/RARA or RARA/PML fusion genes, providing the unique opportunity to investigate in a human noncell-line model the respective role of PML/RARA or RARA/PML in retinoid signaling. " /// "The two cases expressing PML/RARA presented with an immunostaining pattern typical of APL and a positive response to ATRA, whereas the APL case expressing only a RARA/PML fusion transcript exhibited an immunostaining pattern typical of non-APL cells, and was resistant to ATRA. " /// "Our results confirm that sensitivity to ATRA requires expression of PML/RARA and strongly correlates with immunostaining, and demonstrate that expression of RARA/PML alone is sufficient for a cytological APL phenotype, but does not confer sensitivity to ATRA.. " /// "Here, we report the in vitro response to ATRA of these two cases as well as of a third case presenting with submicroscopic insertion (15;17) and expressing exclusively PML/RARA, by morphological, functional, and immunological assays. "
RARA_PMLt(15;17) / t(15;17) / t(5;17) / t(11;17)(q23;q21) / t(11;17) / 10942370acute promyelocytic leukemia;leukemia - - This group includes (1) cases with cryptic PML/RARA gene rearrangements and t(5;17) that leads to the NPM/RARA fusion gene, which are retinoid-responsive, and (2) cases with t(11;17)(q23;q21) that are associated with the PLZF/RARA fusion gene, which are retinoid-resistant. /// There were no major differences observed in morphology or immunophenotype between cases with the classic t(15;17) and those with the cryptic PML/RARA gene rearrangements.
RARA_PMLt(15;17) / 9288109- - - In more than 99% of cases, this disruption results in the formation of a PML-RARA gene fusion.
RARA_PMLt(15;17) / 11378661acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - Immediate identification of t(15;17) or the PML/RARA gene rearrangement is fundamental for treatment. /// "When the three tests were compared at diagnosis, karyotyping presented the translocation in 80% of the tested samples while FISH and RT-PCR showed the PML/RARA rearrangement in 100% of them. "
RARA_PMLt(8;21) / inv(16) / t(15;17) / t(9;22) / t(4;11) / 11896540acute myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - We investigated 105 consecutive AML cases for the presence of fusion gene transcripts by reverse transcriptase polymerase chain reaction (RT-PCR): AML1-ETO associated with t(8;21), CBFB-MYH11 with inv(16), PML-RARA with t(15;17), BCR-ABL with t(9;22), and MLL-AF4 with t(4;11).
RARA_PMLt(15;17) / 8396481acute promyelocytic leukemia;leukemia - - The translocation, which is balanced and reciprocal, leads to the formation of two fusion genes, PML/RAR alpha and RAR alpha/PML. /// "The PML/RAR alpha gene codes for two abnormal proteins: the PML/RAR alpha fusion protein and an abnormal PML protein, the RAR alpha/PML gene encodes the RAR alpha/PML fusion protein. "
RARA_PMLt(15;17) / 8947582acute promyelocytic leukemia;leukemia PCR;RT-PCR - Six patients with acute promyelocytic leukaemia (APL) and t(15;17) were investigated by cytogenetics and by reverse transcriptase polymerase chain reaction (RT-PCR) for the fusion transcript PML-RARA. /// Thereafter the PML-RARA transcript was not seen in 20/21 first remission samples in five cases studied. /// "Despite serial negative RT-PCR results, PML-RARA reemerged at or prior to relapse following BMT in the remaining three cases. "
RARA_PMLp13;q21 / t(15;20;17)(q22;p13;q21) / t(15;17) / t(17;20) / t(15;20) / t(15;17) / 9494608acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - Our results confirmed that the PML/RAR alpha gene on the der(15)t(15;17), not the RAR alpha/PML gene, must be essential to leukemogenesis in APL. /// Fluorescence in situ hybridization with cosmid DNA probes flanking the breakpoints of t(15;17) did not show the retinoic acid receptor alpha (RAR alpha)/PML fusion signal usually generated on the der(17)t(15;17).
RARA_PMLt(15;17) / t(15;17) / 8296791acute promyelocytic leukemia;leukemia - - Detection of PML-retinoic acid receptor-alpha fusion transcripts in acute promyelocytic leukemia with trisomy 8 but without t(15;17)..
RARA_PMLt(15;17) (q22;q21) / t(15;17) / 9002938acute myeloid leukemia - - this translocation fuses the PML gene on chromosome 15 to the retinoic acid receptor alpha (RAR alpha) gene on chromosome 17, creating two novel fusion genes, PML-RAR alpha and RAR alpha-PML.
RARA_PMLt(15;17) / 7496355acute myeloid leukemia - - However, leukemic cells lacked both translocation t(15;17) and RAR alpha/PML genes rearrangement.
RARA_PMLt(15;17) / 1486033acute myeloid leukemia PCR;RT-PCR - PML-RARA transcripts were detected in every case from a series of 18 APL patients with cytogenetically confirmed t(15;17) translocations, whereas RARA-PML messages were detected in only 67% (12/18) of these patients. /// Diagnosis of acute promyelocytic leukaemia by RT-PCR: detection of PML-RARA and RARA-PML fusion transcripts.. /// Separate PCR assays were designed to amplify either PML-RARA (15q+ derived) or RARA-PML (17q- derived) chimaeric transcripts.
RARA_PMLt(15;17) / 16434964acute promyelocytic leukemia;leukemia - - The translocation results in a fusion gene product, PML-RARalpha, in which the PML gene fuses to the retinoic acid receptor alpha (RARalpha) gene.
RARA_PMLt(7;8) / 19162322acute promyelocytic leukemia;leukemia PCR;RT-PCR - Derivative (7)t(7;8): The sole karyotype abnormality in acute promyelocytic leukemia with PML/RARA rearrangement identified by RT-PCR and sequence analysis..
RARA_PMLt(15;17) / 10992301acute promyelocytic leukemia;leukemia PCR - A lymphoid-cell line, lacking the t(15;17) but having the PML and RARA genes in close proximity in specific phases of the cell cycle, was irradiated with 10 Gy of (60)Co, and the incidence of PML-RARA transcripts was analyzed by a highly sensitive PCR assay. /// "The data thus indicate that the PML and RARA genes are not particularly susceptible to the clastogenic effects of gamma-irradiation, and that, similar to what has been reported for other chromosomal translocations, transcriptionally active PML-RARA rearrangements can be generated in normal hematopoietic cells of different lineages without apparent oncogenic consequences.. " /// "Despite gene proximity, typical PML-RARA transcripts were only rarely detected in irradiated cells. " /// "PML-RARA transcripts were observed at low frequencies in isolated lymphoid and granulocytic cell populations, with similar incidence in both cell types. "
RARA_PMLt(8;21)(q22;q22) / inv(16)(p13q22) / t(16;16)(p13;q22) / t(15;17)(q22;q12-21) / 18648004acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia - - The most frequent chromosome/molecular rearrangements, that is, t(8;21)(q22;q22)/RUNX1-RUNX1T1 and inv(16)(p13q22)/t(16;16)(p13;q22)/CBFB-MYH11 characteristic of core-binding factor (CBF) AML and t(15;17)(q22;q12-21)/PML-RARA characteristic of acute promyelocytic leukemia (APL), confer favorable clinical outcome when patients receive optimal treatment, that is, regimens that include high-dose cytarabine for CBF AML and all-trans-retinoic acid and/or arsenic trioxide for APL.
RARA_PMLt(1;19) / t(4;11) / t(8;21) / t(9;22) / t(12;21) / t(15;17) / inv (16) / 10602411- PCR;RT-PCR - A total of nine well-defined chromosome aberrations with fusion gene transcripts were selected: t(1;19) with E2A-PBX1, t(4;11) with MLL-AF4, t(8;21) with AML1-ETO, t(9;22) with BCR-ABL p190 and BCR-ABL p210, t(12;21) with TEL-AML1, t(15;17) with PML-RARA, inv (16) with CBFB-MYH11, and microdeletion 1p32 with SIL-TAL1.
RARA_PMLt(15;17) / 20362228- - - We identified a previously undescribed clonal evolution involving t(15;17) without PML-RARA rearrangement in an AML patient.
RARA_PMLt(15;19;17) / 16875944acute myeloid leukemia;myeloid leukemia;leukemia - - PML/RARA rearrangement associated with a t(15;19;17) in a case of acute myeloid leukemia with abundant myelocytes with salmon-pink cytoplasm..
RARA_PMLt(15;17) / t(15;17) / 1317574acute promyelocytic leukemia;leukemia - - Expression pattern of the RAR alpha-PML fusion gene in acute promyelocytic leukemia.. /// We investigated the organization and expression pattern of the RAR alpha-PML gene in a series of APL patients representative of the molecular heterogeneity of the t(15;17) and found (i) two types of RAR alpha-PML mRNA junctions (RAR alpha exon 2/PML exon 4 or RAR alpha exon 2/PML exon 7) that maintain the RAR alpha and PML longest open reading frames aligned and are the result of chromosome 15 breaking at two different sites. /// " Two chimeric genes, PML-RAR alpha and RAR alpha-PML, are formed as a consequence of the acute promyelocytic leukemia (APL)-specific reciprocal translocation of chromosomes 15 and 17 [t(15;17)]. " /// and (ii) 10 different RAR alpha-PML fusion transcripts that differ for the assembly of their PML coding exons. /// "A RAR alpha-PML transcript was present in most, but not all, APL patients.. "
