PML--RARA

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

PML RARA

COSMIC

The fusion gene pair PML--RARA information is available in COSMIC database.

Link
PML--RARA

ChimerKB

Top
The fusion gene pair PML--RARA information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
PML_RARA-/-/ -/-/ - hg18 acute promyelocytic leukemia - - Oncogene; Receptor; Transcription_Factor Mitelman
PML_RARA-/-/ -/-/ - hg18 acute myeloblastic leukemia - - Oncogene; Receptor; Transcription_Factor Mitelman
PML_RARA-/-/ -/-/ - hg18 acute myeloid leukemia - - Oncogene; Receptor; Transcription_Factor Mitelman
PML_RARA-/-/ -/-/ - hg18 biphenotypic leukemia - - Oncogene; Receptor; Transcription_Factor Mitelman
PML_RARA-/-/ -/-/ - hg18 chronic myeloid leukemia - - Oncogene; Receptor; Transcription_Factor Mitelman
PML_RARAchr15/74326146/+ chr17/38504568/+ Exonic hg19 - - - Oncogene; Receptor; Transcription_Factor GenBank
PML_RARAchr15/74326417/+ chr17/38504568/+ Exonic hg19 - - - Oncogene; Receptor; Transcription_Factor GenBank
PML_RARA-/390/ -/16895/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/487/ -/15630/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/489/ -/15630/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/596/ -/16516/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/598/ -/16520/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/661/ -/15142/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/669/ -/15144/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/688/ -/13325/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/763/ -/15406/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/861/ -/6204/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/872/ -/15342/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/877/ -/15344/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/945/ -/347/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/8336/ -/11408/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/8466/ -/16802/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/8473/ -/7680/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/8477/ -/16786/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/8479/ -/16181/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/8504/ -/456/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/9554/ -/16272/ Exonic hg18 - - - Oncogene; Receptor; Transcription_Factor TICdb
PML_RARA-/-/ -/-/ - hg18 acute promyelocytic leukemia - 2170850 Oncogene; Receptor; Transcription_Factor OMIM

ChimerPUB

Top
The fusion gene pair PML--RARA information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
PML_RARAt(15;17) / 8564566- - - The t(15;17) translocation, specifically associated with the human acute promyelocytic leukemia (APL), fuses the retinoic acid receptor alpha (RAR alpha) to a novel gene PML generating the hybrid protein PML-RAR. /// This observation suggested that the changes in the myeloblastin regulation by RA found in NB4 cells could be ascribed to the presence of the fusion protein PML-RAR.
PML_RARAt(15;17) / 24711541acute promyelocytic leukemia;leukemia - - Acute promyelocytic leukemia (APL) is epitomized by the chromosomal translocation t(15;17) and the resulting oncogenic fusion protein PML-RAR?.
PML_RARAt(3;21)(q26;q22) / t(15;17)(q22;q21) / 19027486acute promyelocytic leukemia;myelodysplastic syndrome;leukemia - - The rearranged gene created by this translocation encodes a chimeric protein PML-RARA that is a transcriptional repressor.
PML_RARA- 8095167acute promyelocytic leukemia;leukemia - - Human CD4 lymphocytes specifically recognize a peptide representing the fusion region of the hybrid protein pml/RAR alpha present in acute promyelocytic leukemia cells..