RARA_PMLt(15;17) / 21436584acute myeloid leukemia;acute lymphoblastic leukemia;chronic myeloid leukemia - - It is characterized by the t(15;17)(q22;q11.2) chromosomal translocation that creates the promyelocytic leukemia-retinoic acid receptor ? (PML-RARA) fusion oncogene. /// "To identify these, we used a mouse model of APL, whereby PML-RARA expressed in myeloid cells leads to a myeloproliferative disease that ultimately evolves into APL. " /// "Further analysis showed that JAK1 V658F cooperated in vivo with PML-RARA, causing a rapidly fatal leukemia in mice. "
RARA_PMLdel(17q) / 8558940acute promyelocytic leukemia;leukemia PCR;RT-PCR - Most patients with APL express del(17q)-derived RAR alpha-PML transcripts as well as the putative leukemogenic PML-RAR alpha associated with add(15q). /// Minimal residual disease detection in acute promyelocytic leukemia by reverse-transcriptase PCR: evaluation of PML-RAR alpha and RAR alpha-PML assessment in patients who ultimately relapse.. /// The RAR alpha-PML assay changed the PCR status of two patients in morphological remission. /// "Although parallel assessment of PML-RAR alpha and RAR alpha-PML can enhance minimal residual disease detection in APL, this study demonstrates that treatment strategies involving determination of PCR status post-consolidation, even using RAR alpha-PML in addition to the more conventional PML-RAR alpha assay will fail to identify all patients at risk of relapse. " /// "We have found that a nested RT-PCR for RAR alpha-PML affords greater sensitivity than that for PML-RAR alpha, particularly in patients with the commonest breakpoint pattern. "
RARA_PMLt(15;17) / del(17q) / 8790159- PCR;RT-PCR - Parallel employment of the RAR alpha-PML assay confirmed expression of del(17q)-derived transcripts in 81% and permitted determination of the PML breakpoint (a potential independent prognostic variable) in all 93 cases.
RARA_PMLt(15;17) / t(15;17) / 7682097acute promyelocytic leukemia;leukemia - - Breakpoint clusters of the PML gene in acute promyelocytic leukemia: primary structure of the reciprocal products of the PML-RARA gene in a patient with t(15;17)..
RARA_PML- 7648936acute promyelocytic leukemia;leukemia - - 17) and PML/RAR alpha fusion gene (PML + RAR alpha + APL).
RARA_PMLt(15;17) / 16502581acute promyelocytic leukemia;leukemia PCR;RT-PCR - The use of reverse-transcription polymerase chain reaction (RT-PCR) for the detection of the PML-RARA and RARA-PML fusion genes is the only technique that defines the PML breakpoint type and that allows the definition of a correct strategy for subsequent minimal residual disease (MRD) monitoring.
RARA_PMLt(1;19) / t(12;21) / t(8;21) / t(8;14) / t(9;22) / t(10;11) / t(15;17) / inv(16) / 15843827hematologic malignancy - - Using cDNA microarrays, we determined the gene expression profiles of 40 cell lines as well as of primary leukemias harboring 11q23/MLL rearrangements, t(1;19)[TCF3/PBX1], t(12;21)[ETV6/RUNX1], t(8;21)[RUNX1/CBFA2T1], t(8;14)[IGH@/MYC], t(8;14)[TRA@/MYC], t(9;22)[BCR/ABL1], t(10;11)[PICALM/MLLT10], t(15;17)[PML/RARA], or inv(16)[CBFB/MYH11].
RARA_PMLt(15;17) / t(15;17) / 7647002- PCR;RT-PCR - Acute promyelocytic leukaemia (APL) is characterized by t(15;17), which results in the formation of two chimaeric genes, PML-RAR alpha and RAR alpha-PML. /// "Our results, however, show persistence of t(15;17) cells expressing RAR alpha-PML fusion mRNA in patients in long-term remission of APL. " /// Persistence of RAR alpha-PML fusion mRNA detected by reverse transcriptase polymerase chain reaction in patients in long-term remission of acute promyelocytic leukaemia.. /// PML-RAR alpha transcripts have been detected in all cases of APL whilst those of RAR alpha-PML have been detected in only about 67% of cases. /// The level of sensitivity for detecting RAR alpha-PML was some 10-fold higher than that for PML-RAR alpha. /// "All patients were negative for PML-RAR alpha, whereas in six patients (remission 3-9 years) RAR alpha-PML was consistently detected. " /// "Only one patient at remission showed the 5' breakpoint RAR alpha-PML, with the rest showing the 3' breakpoint 144 bp RAR alpha-PML. "
RARA_PMLt(15;17) / t(15;17) / 19109227acute promyelocytic leukemia;leukemia - - Acute promyelocytic leukemia (APL) is a hematopoietic malignant disease characterized by the chromosomal translocation t(15;17), resulting in the formation of the PML-RARA gene.
RARA_PMLt(15;17) / 24865730- - - The disease is caused by a single genetic event, namely the translocation t(15;17), which gives rise to the oncoprotein PML-RARA.
RARA_PMLt(15;17)(q24;q12) / 20155840acute promyelocytic leukemia;leukemia PCR;RT-PCR - This study demonstrates that the frequency of RARA-PML expression has been underestimated and highlights remarkable complexity at chromosomal breakpoint regions in APL even in cases with an apparently simple balanced t(15;17)(q24;q12).. /// "Six patients were falsely classified as RARA-PML negative due to deletions on chromosome 15 and/or 17, or alternative splicing leading to atypical RARA-PML fusion transcripts, which were not identified by conventional RT-PCR assays. " /// " Reciprocal RARA-PML transcripts are not detected in approximately 25% of patients with PML-RARA positive acute promyelocytic leukemia (APL), but the reasons for this are poorly understood. " /// "Atypical mRNA fusions in PML-RARA positive, RARA-PML negative acute promyelocytic leukemia.. " /// We studied 21 PML-RARA positive/RARA-PML negative cases by bubble PCR and multiplex long template PCR to identify the genomic breakpoints. /// Three cases were found to have complex rearrangements involving a third locus: the first had a PML-CDC6-RARA forward DNA fusion and expressed a chimeric PML-CDC6-RARA mRNA in addition to a PML-RARA.
RARA_PMLinv(16) / t(15;17) / 26079545acute myeloid leukemia;myeloid leukemia;leukemia PCR - Acute myeloid leukemia patients with recurrent cytogenetic abnormalities including inv(16);CBFB-MYH11 and t(15;17);PML-RARA may be assessed by monitoring the levels of the corresponding abnormal fusion transcripts by quantitative reverse transcription-PCR (qRT-PCR).
RARA_PMLt(15;17) / 23631001- - - PML is involved in the t(15;17) translocation that specifically occurs in Acute Promyelocytic Leukaemia (APL), resulting in a PML-retinoic acid receptor-alpha (PML-RARalpha) fusion protein.
RARA_PMLt(15;17) / 25815362acute promyelocytic leukemia;leukemia PCR;RT-PCR - The diagnostic work-up of acute promyelocytic leukemia (APL) includes the cytogenetic demonstration of the t(15;17) translocation and/or the PML-RARA chimeric transcript by RQ-PCR or RT-PCR. /// "We describe here two new, rapid and specific assays that detect PML-RARA transcripts, based on the RT-QLAMP (Reverse Transcription-Quenching Loop-mediated Isothermal Amplification) technology in which RNA retrotranscription and cDNA amplification are carried out in a single tube with one enzyme at one temperature, in fluorescence and real time format. " /// A single tube triplex assay detects bcr1 and bcr3 PML-RARA transcripts along with GUS housekeeping gene. /// "In conclusion, PML-RARA RT-QLAMP compared to RT-PCR or RQ-PCR is a valid improvement to perform rapid, simple and accurate molecular diagnosis of APL. "
RARA_PMLt(15;17)(q22;q12) / 18646608acute promyelocytic leukemia;leukemia PCR;RT-PCR - Karyotype analysis and RT-PCR showed 47, XY, t(15;17)(q22;q12), +12, and PML-RARA, respectively.
RARA_PMLt(15;17) / t(15;17) / 16352814acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia - - Here we found that conditional expression of promyelocytic leukemia-retinoic acid receptor alpha (PML-RARA), the protein encoded by the t(15;17) translocation found in acute promyelocytic leukemia (APL), suppressed PU.1 expression, while treatment of APL cell lines and primary cells with all-trans retinoic acid (ATRA) restored PU.1 expression and induced neutrophil differentiation.
RARA_PMLt(15;17) / 18702871pseudotumor cerebri;sweet syndrome - - Forty-two patients with confirmed APL (by t(15;17) and/or PML/RARA) treated at our institution (University hospital of Tunis) between January 1998 and June 2006 using two consecutive protocols: European APL93 trial (24 patients) until February 2004 and Spanish PETHEMA LPA99 trial (18 patients) more recently.
RARA_PMLt(8;21) / t(15;17) / 25750172- - - Other mechanisms linked to PU.1 downregulation in human AML include TP53 deletion, FLT3-ITD mutation and the recurrent AML1-ETO [t(8;21)] and PML-RARA [t(15;17)] translocations.
RARA_PMLt(8;21) / t(15;17) / 21234297acute promyelocytic leukemia;leukemia - - Early Detection of t(8;21) Chromosomal Translocations During Treatment of PML-RARA Positive Acute Promyelocytic Leukemia: A Case Study..
RARA_PMLt(15,17) / / 25436934acute promyelocytic leukemia;leukemia - - Acute promyelocytic leukemia (APL) is largely caused by the t(15,17) chromosome translocation, leading to the production of the PML/retinoic acid receptor alpha fusion.