ChimerSEQ

Top
The fusion gene pair PML--RARA information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
PML_RARAchr15/74325755/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2803-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74317268/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2897-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74315749/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2823-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74315749/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2840-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74325755/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2862-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74325763/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2872-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74315749/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2980-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74315749/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2998-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74325056/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2999-03B Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74315749/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3001-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74317268/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-3012-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74315749/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2991-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74325755/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2982-03B Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74315749/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3007-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74315749/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3007-03A Oncogene; Receptor; Transcription_Factor FusionScan
PML_RARAchr15/74315748/+ chr17/38499047/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2823-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2823-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2840-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2980-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2991-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2998-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38499005/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3001-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3001-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38499005/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3001-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3007-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74315748/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-3007-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74317267/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2897-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325754/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2862-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325754/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2897-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325754/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2982-03B Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325754/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2982-03B Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325754/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2994-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325754/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2999-03B Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325762/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2862-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325762/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2872-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325762/+ chr17/38504567/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2994-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325861/+ chr17/38495607/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2897-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325947/+ chr17/38492306/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2872-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74326174/+ chr17/38494414/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2803-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74326442/+ chr17/38496872/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2982-03B Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74326459/+ chr17/38498831/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2994-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74326513/+ chr17/38502175/+ 15q24.1 17q21.2 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2862-03A Oncogene; Receptor; Transcription_Factor TopHat-Fusion
PML_RARAchr15/74325616/ chr17/38499056/ 15q24.1 17q21.2 Exonic hg19 - Inter-chr NA AJ417079 Oncogene; Receptor; Transcription_Factor ChiTaRs
PML_RARAchr15/74315749/ chr17/38504566/ 15q24.1 17q21.2 Exonic hg19 - Inter-chr NA M73779 Oncogene; Receptor; Transcription_Factor ChiTaRs
PML_RARAchr15/74325755/ chr17/38504566/ 15q24.1 17q21.2 Exonic hg19 - Inter-chr NA S50916 Oncogene; Receptor; Transcription_Factor ChiTaRs
PML_RARAchr15/74317268/ chr17/38504567/ 15q24.1 17q21.2 Exonic hg19 - Inter-chr NA EF535849 Oncogene; Receptor; Transcription_Factor ChiTaRs
PML_RARAchr15/74325755/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2803-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74315749/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2823-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74315749/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2840-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74325755/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2841-03B Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74325755/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2862-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74325755/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2872-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74325755/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2897-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74315749/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2980-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74325755/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2982-03B Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74315749/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2991-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74325755/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2994-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74315749/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2998-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74325755/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2999-03B Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74315749/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-3001-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74315749/+ chr17/38504568/+ 15q24.1 17q21.2 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-3007-03A Oncogene; Receptor; Transcription_Factor PRADA
PML_RARAchr15/74325609/ chr17/38503513/ 15q24.1 17q21.2 Exonic hg19 - Inter-chr acute promyelocytic leukemia AB067754 Oncogene; Receptor; Transcription_Factor ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair PML--RARA information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AJ417079PML--RARA PML15 74325497 74325616 + 1 115 100 RARA17 38499056 38504691 + 109 296 100
Human M73779PML--RARA PML15 74287088 74315749 + 1 1249 100 RARA17 38504566 38513046 + 1248 3028 100
Human S50916PML--RARA PML15 74325716 74325755 + 1 40 100 RARA17 38504566 38512511 + 39 1284 100
Human EF535849PML--RARA PML15 74315719 74317268 + 26 127 100 RARA17 38504567 38504657 + 127 216 100
Human AB067754PML--RARA PML15 74325017 74325609 + 1 153 100 RARA17 38503513 38504594 + 153 200 100

FARE-CAFE

Top
The fusion gene pair PML--RARA information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
PML-RARA A)T-Cell Acute Promyelocytic Leukemia,B)Acute promyelocytic leukemia,C)Acute Lympho blastic Leukemia,D)Acute Myelocytic Leukemia-M3 A)PCR,B)Immunofluorescence,APAAP,PCR,Immunocytochemical,C)FISH,Southern blot,SSCP,PCR,DNA sequencing,LDI-PCR,Western blot,RT-PCR,Exontrapping,RACE,G-Banding,D)FISH,DNA sequencing,RT-PCR,LT-PCR,BubblePCR,Southern blot,PCR t(15;17)(q22;q21) PubMed:12508246

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
PML-RARA PML-RARA-Isoform1 PML 74326444 1 1 RARA 38500972 1 0 AACTAAATGAAGCGTCTTTtAGCGTGGGTGTGCATATATA 12508246 _
PML-RARA PML-RARA-Isoform2 PML _ _ 1 RARA 38504566 1 0 AGTGGCGCCGGGGAGGCAGcCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATA 17960172 _
PML-RARA PML-RARA-Isoform3 PML 74329436 0 1 RARA 38504614 1 1 tgccacctggagaccgagatctgcaggagaaaggcctgggaaaaATCTtccctcgccaccccctctaccccgcatctacaagccttgctttg 19100514 _
PML-RARA PML-RARA-Isoform4 PML 74316105 0 1 RARA _ 1 _ ccaagcacttcaggaggttctcttaagcCagctgctctgctcggat 20633765 _
PML-RARA PML-RARA-Isoform5 PML 74325741 1 1 RARA 38504450 1 0 AGTGAGGTCTTCCTGCCCAACAGCAACCACGTGGCTGCCAGCAGTGGTGAGGCTG _ S76369
PML-RARA PML-RARA-Isoform6 PML 74326146 0 1 RARA 38504542 1 0 CATGACCTTAACTCTGCTCTCTCAGTCTGCCCCTCCCCTCTTCTCTCTCTAGCCA _ S76373
PML-RARA PML-RARA-Isoform7 PML 74326245 0 1 RARA 38503275 1 0 CTTCTATGAACACTGCCAGGCTGGTAGTCAGCCCCTGGTGTTCCCATGCTTCCTT _ S76375
PML-RARA PML-RARA-Isoform8 PML 74326270 0 1 RARA 38503251 1 0 GTAAGGGGGGAGGGTGGTAGCACATAGTAGTTGGGCAGGAGTTGAGGTTAACCCA _ S76379
PML-RARA PML-RARA-Isoform9 PML 74326354 0 1 RARA 38504168 1 0 GTCCCTCATTCTGACTGAGCCCTAGCCTTTCCCTCCCTCCTCTTCAAGCGTTAAC _ S76382
PML-RARA PML-RARA-Isoform10 PML 74326380 0 1 RARA 38504140 1 0 GTTTCCTCTGCCCCCAGCTTATGTCCCTTGGTCACACACTGAGCACTGACTGATA _ S76387
PML-RARA PML-RARA-Isoform11 PML 74326417 0 1 RARA 38502790 1 0 CAAATGCTATTGGTAATCGATGGGTTCTATTGTTACTGCTTTTACGTCTTGGAAA _ S76389
PML-RARA PML-RARA-Isoform12 PML _ _ 1 RARA _ 1 _ ACCTCACGTGGCCAGTGGCgAGTTGCGGTTAGGCCACGGT 12508246 _
PML-RARA PML-RARA-Isoform13 PML 74326451 0 1 RARA 38502765 1 0 CCCCTCCCCCCACCAGTCTGGATTGTCTAACTAAATGAAGCGTCTTTAACTCTAG _ S76395
PML-RARA PML-RARA-Isoform14 PML 74326542 0 1 RARA 38503025 1 0 TCAGGAGAGAATCTGCTGGGCTGGGGATGGCCAGGTAGCAGTTGTCAGGCCTCCT _ S76399
PML-RARA PML-RARA-Isoform15 PML 74326633 0 1 RARA 38502991 1 0 ACAGCAAGAAATTATGGAAACCCATTTGTGTTGGAGTGAAGAGCAGACGGCGGTG _ S76402
PML-RARA PML-RARA-Isoform16 PML 74325773 1 1 RARA 38488104 1 0 AGGTAGGGAGGTGGGTAGGGaGGAAGGCTGGCTGGAACCC 12508246 _
PML-RARA PML-RARA-Isoform17 PML 74326232 0 1 RARA _ 1 _ ATCTTCTATGAACACTGCCaCCAGCCA 12508246 _
PML-RARA PML-RARA-Isoform18 PML 74326617 1 1 RARA 38493851 1 0 TAAGGCACAGCAAGAAATTaAAAGCCACAGTTCTTATTCT 12508246 _
PML-RARA PML-RARA-Isoform19 PML 74316694 0 1 RARA 38487995 1 0 TCCACCTAGGTAGTGAATGtTCTTGACATTTGATGGAAAT 12508246 _
PML-RARA PML-RARA-Isoform20 PML 74315749 0 1 RARA 38504566 1 0 agctcttgcatcacccaggggaaagCcattgagacccagagcagcagttctgaagagatagtgcccagc 17454588 _
PML-RARA PML-RARA-Isoform21 PML 74325056 0 1 RARA 38504566 1 0 atcaaaggcccttcctatggagagCcattgagacccagagcagcagttctgaagagatagtgcccagc 17454588 _
PML-RARA PML-RARA-Isoform22 PML 74325755 0 1 RARA 38504566 1 0 gtggccagtggcgccggggaggcagCcattgagacccagagcagcagttctgaagagatagtgcccagc 17454588 _
PML-RARA PML-RARA-Isoform23 PML 74317198 0 1 RARA 38487648 1 0 _ _ _
PML-RARA PML-RARA-Isoform24 PML 74316694 0 1 RARA 38487995 1 0 _ _ _
PML-RARA PML-RARA-Isoform25 PML 74325743 1 1 RARA 38495330 1 0 _ _ _
PML-RARA PML-RARA-Isoform26 PML 74325773 0 1 RARA 38488104 1 0 _ _ _