RARA_PML- 24598642acute myeloid leukemia;myeloid leukemia;leukemia PCR - NPM1 mutation can co-exists with FLT3-ITD and IDH1 mutation, but not with AML1-ETO, PML-RARA or CBF-MYH11 fusion genes.. /// "NPM1 mutation was not detected in AML with AML1-ETO, PML-RARA or CBF-MYH11 fusion genes. "
RARA_PMLt(15;17) / 25197424acute promyelocytic leukemia;leukemia - - Tetraploidy acute promyelocytic leuemia with double t(15;17)/PML-RARA, a case report with review of literature..
RARA_PML- 9207466acute promyelocytic leukemia;leukemia - - 17) in acute promyelocytic leukemia (APL) produces the reciprocal fusion gene RAR alpha-PML. /// RAR alpha1-PML mRNAs and RAR alpha2-PML mRNAs from 5' PML breaksite cases coded for full-length RAR alpha-PML proteins but RAR alpha2-PML mRNAs from 3' PML breaksite cases encoded a truncated RAR alpha2 peptide.
RARA_PMLt(15;17) / t(15;17) / 7987829acute promyelocytic leukemia;leukemia - - A ribozyme which discriminates in vitro between PML/RAR alpha, the t(15;17)-associated fusion RNA of acute promyelocytic leukemia, and PML and RAR alpha, the transcripts from the nonrearranged alleles..
RARA_PML- 16638186- PCR;RT-PCR - The results showed that 4 types of fusion genes such as PML/RARA, AML1/ETO, CBFbeta/MYH11, BCR/ABL were detected in 8 (21.6%) patients by multiplex RT-PCR.
RARA_PMLt(12;21) / t(15;17) / 20211010acute lymphoblastic leukemia;myeloid leukemia;lymphoblastic leukemia;leukemia - - This study revealed that e.g., the t(12;21) [ETV6-RUNX1] subtype of ALL and the t(15;17) [PML-RARA] subtype of AML had transcriptional programs similar to those in normal Pro-B cells and promyelocytes, respectively.
RARA_PMLt(15;17) / 17965322- - - In t(15;17)/PML-RARA with FLT3-TKD mutations, in FLT3-LM/TKD double-mutated, and in MLL-PTD/TKD double-mutated cases prognosis was unfavorably influenced by FLT3-TKD mutations.
RARA_PMLt(15;17) / 11301322acute promyelocytic leukemia;leukemia - - The t(15;17) translocation, found in 95% of acute promyelocytic leukemia, encodes a promyelocytic leukemia (PML)-retinoic acid receptor alpha (RARalpha) fusion protein.
RARA_PMLt(15;17) / 20670478acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;myelodysplastic syndrome;leukemia - - From 2004, 39 patients with confirmed APL either by t(15;17) or PML/RARA were treated by the PETHEMA LPA 99 trial.
RARA_PMLt(15;17) / 21364283acute promyelocytic leukemia;leukemia - - Acute promyelocytic leukemia (APL) is characterized by the t(15;17) translocation that generates the fusion protein promyelocytic leukemia-retinoic acid receptor ? (PML-RARA) in nearly all cases. /// "To address this discrepancy, we have generated a system whereby PML-RARA expression is somatically acquired from the mouse Pml locus in the context of Pml haploinsufficiency. " /// Multiple prior mouse models of APL constitutively express PML-RARA from a variety of non-Pml loci. /// PML-RARA can increase hematopoietic self-renewal without causing a myeloproliferative disease in mice.. /// "Thus, at physiologic doses, PML-RARA primarily acts to increase hematopoietic progenitor self-renewal, expanding a population of cells that are susceptible to acquiring secondary mutations that cause progression to leukemia. " /// We found that physiologic PML-RARA expression was sufficient to direct a hematopoietic progenitor self-renewal program in vitro and in vivo.
RARA_PMLt(15;17) / 25110071acute myeloid leukemia;myeloid leukemia;leukemia - - P=0.001), followed by t(15;17)/PML-RARA (11.0%, P=0.004), and FLT3-ITD (8.5%, P<0.001). /// "In the total cohort and subgroups with high WT1mut incidences (biallelic CEBPAmut, PML-RARA), WT1mut had no impact on prognosis. "
RARA_PMLt(15,17) / / 14976209acute promyelocytic leukemia;leukemia - - Acute promyelocytic leukemia (APL) cases expressing the t(15,17) product, promyelocytic leukemia (PML)/retinoic acid receptor alpha (RARalpha), have clinical remissions through leukemic cell differentiation after all-trans-retinoic acid (RA) treatment.
RARA_PMLt(15;17) / 9756909acute promyelocytic leukemia;leukemia - - Acute promyelocytic leukemia arises following a reciprocal chromosome translocation t(15;17), which generates PML-retinoic acid receptor alpha fusion proteins (PML-RARalpha).
RARA_PMLt(15;17) / 22084648acute promyelocytic leukemia;leukemia - - From 2004, 51 patients with confirmed APL either by t(15;17) or PML/RARA were treated according to the PETHEMA LPA 99 trial.
RARA_PMLt(15;17) / 21859732acute promyelocytic leukemia;leukemia - - Combined treatment with all-trans-retinoic acid and chemotherapy is extremely efficient in patients with acute promyelocytic leukemia with t(15;17)/PML-RARA, but up to 15% of patients relapse. /// Clinical impact of FLT3 mutation load in acute promyelocytic leukemia with t(15;17)/PML-RARA..
RARA_PMLt(15;17) / t(8;21) / inv (16) / t(16;16) / 22207733acute myeloid leukemia;myeloid leukemia;leukemia - - After excluding patients with t(15;17)/PML-RARA, t(8;21)/RUNX1-RUNX1T1, inv (16)/t(16;16)/CBFB-MYH11, and normal karyotype, 824 patients with AML with cytogenetic abnormalities were analyzed.
RARA_PMLt(15;17) / 21078537- - - Cytogenetic and molecular characterisation has already identified subgroups, such as acute promyelocytic leukaemia (APL) with t(15;17)/PML-RARA and AML with FLT3 mutation for which targeted therapies are available, and further molecularly defined groups who may be potential candidates for this approach are likely to be identified in the future.
RARA_PML- 17008891acute promyelocytic leukemia;leukemia - - Do RARA/PML fusion gene deletions confer resistance to ATRA-based therapy in patients with acute promyelocytic leukemia?.
RARA_PML- 20528759acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia - - An abnormal fusion gene, PML/RARA is detected in approximately 98% of patients with APL. /// PML/RARA confers long-term self-renewal properties to promyelocytes.
RARA_PML- 24088603- - - As an initial application of this system, the PML/RARA fusion gene sequence formed from promyelocytic leukemia (PML) and retinoic acid receptor alpha (RARA) was successfully detected.
RARA_PML- 16645213acute myeloid leukemia;myeloid leukemia;leukemia - - NPM1 gene mutations are the most frequent genetic lesion in the 60% of adult acute myeloid leukemias (AMLs) with normal karyotype and no evidence of typical fusion genes (BCR/ABL1, PML/RARA, AML1/ETO, CBFB/MYH11, DEK/CAN).
RARA_PMLt(15;17) / t(15;17) / 10938104acute promyelocytic leukemia;leukemia - - Potentiation of GATA-2 activity through interactions with the promyelocytic leukemia protein (PML) and the t(15;17)-generated PML-retinoic acid receptor alpha oncoprotein..
RARA_PMLt(15;17)(q22;q12-q21) / t(11;17) / t(4;11) / t(1;22) / del(5) / del(7) / t(15;17) / 7519869acute promyelocytic leukemia;myelodysplastic syndrome;leukemia PCR - Molecular analysis by reverse transcriptase PCR analysis showed the presence of wild type retinoic acid receptor alpha (RARA) and the absence of the PML-RARA chimeric gene associated with t(15;17).
RARA_PML- 20359255acute promyelocytic leukemia;leukemia PCR - Acute promyelocytic leukemia (APL) with atypical breakpoints in the promyelocytic leukemia (PML) and retinoic acid receptor-alpha (RARA) genes represents a rare leukemic event, which occurs preferentially in patients with variant types of the PML/RARA fusion gene. /// A case of a novel PML/RARA short fusion transcript with truncated transcription variant 2 of the RARA gene..
RARA_PML- 26595813acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia - - While loss-of-function mutations in DNMT3A are highly recurrent in acute myeloid leukemia (AML), DNMT3A mutations are almost never found in AML patients with translocations that create oncogenic fusion genes such as PML-RARA, RUNX1-RUNX1T1, and MLL-AF9. /// PML-RARA requires DNA methyltransferase 3A to initiate acute promyelocytic leukemia.. /// "Together, these findings suggest that PML-RARA requires DNMT3A to initiate APL in mice. " /// "We used retroviral vectors to express PML-RARA, RUNX1-RUNX1T1, or MLL-AF9 in bone marrow cells derived from WT or DNMT3A-deficient mice. "
RARA_PMLt(15;17) / 19273155acute promyelocytic leukemia;leukemia - - Strikingly, over a decade ago, PML-NBs were found to be disrupted in acute promyelocytic leukemia (APL) in which PML is fused to the gene encoding retinoic acid receptor alpha (RARA) due to the t(15;17) chromosomal translocation, generating the PML-RARA chimeric protein. /// "The treatment of APL patients with all-transretinoic acid (ATRA) and arsenic trioxide which target the PML-RARA oncoprotein results in clinical remission, associated with blast cell differentiation and reformation of the PML NBs, thus linking NB integrity with disease status. "
RARA_PMLt(15;17) / 10601023acute promyelocytic leukemia;leukemia - - Although retinoic acid receptor alpha (RARalpha) agonists induce the maturation of t(15;17) acute promyelocytic leukemia (APL) cells, drug treatment also selects leukemic blasts expressing PML-RARalpha fusion proteins with mutated ligand-binding domains that no longer respond to all-trans retinoic acid (ATRA).