PML-RARA PML-RARA-Isoform27 PML 74326443 0 1 RARA 38500971 1 0 _ _ _
PML-RARA PML-RARA-Isoform28 PML 74326310 0 1 RARA 38494759 1 0 _ _ _
PML-RARA PML-RARA-Isoform29 PML 74326232 0 1 RARA 38487628 1 1 _ _ _
PML-RARA PML-RARA-Isoform30 PML 74326617 0 1 RARA 38493852 1 0 _ _ _
PML-RARA PML-RARA-Isoform31 PML 74329436 0 1 RARA 38504614 1 0 _ _ _
PML-RARA PML-RARA-Isoform32 PML 74326416 0 1 RARA 38504195 1 0 _ _ _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
PML-RARA PML-RARA-Isoform1 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform2 - - 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
1) zf-B_box
2) DUF3583
-
PML-RARA PML-RARA-Isoform3 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform4 1) zf-B_box
2) DUF3583
1) zf-B_box
- -PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML-RARA PML-RARA-Isoform5 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform6 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform7 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform8 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform9 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform10 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform11 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform12 - - - -PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
1) zf-B_box
2) DUF3583
3) zf-C4
4) Hormone_recep
1) zf-B_box
2) zf-C4 , Hormone_recep
3) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML-RARA PML-RARA-Isoform13 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform14 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform15 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform16 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform17 1) zf-B_box
2) DUF3583
1) zf-B_box
- -PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML-RARA PML-RARA-Isoform18 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform19 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform20 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform21 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform22 1) zf-B_box
2) DUF3583
1) zf-B_box
1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform23 - - 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
1) zf-B_box
2) DUF3583
1) zf-B_box
PML-RARA PML-RARA-Isoform24 - - 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
1) zf-B_box
2) DUF3583
1) zf-B_box
PML-RARA PML-RARA-Isoform25 1) DUF3583
- 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform26 1) DUF3583
- 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform27 1) DUF3583
- 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform28 1) DUF3583
- 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform29 1) DUF3583
- 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform30 1) DUF3583
- 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform31 1) DUF3583
- 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -
PML-RARA PML-RARA-Isoform32 1) DUF3583
- 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
PML 1) zf-B_box
2) DUF3583
1) zf-B_box
RARA 1) zf-C4
2) Hormone_recep
1) zf-C4 , Hormone_recep
2) zf-C4 , Hormone_recep , fn3 , Arm , SRC-1
- -

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
PML-RARA hsa-miR-125a-5phsa-miR-218-5phsa-miR-615-3phsa-miR-138-5p hsa-miR-335-5phsa-miR-423-3phsa-miR-378a-3p Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
PML-RARA NM_002675.3 1) MITF_HUMAN
2) RB1_HUMAN
3) STAT1_HUMAN
4) RBL2_HUMAN
5) PRDM14_HUMAN
6) ESTROGEN RECEPTOR ALPHA_HUMAN
7) ETS1_HUMAN
8) FOS_HUMAN
9) CTCF_HUMAN
10) BRG1_HUMAN
11) ESR1_HUMAN
12) SPI1_HUMAN
1) RXR/RAR_HUMAN
2) RUNX1_HUMAN
3) EGR1_HUMAN
4) GATA2_HUMAN
5) GATA3_HUMAN
6) HNF4A_HUMAN
7) TFAP2C_HUMAN
8) FOXA1_HUMAN
9) CEBPA_HUMAN
10) ESR2_HUMAN
11) FOXP1_HUMAN
12) NR1H3_HUMAN
1) 21258399
2) 20385362
3) 19122651
4) 20385362
5) 20953172
6) 20547749
7) 20019798
8) 20139302
9) 21795385
10) 19505939
11) 21566084
12) 21241896