RARA_PMLt(15;17) / 7658715acute promyelocytic leukemia;leukemia - - Although the mechanism of its effectiveness upon APL remains unclear, the PML-retinoic acid receptor alpha (RARA) chimeric protein produced by t(15;17) is assumed to underlie the sensitivity of APL cells to ATRA. /// These data indicated that isoforms of PML-RARA fused transcripts affect neither the clinical features of APL nor the prognosis after treatment with ATRA.. /// Isoforms of PML-retinoic acid receptor alpha fused transcripts affect neither clinical features of acute promyelocytic leukemia nor prognosis after treatment with all-trans retinoic acid. /// There are two major isoforms of PML-RARA transcripts.
RARA_PML- 23627671- - - In acute promyelocytic leukaemia (APL) patients with the long (L)-type promyelocytic leukaemia-retinoic acid receptor ? fusion gene (PML-RARA), three alternative splicing isoforms can be detected: E5(+)E6(+), E5(-)E6(+), and E5(-)E6(-). /// This study is the first to demonstrate that alternative splicing of L-type PML-RARA is associated with time to achieve complete remission (CR) in APL.
RARA_PMLt(15;17)(q22;q11) / 23823097acute promyelocytic leukemia;leukemia - - The cytogenetic analysis of BM cells demonstrated t(15;17)(q22;q11), and PML-RARA chimeric gene was detected by reverse transcriptase-polymerase chain reaction assay.
RARA_PMLt(15;17) / 9108090acute promyelocytic leukemia;leukemia - - Acute promyelocytic leukemia (APL) is associated with the t(15;17) translocation, which generates a PML/RAR alpha fusion protein between PML, a growth suppressor localized on nuclear matrix-associated bodies, and RAR alpha, a nuclear receptor for retinoic acid (RA). /// "Thus, RA and arsenic target RAR alpha and PML, respectively, but both induce the degradation of the PML/RAR alpha fusion protein, which should contribute to their therapeutic effects. "
RARA_PMLt(15;17) / 11007035acute promyelocytic leukemia;leukemia PCR;RT-PCR - Of the four responders based on bone marrow morphology, two achieved molecular remission (negative RT-PCR for PML- RAR alpha fusion transcripts) by the end of the second and third cycles of As2O3 therapy.
RARA_PML- 15218975acute promyelocytic leukemia;leukemia - - Tetraploid acute promyelocytic leukemia with double PML/RARA gene rearrangements successfully treated with all-trans retinoic acid..
RARA_PMLt(15;17) / 14767917acute promyelocytic leukemia;leukemia PCR;RT-PCR - PML-RAR alpha fusion transcript (S type) was detected by RT-PCR, while RAR alpha-PML fusion transcript was not detected. /// PML-RAR alpha and RAR alpha-PML fusion transcripts were detected by reverse transcription-polymerase chain reaction (RT-PCR).
RARA_PMLt(15;17) / t(15;17)(q22;q21) / 19061780acute promyelocytic leukemia;leukemia - - In addition, variant fusion transcripts of PML/RARA were detected in the marrow specimen.
RARA_PML- 7831584acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia;hematologic malignancy - - The presence of the PML/retinoic acid receptor-alpha (PML/RAR-alpha) fusion gene, produced as a result of the unique chromosomal translocation in APL, is a marker of sensitivity to ATRA.
RARA_PML- 18294238acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - Acute promyelocytic leukemia with i(17)(q10) on G-banding and PML/RARA rearrangement by RT-PCR without evidence of PML/RARA rearrangement on FISH..
RARA_PML- 25419843acute promyelocytic leukemia;leukemia - - Previously we reported that the expression of promyelocytic leukemia (PML)-retinoic acid receptor alpha (RAR?) fusion gene, which is caused by specific translocation (15;17) in acute promyelocytic leukemia, can enhance constitutive autophagic activity in leukemic and nonleukemic cells, and PML overexpression can sequestrate part of microtubule-associated protein light chain 3 (LC3) protein in PML nuclear bodies, suggesting that LC3 protein also distributes into nuclei although it is currently thought to function primarily in the cytoplasm, the site of autophagosomal formation.
RARA_PMLt(11;17) / 1375719acute promyelocytic leukemia;leukemia PCR;RT-PCR - A third PML-RAR-alpha mRNA isoform, in which the most 3' PML exon present in the long-type isoform was truncated in its sequences lying immediately upstream of RAR-alpha B region, was found and characterized in a single patient.
RARA_PMLt(15;17) / t(15;17)(q22;q21) / t(15;17) / 12508246acute promyelocytic leukemia;leukemia - - amplified and sequenced the genomic PML-RARA junction sequences from 37 APL patients, and (iii). /// amplified and sequenced the reverse RARA-PML genomic fusion in 29 of these cases.
RARA_PMLt(15;17)(q22;q21) / t(3;8)(p25;q12) / t(15;17) / 8180390chronic myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - Reverse transcriptase polymerase chain reaction (RT-PCR) confirmed the existence of hybrid transcripts of 276, 455 bp and 623 bp, from PML-RARA on the der(15) chromosome, consistent with alternate exon splicing of the long form of the transcript occurring in 50% to 60% of patients with APL.
RARA_PML- 21344764acute myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - To perform quantitative RT-PCR and RQ-PCR reactions 4 fusion gene transcripts (AML1-ETO, CBFb-MYH11, PML-RARA /subtype bcrl and bcr3/) were used according to the protocol established by Europe Against Cancer Program. /// "PML-RARA (subtype bcr3) and CBFB-MYH11 gene transcripts were detected in 3 (4%) and 3 (4%) patients, respectively. "
RARA_PML- 17286448acute myeloid leukemia;chronic myeloid leukemia;myeloid leukemia;leukemia PCR - A total of 23 sets of oligomers were fabricated on glass slides for the detection of normal and fusion genes, as follows: BCR/ABL, AML/EAP, AML/ETO, AML/MDS, PML/RARA, NUMA1/RARA, PLZF/RARA, and CBFB/MYH.
RARA_PMLt(15;17) / 1375840acute promyelocytic leukemia;leukemia PCR;RT-PCR - A PML/retinoic acid receptor alpha fusion transcript is constantly detected by RNA-based polymerase chain reaction in acute promyelocytic leukemia..
RARA_PMLt(15;17) / t(15;17)(q22;q12-q21) / 8142621- - - Both reciprocal fusion products which arise as a result of the translocation, PML/RAR alpha and RAR alpha/PML, are expressed in many patients. /// "PML/RAR alpha, is implicated in leukaemogenesis, and may block myeloid differentiation directly and/or interfere with the normal function(s) of PML and/or RAR alpha.. "
RARA_PMLt(8;21) / 11753612acute myeloid leukemia;myeloid leukemia;leukemia - - Breakpoints in general displayed similar complexity of duplications, deletions, and insertions to other common pediatric leukemia translocations (TEL-AML1, MLL-AF4, PML-RARA, CBFB-MYH11) that we and others have analyzed..
RARA_PMLt(15;17) / t(15;17)(q21;q22) / 1339190- - - The PML-RARA chimaeric protein is presumably the target during the striking differentiation therapy achieved with all-trans retinoic acid. /// "Intriguingly, some APLs not only express the PML-RARA fusion protein but also the reciprocal RARA-PML fusion protein, although the contribution of this product is unclear. "
RARA_PML- 8525772acute promyelocytic leukemia;leukemia - - The presence of the PML/retinoic acid receptor-alpha (PML/RAR-alpha) fusion gene is a marker for sensitivity to this agent.
RARA_PMLt(15;17) / t(11;17) / 7719245acute promyelocytic leukemia;leukemia PCR;RT-PCR - The heterogeneity of the PML rearrangements juxtaposes different PML gene portions to the same set of RAR alpha exons, producing two major PML-RAR alpha fusion mRNA isoforms.
RARA_PML- 8385082acute promyelocytic leukemia;leukemia PCR - Detection of PML/retinoic acid receptor a gene rearrangements by polymerase chain reaction using genomic DNA in patients with acute promyelocytic leukemia..
RARA_PMLt(15;17) / 1720570acute promyelocytic leukemia;leukemia - - Although leukemic cells with translocations characteristically express only one fusion product, both PML/RARA (on the 15q+ derivative chromosome) and RARA/PML (on the 17q- derivative) are transcribed..
RARA_PMLt(15;17) / 8180596leukemia PCR - Appropriate oligoprimers complementary to PML and RAR-a sequences nearby the DNA breakpoints may be successfully used in PCR experiments to amplify the PML/RAR-a hybrid gene and sensitively detect minimal residual disease.
RARA_PMLt(15;17) / 10702899acute promyelocytic leukemia;leukemia PCR - RtPCR for the PML-RARA hybrid mRNA has become the hallmark of molecular diagnosis and molecular monitoring in APL.
RARA_PML- 22811791acute myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - The aim of the present study is to note the incidence of common fusion transcripts of AML1-ETO, PML-RARA and CBF?-MYH11 in adult and pediatric AML cases. /// "Of the 28 positive adult cases, 14/96 (14.58%) were positive for AML1-ETO, 12/96 (12.5%) for PML-RARA and 2/96 (2.08%) for CBF?-MYH11. " /// "In the 11 positive pediatric cases, 6/20 (30%) were positive for AML1-ETO, 3/20 (15%) for PML-RARA and 2/20 (10%) for CBF?-MYH11. "
RARA_PML- 24975339chronic myeloid leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - He obtained hematological remission after combination therapy with all-trans retinoic acid and chemotherapy for PMC, and PML-RARA was not detected by FISH analysis. /// "Arsenic trioxide (ATO) and imatinib therapy induced a second complete cytogenetic response, and PML-RARA mRNA detected by real-time quantitative RT-PCR dropped below the detection limit. "
RARA_PML- 22018276acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - Microgranular variant of acute promyelocytic leukemia with normal conventional cytogenetics, negative PML/RARA FISH and positive PML/RARA transcripts by RT-PCR..
RARA_PML- 1325570acute promyelocytic leukemia;leukemia PCR;RT-PCR - Breakpoints cluster in limited regions of RARA and PML, and PML/RARA and RARA/PML transcripts can also be detected by RT-PCR. /// "Although PML/RARA and RARA/PML fusion products are transcribed in APL, PML/RARA may play an important role in the etiology of APL. "
RARA_PMLt(15;17) / t(15;17) / 7784078acute promyelocytic leukemia;leukemia PCR;RT-PCR - PML/RAR alpha is expressed in APL cells with the non-rearranged alleles, PML and RAR alpha.
RARA_PMLt(15;17) / 1453773acute promyelocytic leukemia;leukemia - - Northern-blot analyses show that the chimeric fusion transcript PML-RAR alpha and the normal allelic PML and RAR alpha transcripts are similarly expressed in both cell lines.
RARA_PMLt(8;21) / 7858239acute promyelocytic leukemia;leukemia PCR;RT-PCR - We analyzed seven patients with acute promyelocytic leukemia (APL) in hematological remission for PML-retinoic acid receptor alpha (PML-RAR alpha) fusion transcripts by RT-PCR with the sensitivity level of one APL cell in 10(5) bone marrow mononuclear cells.
RARA_PMLt(15;17)(q22;q21) / 21927800acute promyelocytic leukemia;leukemia PCR;RT-PCR - Fluorescence in situ hybridization with a PML/RARA dual-color DNA probe showed a single fusion signal, and RT-PCR analysis showed PML/RARA fusion transcripts.
RARA_PMLinv(16) / t(4;11) / t(11;19) / 23091311- PCR - Fifteen fusion transcripts were included: BCR-ABL1, PML-RARA, ZBTB16-RARA, RUNX1-RUNX1T1, CBFB-MYH11, DEK-NUP214, TCF3-PBX1, ETV6-RUNX1, MLL-AFF1, MLL-MLLT4, MLL-MLLT3, MLL-MLLT10, MLL-ELL, MLL-MLLT1, and MLL-MLLT6. /// "Seven cryptic translocations including ETV6-RUNX1, MLL-MLLT3, MLL-MLLT4, and PML-RARA were detected. "
RARA_PMLt(15;17) / t(5;17) / t(11;17) / 9103677- - - 17) leading to the formation of PML-RAR alpha, RAR alpha-PML and aberrant PML fusion products.
RARA_PMLt(15;17) / 22562027acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia - - The PML-RARA translocation alone may not be sufficient to induce leukemia. /// "Therefore, we assume that FLT3 mutations and the other genetic and chromosomal alterations may cooperate with PML-RARA in the development of APL disease.. "
RARA_PMLt(15;17) / 8415704acute promyelocytic leukemia;leukemia - - The PML-retinoic acid receptor alpha translocation converts the receptor from an inhibitor to a retinoic acid-dependent activator of transcription factor AP-1..
RARA_PMLt(15;17) / 9342843acute promyelocytic leukemia;leukemia - - When cultured in ATRA, these resistant cells still express PML, RAR alpha, and PML/RAR alpha proteins.
RARA_PMLt(15;17) / 16857994acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia - - These data carry implications for the hematopoietic progenitor targeted by the PML-RARA oncoprotein in APL and are suggestive of a different cellular origin for classic hypergranular (M3) and variant forms of the disease.
RARA_PMLt(15;17) / 8674046acute promyelocytic leukemia;leukemia - - The PML-retinoic acid receptor alpha (RARA) oncoprotein, which is generated by the translocation, blocks the differentiation, and ATRA is thought to modulate the dominant negative function of PML-RARA. /// PML-RARA transcripts were not down-regulated by ATRA. /// Accelerated degradation of PML-retinoic acid receptor alpha (PML-RARA) oncoprotein by all-trans-retinoic acid in acute promyelocytic leukemia: possible role of the proteasome pathway.. /// "In this study, we showed by means of immunoblotting that the expression of PML-RARA decreased within 12 h in APL cells treated with ATRA at concentrations greater than 0.1 microM. " /// "These data indicate that the PML-RARA degradation is accelerated by pharmacological concentrations of ATRA, suggesting that ATRA allows APL cells to differentiate by relieving the differentiation block.. " /// "However, the molecular effect of ATRA on PML-RARA is unknown. " /// The decrease of PML-RARA was associated with restoration of the normal subcellular PML localization. /// "However, lactacystin, a specific inhibitor of the proteasome, almost completely inhibited the decrease of PML-RARA. "
RARA_PML- 7624661- - - Special topics are devoted to Ras, erbB2, p 53 and characteristical gene rearrangements, such as bcr-abl, RARA-PML, VDJ, bcl2-IgH.
RARA_PML- 11916515acute promyelocytic leukemia;leukemia - - Patient 1 did not express RAR(alpha)-PML and patient 2 showed the RAR(alpha)-PML transcript, which corresponded to the typical bcr1.
RARA_PML- 18719738acute myeloid leukemia;myeloid leukemia;leukemia - - Both groups showed similar characteristics regarding white blood cell counts, cytogenetic data or presence of gene rearrangements associated with good prognosis as AML1-ETO, CBFB-MYH11 and PML/RARA.
RARA_PML- 17712046acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - The diagnostic marrow was negative for PML-RARA transcripts by reverse transcription-polymerase chain reaction (RT-PCR), but an atypical product was observed.
RARA_PML- 10774514acute promyelocytic leukemia;leukemia PCR;RT-PCR - Molecular assay commonly used to detect the PML/RAR alpha rearrangement in acute promyelocytic leukemia (APL) has the limited sensitivity in comparison with the higher sensitivity of RAR alpha/PML detection. /// "RAR alpha/PML rearrangement is not expressed in the totality of the APL patients, but in only a 90% of them. " /// RAR alpha/PML rearrangement was detected in a greater proportion of samples than PML/RAR alpha. /// [Monitoring of minimal residual disease with the combined detection of PML/RAR alpha and RAR alpha/PML rearrangements in acute promyelocytic leukemia].. /// Likewise RAR alpha/PML rearrangement was detected in some post-consolidation samples (2/11) that all were PMI/RAR alpha negatives. /// RAR alpha/PML rearrangement lasted longer than PML/RAR alpha after treatment.. /// RAR alpha/PML rearrangement was detected in 90% (20/22) of the patients at diagnosis positives for PML/RAR alpha. /// In patients in maintenance regimen a greater proportion of RAR alpha/PML positives (6/28) versus PML/RAR alpha (2/28) were observed. /// The results of the patients monitored since the diagnosis showed that RAR alpha/PML revert to negative one month after PML/RAR alpha negativization. /// In a patient in complete remission RAR alpha/PML preceded the positivity of PML/RAR alpha and persisted after PMI/RAR alpha negativization. /// The PML/RAR alpha was detected according with Biondi's et al method and the RAR alpha/PML following the Grimwade's et al RT-PCR method (Human Press Inc.). /// RAR alpha/PML was detected in 74% (14/19) of post-induction samples versus 37% (7/19) of positives for PML/RAR alpha.
RARA_PMLt(15;17) / 14592978acute promyelocytic leukemia;leukemia - - These results suggest that PML-RARA mediates ATRA-induced C/EBPbeta expression. /// "We further provide evidence that ATRA mediates a direct increase of C/EBPbeta, only in PML-RARA (promyelocytic leukemia-retinoic acid receptor alpha)-expressing cells. " /// "Taken together, C/EBPbeta is an ATRA-dependent PML-RARA target gene involved in ATRA-induced differentiation of APL cells.. " /// "In addition, transactivation experiments indicate that the PML-RARA fusion protein, but not PML-RARA mutants defective in transactivation, strongly transactivates the C/EBPbeta promoter. "
RARA_PMLt(15;17) / t(15;17) / 16737919acute promyelocytic leukemia;leukemia PCR;RT-PCR - Fluorescence in situ hybridization with a PML/RARA dual-color DNA probe showed the fusion signals on der(15) and the residual PML signals on der(22).
RARA_PMLt(15;17) / 8874178acute promyelocytic leukemia;leukemia - - Because the ratio of expression of PML/RAR alpha to wild-type RAR alpha and PML may be important in maintaining the dominant negative block of myelocytic differentiation, these data suggest a molecular mechanism for restoration by tRA normal myeloid differentiation in APL cells.. /// We further show that this loss of PML/ RAR-alpha is not limited to the unique APL cell line.
RARA_PMLt(15;17) / 7486813acute lymphoblastic leukemia;acute promyelocytic leukemia;lymphoblastic leukemia;leukemia - - Only one, the PML-RARA, is associated with APL. /// They are termed PML-RARA and RARA-PML. /// The PML-RARA chimeric protein has two zinc finger-like regions.