TicDB

Top
The fusion gene pair PML--RARA information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
PML RARA 12508246 AACTAAATGAAGCGTCTTTtAGCGTGGGTGTGCATATATA
PML RARA 12508246 ACCTCACGTGGCCAGTGGCgAGTTGCGGTTAGGCCACGGT
PML RARA 12508246 AGGTAGGGAGGTGGGTAGGGaGGAAGGCTGGCTGGAACCC
PML RARA 12508246 ATCTTCTATGAACACTGCCaCCAGCCA
PML RARA 12508246 TAAGGCACAGCAAGAAATTaAAAGCCACAGTTCTTATTCT
PML RARA 12508246 TCCACCTAGGTAGTGAATGtTCTTGACATTTGATGGAAAT
PML RARA 17454588 agctcttgcatcacccaggggaaagCcattgagacccagagcagcagttctgaagagatagtgcccagc
PML RARA 17454588 atcaaaggcccttcctatggagagCcattgagacccagagcagcagttctgaagagatagtgcccagc
PML RARA 17454588 gtggccagtggcgccggggaggcagCcattgagacccagagcagcagttctgaagagatagtgcccagc
PML RARA 17960172 AGTGGCGCCGGGGAGGCAGcCATTGAGACCCAGAGCAGCAGTTCTGAAGAGATA
PML RARA 19100514 tgccacctggagaccgagatctgcaggagaaaggcctgggaaaaATCTtccctcgccaccccctctaccccgcatctacaagccttgctttg
PML RARA 20633765 ccaagcacttcaggaggttctcttaagcCagctgctctgctcggat
PML RARA S57797 GGGGTACCCAGAATAATGGGCTTTTGGGGCCCTGGGGACTAACGCGTTGTGGTGATCAGCAGCTCGGAAGACTCAGATGC
PML RARA S76369 AGTGAGGTCTTCCTGCCCAACAGCAACCACGTGGCTGCCAGCAGTGGTGAGGCTG
PML RARA S76370 GCTGGGGAGTCCCAGTTTTCGGGGAGGCAGGTAGGGAGGTGGGTAGGGCAGTGGC
PML RARA S76372 CCGGACATAGTATTGAGGCCAGACAGACAGGGAGGCAGGTAGGGAGGTGGGTAGG
PML RARA S76373 CATGACCTTAACTCTGCTCTCTCAGTCTGCCCCTCCCCTCTTCTCTCTCTAGCCA
PML RARA S76375 CTTCTATGAACACTGCCAGGCTGGTAGTCAGCCCCTGGTGTTCCCATGCTTCCTT
PML RARA S76379 GTAAGGGGGGAGGGTGGTAGCACATAGTAGTTGGGCAGGAGTTGAGGTTAACCCA
PML RARA S76382 GTCCCTCATTCTGACTGAGCCCTAGCCTTTCCCTCCCTCCTCTTCAAGCGTTAAC
PML RARA S76387 GTTTCCTCTGCCCCCAGCTTATGTCCCTTGGTCACACACTGAGCACTGACTGATA
PML RARA S76389 CAAATGCTATTGGTAATCGATGGGTTCTATTGTTACTGCTTTTACGTCTTGGAAA
PML RARA S76395 CCCCTCCCCCCACCAGTCTGGATTGTCTAACTAAATGAAGCGTCTTTAACTCTAG
PML RARA S76399 TCAGGAGAGAATCTGCTGGGCTGGGGATGGCCAGGTAGCAGTTGTCAGGCCTCCT
PML RARA S76402 ACAGCAAGAAATTATGGAAACCCATTTGTGTTGGAGTGAAGAGCAGACGGCGGTG
PML RARA S76405 TGGGAGAAAACCAGGCCAGGGCAGTTGATTTGTGAATTACTCAAATCCAAATGCA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair PML--RARA information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
LAML AB-2803-03A PML__RARA 0.15 15:74325755/1 17:38504568/1 tier1 In-frame 13094 NA
LAML AB-2823-03A PML__RARA 0.15 15:74315749/1 17:38504568/1 tier1 In-frame 13095 NA
LAML AB-2840-03A PML__RARA 0.15 15:74315749/1 17:38504568/1 tier1 In-frame 13096 NA
LAML AB-2841-03B PML__RARA 0.15 15:74325755/1 17:38504568/1 tier1 In-frame 13097 NA
LAML AB-2862-03A PML__RARA 0.15 15:74325755/1 17:38504568/1 tier1 In-frame 13098 NA
LAML AB-2872-03A PML__RARA 0.15 15:74325755/1 17:38504568/1 tier1 In-frame 13099 NA
LAML AB-2897-03A PML__RARA 0.15 15:74325755/1 17:38504568/1 tier1 In-frame 13100 NA
LAML AB-2980-03A PML__RARA 0.15 15:74315749/1 17:38504568/1 tier1 In-frame 13101 validated
LAML AB-2982-03B PML__RARA 0.15 15:74325755/1 17:38504568/1 tier1 In-frame 13102 non-validated
LAML AB-2991-03A PML__RARA 0.15 15:74315749/1 17:38504568/1 tier1 In-frame 13103 validated
LAML AB-2994-03A PML__RARA 0.15 15:74325755/1 17:38504568/1 tier1 In-frame 13104 non-validated
LAML AB-2998-03A PML__RARA 0.15 15:74315749/1 17:38504568/1 tier1 In-frame 13105 validated
LAML AB-2999-03B PML__RARA 0.15 15:74325755/1 17:38504568/1 tier1 In-frame 13106 validated
LAML AB-3001-03A PML__RARA 0.15 15:74315749/1 17:38504568/1 tier1 In-frame 13107 NA
LAML AB-3007-03A PML__RARA 0.15 15:74315749/1 17:38504568/1 tier1 In-frame 13108 validated

FusionCancer

Top
The fusion gene pair PML--RARA information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair PML--RARA information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene PML--RARA has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene PML--RARA is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene PML--RARA is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene PML--RARA is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene PML--RARA was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair PML--RARA information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene PML--RARA is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene PML--RARA has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene PML is a known oncogene according to ONGENE database.


The tail gene RARA is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene PML is cancer associated according to Bushman Cancer Gene database.


The tail gene RARA is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene PML is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene RARA is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene PML--RARA is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene PML--RARA is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair PML--RARA information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene PML--RARA is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene PML--RARA has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair PML--RARA information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair PML--RARA information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair PML--RARA is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
PML--RARADevelopment and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumorshttps://doi.org/10.1016/j.jmoldx.2018.03.007
PML--RARADevelopment and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumorshttps://doi.org/10.1016/j.jmoldx.2018.03.007

Cortex_Dataset

Top
Fusion gene PML--RARA is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair PML--RARA information is not available in ChromothripsisDB database.