RARA_PMLt(15;17) / 19451695acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia - - The validated gene signature reliably identified M3 samples in 2 other AML datasets, and the validated genes were substantially enriched in our mouse model of APL, but not in a cell line that inducibly expressed PML-RARA. /// "The resulting fusion protein, PML-RARA, initiates APL, which is a subtype (M3) of acute myeloid leukemia (AML). "
RARA_PMLt(15;22;17) / t(15;17)(q22;q21) / t(15;22;17) / 19190979acute promyelocytic leukemia;leukemia PCR;RT-PCR - Fluorescence in situ hybridization with a PML/RARA dual-color DNA probe showed the fusion signals.
RARA_PMLt(15;17) / 20724820acute promyelocytic leukemia;leukemia - - In a recently published study we demonstrate that PML/RARA is amenable for degradation by autophagy and that ATRA- and ATO-induced PML/RARA degradation is autophagy-dependent.
RARA_PML- 8752731acute lymphoblastic leukemia;acute promyelocytic leukemia;lymphoblastic leukemia;leukemia PCR - Owing to the development of the polymerase chain reaction (PCR) MRD can be detected at the 10(-5) level by amplifying the leukemia-specific DNA rearrangement (BCR/ABL, PML/RARA etc.) or clone-specific DNA sequences (IgH chain CDR-III etc.).
RARA_PMLt(15;17) / 19808868acute promyelocytic leukemia;leukemia - - Both agents directly target PML/RARA-mediated transcriptional repression and protein stability, inducing to various extent promyelocyte differentiation and clinical remission of APL patients. /// "The RA-As association, which synergizes for PML/RARA degradation but not for differentiation, rapidly clears leukemia initiating cells (LIC), resulting in APL eradication in murine APL models, but also in several APL clinical trials. " /// Therapy-induced PML/RARA proteolysis and acute promyelocytic leukemia cure.. /// "Cyclic AMP triggered PML/RARA phosphorylation also enhances RA-induced APL regression, PML/RARA degradation, and LIC clearance, raising new options for therapy-resistant patients. " /// "Although differentiation has a major role in debulking of the tumor, PML/RARA degradation seems to be the primary basis for APL eradication by the RA-As association. " /// PML/RARA expression in the mouse is sufficient to initiate APL.
RARA_PMLt(15;17) / 20455087acute promyelocytic leukemia;leukemia - - Expression of PML/RARA, a potent transcriptional repressor, induces APL in mice. /// "Both retinoic acid (RA) and arsenic trioxide directly target PML/RARA-mediated transcriptional repression and protein stability, inducing rapid differentiation of the promyelocytes and clinical remission in most APL patients. " /// Eradication of acute promyelocytic leukemia-initiating cells by PML/RARA-targeting.. /// "Collectively, these results demonstrate that LIC clearance, which mirrors PML/RARA degradation, is the primary basis for APL cure by the RA/arsenic trioxide association, rather than differentiation. " /// "The RA/arsenic trioxide association, which dramatically synergizes for PML/RARA degradation but not for differentiation, rapidly clears LIC in a proteasome-dependent manner, resulting in APL eradication in murine models and patients. "
RARA_PMLt(15;17) / t(11;17) / 9070655acute promyelocytic leukemia;leukemia - - The generated PML-RAR alpha fusion interferes with wild type RAR alpha-mediated transcription and disrupts subnuclear compartments, known as PML bodies.
RARA_PMLt(15;17)(q22;q21) / t(11;17)(q23;q21) / t(5;17)(q35;q12-21) / t(11;17)(q13;q21) / 26471811acute promyelocytic leukemia;leukemia - - We report on an APL patient with iso(17q) as the sole cytogenetic aberration and a cryptic PML-RARA transcript, who was treated with ATRA and ATO after failure of chemotherapy and achieved complete remission. /// Acute promyelocytic leukemia with isochromosome 17q and cryptic PML-RARA successfully treated with all-trans retinoic acid and arsenic trioxide..
RARA_PML- 18665825acute myeloid leukemia PCR;RT-PCR - Common fusion transcripts in childhood acute lymphoblastic leukemia (ALL) are TEL-AML1, E2A-PBX, MLL-AF4, and BCR-ABL (p190) and in acute nonlymphoblastic leukemia (ANLL) are AML-ETO, PML-RARA, and CBFB-MYH11. /// "Multiplex RT-PCR panel A (ALL) included primers for TEL-AML1, E2A-PBX, MLL-AF4, and BCR-ABL (p190) whereas panel B (ANLL) composed of primers for AML-ETO, PML-RARA, and CBFB-MYH11. "
RARA_PMLt(15;17) / 9737682- PCR;RT-PCR - These results show that some patients in remission of APL continue to express PML-RARA even in long-term remission, when they can be considered clinically 'cured' of their disease.. /// We have developed a 'hot-start' RT-PCR method for the amplification of PML-RARA with increased sensitivity at the level of two leukaemic cells in 10(6) cells.
RARA_PMLt(15;17) / t(15;17) / 11929790acute promyelocytic leukemia;myeloid leukemia;leukemia - - However, leukemogenesis by PML-RARA required additional genetic alterations. /// Recurring chromosomal abnormalities in leukemia in PML-RARA transgenic mice parallel human acute promyelocytic leukemia.. /// "In previous studies, we demonstrated that expression of a human PML-RARA complementary DNA in murine granulocyte precursor cells initiated the development of leukemia. "
RARA_PMLt(11;17)(q23;q21) / t(11;17)(q23;q12) / t(15;17)(q22;q12) / 23071480pulmonary tuberculosis;tuberculosis - - PML-RARA is very important.
RARA_PML- 8380300acute promyelocytic leukemia;leukemia PCR;RT-PCR - In addition, structural data provided by PML-RARA transcripts allowed us to more accurately locate the 3' borders of clusters bcr1 and bcr3.
RARA_PMLt(15;17) / 25126724acute promyelocytic leukemia;leukemia - - Importantly, the knockdown phenotypes for DRAM2 are similar to the effects of overexpressing MIR125B1 as impairment of PML-RARA degradation, inhibition of autophagy, and myeloid cell differentiation arrest. /// MIR125B1 represses the degradation of the PML-RARA oncoprotein by an autophagy-lysosomal pathway in acute promyelocytic leukemia.. /// "Here, we demonstrated that MIR125B1 abundance correlates with the PML-RARA status. " /// MIR125B1 overexpression enhanced PML-RARA expression and inhibited the ATRA-induced degradation of the PML-RARA oncoprotein. /// RNA-seq analysis revealed a direct link between the PML-RARA degradation pathway and MIR125B1-arrested differentiation. /// "We further demonstrated that the MIR125B1-mediated blockade of PML-RARA proteolysis was regulated via an autophagy-lysosomal pathway, contributing to the inhibition of APL differentiation. "
RARA_PMLt(15;17) / t(11;17) / 10373566acute promyelocytic leukemia;leukemia - - PIC-1/SUMO-1-modified PML-retinoic acid receptor alpha mediates arsenic trioxide-induced apoptosis in acute promyelocytic leukemia..
RARA_PMLt(15;17) / 23589792acute promyelocytic leukemia;leukemia PCR;RT-PCR - Since APL is a medical emergency and an accurate diagnosis is a prerequisite for prompt treatment, laboratory support to implement faster diagnostic tools to confirm the presence of PML-RARA is required..
RARA_PMLt(15;17)(q22;q21) / 24673420acute promyelocytic leukemia;leukemia - - Using a combination of cytogenetic and molecular methods, we confirmed the insertion and presence of the PML-RARA transcript and lack of the reciprocal RARA-PML transcript. /// "PML-RARA fusion resulting from a cryptic insertion of RARA gene into PML gene without the reciprocal RARA-PML fusion: clinical, cytogenetic, and molecular characterization and prognosis.. "
RARA_PML- 21354057leukemia PCR;RT-PCR - To detect the presence or absence of these genetic alterations in healthy individuals, sensitive nested RT-PCR analyses were performed on a large number of peripheral blood samples for selected markers including MLL partial tandem duplications (PTDs), BCR-ABL p190, BCR-ABL p210, MLL-AF4, AML1-ETO, PML-RARA, and CBFB-MYH11. /// "To our knowledge, the presence of PML-RARA and CBFB-MYH11 in healthy individuals has not been previously described. "
RARA_PMLt(15;17) / t(9;22) / t(15;17)(q22;q12) / del(6) / t(9;22) / 21378481acute promyelocytic leukemia;leukemia - - PML/RARA and minor BCR/ABL were also detected by quantitative reverse transcription polymerase chain reaction of bone marrow cells (52,000 copies/?gRNA and 650 copies/?gRNA, respectively). /// "Post-induction bone marrow examination demonstrated 46, XY[20] and PML/RARA 240 copies/?gRNA, whereas minor BCR/ABL was not detected. "
RARA_PMLt(15;17) / 24433507acute promyelocytic leukemia;leukemia - - An effect to relieve the blockade (inhibition) of PML/RARA-mediated RA dependent promyelocytic differentiation, and retinoic acid in APL therapy (see Figure in the full text, George Zhu, 1991).
RARA_PML- 21120212acute promyelocytic leukemia;leukemia - - Her complete blood cell count was normal, but magnetic resonance image of brain revealed focal meningeal enhancement and cerebrospinal fluid showed leukemic promyelocytes and PML/RARA rearrangement.
RARA_PML- 18290568acute promyelocytic leukemia;leukemia PCR;RT-PCR - After transplant, this patient remained in complete hematological and cytogenetic remission but nested RT-PCR assays with detection thresholds of 10(-3)/10(-4) were positive for PML-RARA rearranged gene even chimerism tests showed 100% of donor profile. /// "Predictive value of RT-PCR PML-RARA transcript monitoring for extramedullary relapse of acute promyelocytic leukemia in the pleura, heart and pericardium after allogeneic SCT.. " /// Presented patient underwent alloSCT in second complete hematological and cytogenetic remission with presence of promyelocytic leukemia-retinoic acid receptor A (PML-RARA) detected in reverse transcription-polymerase chain reaction (RT-PCR) with sensitivity of 10(-2). /// "At that time, PML-RARA transcript detected in RT-PCR assay (10(-2)) was positive for the first time after transplant. " /// We conclude that detection of PML-RARA after alloSCT should be indication insightful diagnosis of medullary or extramedullary (EM) relapse.
RARA_PMLt(15;17) / 1314166- - - Molecular studies on a large series of APLs revealed great heterogeneity of the PML/RAR alpha transcripts due to: (i) variable breaking of chromosome 15 within three PML breakpoint cluster regions (bcr1, bcr2 and bcr3), (ii) alternative splicings of the PML portion and (iii) alternative usage of two RAR alpha polyadenylation sites.
RARA_PMLt(15;17) / 7675545acute promyelocytic leukemia;leukemia - - A dimerization domain within PML is able to mediate the formation of PML-RAR alpha homodimers that can bind to target sequences with distinct DNA binding properties if compared with RAR alpha.(ABSTRACT TRUNCATED AT 250 WORDS).
RARA_PML- 24464319acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia PCR;RT-PCR - Class II mutations: 24 (17.9?%), 19 (14.2?%), and 9 (6.7?%) children had PML-RARA, RUNX1-RUNX1T1, and CBFB-MYH11 transcripts, respectively.
RARA_PML- 22915647acute myeloid leukemia;myeloid leukemia;leukemia - - Based on Cox regression and Kaplan-Meier analyses, 5 distinct prognostic subgroups were identified: (1) very favorable: PML-RARA rearrangement (n = 29) or CEPBA double mutations (n = 42. /// "One thousand patients with cytogenetic data were investigated for the following molecular alterations: PML-RARA, RUNX1-RUNX1T1, CBFB-MYH11, FLT3-ITD, and MLL-PTD, as well as mutations in NPM1, CEPBA, RUNX1, ASXL1, and TP53. "
RARA_PML- 12791658acute myeloid leukemia;myeloid leukemia;leukemia - - Real-time quantification of FLT3 in 141 cases of AML showed that all cases with FLT3 D835 express high level transcripts, whereas FLT3-ITD AML can be divided into cases with high-level FLT3 expression, which belong essentially to the monocytic lineage, and those with relatively low-level expression, which predominantly demonstrate PML-RARA and DEK-CAN. /// Variant CBFbeta-MYH11 fusions and bcr3 PML-RARA may also be initiated by similar mechanisms..
RARA_PMLt(15;17) / 7534109acute promyelocytic leukemia;leukemia - - Furthermore, APL develops only when the PML and RARA genes are rearranged, within restricted genomic regions and a functional PML-RARA chimeric product is produced, and this might lead to a clustering of the breakpoints..
RARA_PMLt(5;17)(q35;q12) / 26342691acute promyelocytic leukemia;leukemia;sarcoma - - As MS was also diagnosed in two of the seven other reported cases of APL with NPM1/RARA, MS may occur more frequently in APL with NPM1/RARA than APL with PML/RARA..
RARA_PML- 7536493acute promyelocytic leukemia;leukemia PCR;RT-PCR - In one female patient, the abnormal PML-RAR fusion gene was found only in the more mature CD34+/CD38+ cell fraction using a nested PCR approach, whereas the polyclonal CD34+/CD38- fraction was PML-RARA negative. /// These findings were confirmed in a third patient with APL in whom the PML-RARA transcripts were absent in the CD34+/CD38- cell fraction. /// Highly purified primitive hematopoietic stem cells are PML-RARA negative and generate nonclonal progenitors in acute promyelocytic leukemia..
RARA_PML- 12353268acute promyelocytic leukemia;leukemia FISH;PCR;RT-PCR - Finally, we assessed the presence of the PML, RARA, PML/RARA, and RARA/PML transcripts by RT-PCR and of the PML/RARA and RARA proteins by Western blotting in all the cell lines.
RARA_PMLt(15;17) / 15604884acute promyelocytic leukemia;leukemia - - The mechanism of arsenic cytotoxicity is thought to involve posttranslational modification followed by degradation of the PML-retinoic acid receptor-alpha (PML-RARalpha) fusion protein.
RARA_PML- 23056333acute promyelocytic leukemia;leukemia - - Finally, since PML/Pml is normally expressed in the HSPCs of both humans and mice, and since some human APL samples contain TCR rearrangements and express T lineage genes, we suggest that the very early hematopoietic expression of PML-RARA in this mouse model may closely mimic the physiologic expression pattern of PML-RARA in human APL patients.. /// "We originally targeted PML-RARA expression with CTSG regulatory elements, based on the early observation that this gene was maximally expressed in cells with promyelocyte morphology. "
RARA_PML- 20376583acute myeloid leukemia;myeloid leukemia;leukemia PCR - Comparative monitoring of MRD by RQ-PCR for the Wilms' tumor gene 1(WT1) or specific translocation markers demonstrated that BAALC had similar kinetics as WT1, AML1/ETO and minor BCR/ABL, but not PML/RARA.
RARA_PML- 8470912- - - In many APL patients, translocation between RAR alpha gene and an oncogenic gene, PML, can be detected, although the roles of their fusion products (RAR alpha-PML and PML-RAR alpha) in APL induction have not been understood.
RARA_PML- 23320012acute promyelocytic leukemia;leukemia - - Molecular methods for genomic analyses of variant PML-RARA or other RARA-related chromosomal translocations in acute promyelocytic leukemia..
RARA_PMLt(15;17)(q22;q21) / t(15;17) / 7935403acute promyelocytic leukemia;leukemia - - The breakpoint site encodes fusion protein PML-RAR alpha, which is able to form a heterodimer with PML.
RARA_PMLt(15;17) / 9031108acute promyelocytic leukemia;leukemia - - The fusion protein PML-RAR alpha encoded from the breakpoint can form a heterodimer and acts as a dominant negative inhibitor against the normal function of PML.
RARA_PML- 8161469acute promyelocytic leukemia;leukemia - - This results in a PML-RARA chimeric gene.
RARA_PMLt(3;17)(p25;q21) / 20633765acute promyelocytic leukemia;leukemia ISH - Cryptic insertion of PML-RARA into the 3p25 locus in an acute promyelocytic leukemia with t(3;17)(p25;q21)..
RARA_PML- 23358744acute myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia - - A prerequisite for individualized treatment strategies is a fast pretherapeutic molecular screening including the fusion genes PML-RARA, RUNX1-RUNX1T1 and CBFB-MYH11 as well as mutations in the genes NPM1, FLT3 and CEBPA.
RARA_PMLt(5;17) / t(15;17)(q23;q12) / t(11;17)(q23;q12) / t(5;17)(q32;q12) / del(5q) / del(8q) / t(11;17) / 8605120acute promyelocytic leukemia;leukemia ISH - Whereas RARA rearrangement appears sufficient for an APL-like phenotype, it seems that the presence of a classical PML/RARA is required for typical APL with response to ATRA.. /// Molecular studies evidenced RARA rearrangement but showed neither PML rearrangement nor PML/RARA fusion.
RARA_PMLt(15;17)(q22;q21) / 15717685acute promyelocytic leukemia;leukemia;disseminated intravascular coagulation ISH - Fluorescence in situ hybridization assay revealed 2 promyelocytic leukemia and retinoic acid receptor alpha (PML/RARA) fusion signals, and reverse transcription-polymerase chain reaction assay revealed short-form PML/RARA fusion transcript.
RARA_PMLp15;q21 / t(10;17)(p15;q21) / 17175384leukemia ISH - Fluorescence in situ hybridization with the LSI PML/RARA dual-color probe showed the breakpoint to be distal to the RARA locus.
RARA_PMLt(15;17) / 17934255acute promyelocytic leukemia;leukemia ISH - Molecular analysis by reverse transcription polymerase chain reaction using primers for different PML-RARA junctions showed bands with different sizes compared with those generated from the three classical breakpoints, namely bcr1, bcr2 and bcr3. /// Identification of atypical PML-RARA breakpoint in a patient with acute promyelocytic leukemia..
RARA_PML- 24189654acute myeloid leukemia;myeloid leukemia;leukemia;melanoma - - In clinical samples with ? 10% tumor cells, UW-OncoPlex correctly identified 129 of 130 known mutations [sensitivity 99.2%, (95% CI, 95.8%-99.9%)], including single nucleotide variants, small insertions and deletions, internal tandem duplications, gene copy number gains and amplifications, gene copy losses, chromosomal gains and losses, and actionable genomic rearrangements, including ALK-EML4, ROS1, PML-RARA, and BCR-ABL.
RARA_PML- 20513534myeloid leukemia ISH - This represents a rare case of APL with a cryptic PML-RARA rearrangement presenting as myeloid sarcoma at multiple relapses and involving multiple anatomical sites, including cardiac atrium.. /// Unusual presentation of myeloid sarcoma in a case of acute promyelocytic leukemia with a cryptic PML-RARA rearrangement involving multiple sites including the atrium..

ChimerSEQ

Top
The fusion gene pair RARA--PML information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
RARA_PMLchr17/38487648/+ chr15/74317197/+ 17q21.2 15q24.1 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2823-03A Oncogene; Receptor; Transcription_Factor FusionScan
RARA_PMLchr17/38487648/+ chr15/74325496/+ 17q21.2 15q24.1 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2998-03A Oncogene; Receptor; Transcription_Factor FusionScan
RARA_PMLchr17/38487648/+ chr15/74317197/+ 17q21.2 15q24.1 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3007-03A Oncogene; Receptor; Transcription_Factor FusionScan
RARA_PMLchr17/38487648/+ chr15/74317197/+ 17q21.2 15q24.1 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2840-03A Oncogene; Receptor; Transcription_Factor FusionScan
RARA_PMLchr17/38487648/+ chr15/74326818/+ 17q21.2 15q24.1 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2994-03A Oncogene; Receptor; Transcription_Factor FusionScan
RARA_PMLchr17/38487648/+ chr15/74317197/+ 17q21.2 15q24.1 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3001-03A Oncogene; Receptor; Transcription_Factor FusionScan
RARA_PMLchr17/38499119/+ chr15/74326818/+ 17q21.2 15q24.1 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3012-03A Oncogene; Receptor; Transcription_Factor FusionScan
RARA_PMLchr17/38487648/ chr15/74317198/ 17q21.2 15q24.1 Exonic hg19 - Inter-chr NA M82827 Oncogene; Receptor; Transcription_Factor ChiTaRs
RARA_PMLchr17/38487648/+ chr15/74317198/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2823-03A Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38487648/+ chr15/74317198/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2840-03A Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38487648/+ chr15/74326819/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2841-03B Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38487648/+ chr15/74326819/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2872-03A Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38487648/+ chr15/74317198/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2980-03A Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38487648/+ chr15/74317198/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2991-03A Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38487648/+ chr15/74326819/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2994-03A Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38487648/+ chr15/74325497/+ 17q21.2 15q24.1 Exonic hg19 Out-of-frame Inter-chr LAML TCGA-AB-2998-03A Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38487648/+ chr15/74317198/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-3001-03A Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38487648/+ chr15/74317198/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-3007-03A Oncogene; Receptor; Transcription_Factor PRADA
RARA_PMLchr17/38499119/+ chr15/74326819/+ 17q21.2 15q24.1 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-3012-03A Oncogene; Receptor; Transcription_Factor PRADA

ChiTaRS 2.1

Top
The fusion gene pair RARA--PML information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human M82827RARA--PML RARA17 38487146 38487648 + 1 502 100 PML15 74317198 74328712 + 503 2093 99.9

FARE-CAFE

Top
The fusion gene pair RARA--PML information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
RARA-PML Acute promyelocytic leukemia FISH,Southern blot,SSCP,PCR,DNA sequencing,LDI-PCR,Western blot,RT-PCR,Exontrapping,RACE,G-Banding t(15;17)(q22;q21) PubMed:12508246

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
RARA-PML RARA-PML-Isoform1 RARA 38503920 0 1 PML 74326822 1 1 GGGGTACCCAGAATAATGGGCTTTTGGGGCCCTGGGGACTAACGCGTTGTGGTGATCAGCAGCTCGGAAGACTCAGATGC _ S57797
RARA-PML RARA-PML-Isoform2 RARA 38504435 0 1 PML 74325745 1 1 GCTGGGGAGTCCCAGTTTTCGGGGAGGCAGGTAGGGAGGTGGGTAGGGCAGTGGC _ S76370
RARA-PML RARA-PML-Isoform3 RARA 38503830 0 1 PML 74325747 1 1 CCGGACATAGTATTGAGGCCAGACAGACAGGGAGGCAGGTAGGGAGGTGGGTAGG _ S76372
RARA-PML RARA-PML-Isoform4 RARA 38502990 0 1 PML 74326627 1 0 TGGGAGAAAACCAGGCCAGGGCAGTTGATTTGTGAATTACTCAAATCCAAATGCA _ S76405

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
RARA-PML RARA-PML-Isoform1 - - - -RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
3) zf-B_box
4) DUF3583
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
3) zf-B_box
RARA-PML RARA-PML-Isoform2 - - - -RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
3) zf-B_box
4) DUF3583
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
3) zf-B_box
RARA-PML RARA-PML-Isoform3 - - - -RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
3) zf-B_box
4) DUF3583
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
3) zf-B_box
RARA-PML RARA-PML-Isoform4 - - - -RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
3) zf-B_box
4) DUF3583
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
3) zf-B_box

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
RARA-PML hsa-miR-335-5phsa-miR-423-3phsa-miR-378a-3p hsa-miR-125a-5phsa-miR-218-5phsa-miR-615-3phsa-miR-138-5p Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
RARA-PML NM_000964.3 1) RXR/RAR_HUMAN
2) MITF_HUMAN
3) STAT1_HUMAN
4) RB1_HUMAN
5) RBL2_HUMAN
6) RUNX1_HUMAN
7) PRDM14_HUMAN
8) ESTROGEN RECEPTOR ALPHA_HUMAN
9) ETS1_HUMAN
10) EGR1_HUMAN
11) FOS_HUMAN
12) GATA2_HUMAN
13) GATA3_HUMAN
14) CTCF_HUMAN
15) BRG1_HUMAN
16) HNF4A_HUMAN
17) TFAP2C_HUMAN
18) FOXA1_HUMAN
19) CEBPA_HUMAN
20) ESR1_HUMAN
21) ESR2_HUMAN
22) FOXP1_HUMAN
23) NR1H3_HUMAN
24) SPI1_HUMAN
- 1) 16081280
2) 21258399
3) 19122651
4) 20385362
5) 20385362
6) 20019798
7) 20953172
8) 20547749
9) 20019798
10) 20690147
11) 20139302
12) 21808000
13) 21878914
14) 21795385
15) 19505939
16) 21646355
17) 21572391
18) 21572391
19) 20219941
20) 20348243
21) 21235772
22) 21924763
23) 22292898
24) 21241896

TicDB

Top
The fusion gene pair RARA--PML information is not available in TicDB.

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair RARA--PML information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
LAML AB-2823-03A RARA__PML 0.15 17:38487648/1 15:74317198/1 tier1 In-frame 14320 NA
LAML AB-2840-03A RARA__PML 0.15 17:38487648/1 15:74317198/1 tier1 In-frame 14321 NA
LAML AB-2841-03B RARA__PML 0.15 17:38487648/1 15:74326819/1 tier1 In-frame 14322 NA
LAML AB-2872-03A RARA__PML 0.15 17:38487648/1 15:74326819/1 tier1 In-frame 14323 NA
LAML AB-2980-03A RARA__PML 0.15 17:38487648/1 15:74317198/1 tier1 In-frame 14324 validated
LAML AB-2991-03A RARA__PML 0.15 17:38487648/1 15:74317198/1 tier4 In-frame 14325 validated
LAML AB-2994-03A RARA__PML 0.15 17:38487648/1 15:74326819/1 tier1 In-frame 14326 non-validated
LAML AB-2998-03A RARA__PML 0.15 17:38487648/1 15:74325497/1 tier1 Out-of-frame 14327 non-validated
LAML AB-3001-03A RARA__PML 0.15 17:38487648/1 15:74317198/1 tier1 In-frame 14328 NA
LAML AB-3007-03A RARA__PML 0.15 17:38487648/1 15:74317198/1 tier1 In-frame 14329 validated
LAML AB-3012-03A RARA__PML 0.15 17:38499119/1 15:74326819/1 tier1 In-frame 14330 validated

FusionCancer

Top
The fusion gene pair RARA--PML information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair RARA--PML information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene RARA--PML has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene RARA--PML is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene RARA--PML is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene RARA--PML is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene RARA--PML was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair RARA--PML information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene RARA--PML is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene RARA--PML has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene RARA is a known oncogene according to ONGENE database.


The tail gene PML is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene RARA is cancer associated according to Bushman Cancer Gene database.


The tail gene PML is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene RARA is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene PML is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene RARA--PML is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene RARA--PML is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair RARA--PML information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene RARA--PML is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene RARA--PML has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair RARA--PML information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair RARA--PML information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair RARA--PML is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
RARA--PMLDevelopment and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumorshttps://doi.org/10.1016/j.jmoldx.2018.03.007

Cortex_Dataset

Top
Fusion gene RARA--PML is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair RARA--PML information is not available in ChromothripsisDB database.