PICALM--MLLT10

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

PICALM MLLT10

COSMIC

The fusion gene pair PICALM--MLLT10 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair PICALM--MLLT10 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
PICALM_MLLT10-/0/ -/0/ Exonic hg18 - - - - TICdb
PICALM_MLLT10-/0/ -/33114/ Exonic hg18 - - - - TICdb

ChimerPUB

Top
The fusion gene pair PICALM--MLLT10 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
PICALM_MLLT10- 20875875acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia;sarcoma;lymphoma;hematologic malignanc FISH - Cases with the PICALM-MLLT10 fusion gene can involve a diagnostic dilemma for the following reasons: (1) the fusion gene occurs very rarely, (2) the cases do not have a distinct myeloid or lymphoid morphology and cells often appear immature, (3) cases usually have a mixed T-cell and myeloid phenotype, and (4) cases often have a mixed clinical presentation (e.g., mediastinal mass in a patient with AML). /// " Patients with various hematologic malignancies, including acute lymphoblastic leukemia (ALL), acute myeloblastic leukemia (AML), diffuse histiocytic lymphoma, and granulocytic sarcoma, have sometimes been shown to carry the PICALM-MLLT10 fusion gene (alias CALM-AF10) by various cytogenetic methodologies. " /// Acute leukemia with PICALM-MLLT10 fusion gene: diagnostic and treatment struggle.. /// "Routine acute leukemia fluorescence in situ hybridization panels do not include a probe for the PICALM-MLLT10 fusion gene, and therefore diagnosis can be made only when karyotyping is available. " /// A 27-year-old woman was diagnosed with AML with the PICALM-MLLT10 fusion gene. /// "The case report and literature review here (including discussion of the poor prognosis and of management, including CNS prophylaxis) are intended to raise awareness and to inform about PICALM-MLLT10 in acute leukemia.. "
PICALM_MLLT10t(10;11)(p12-13;q14-21) / 22871473acute myeloid leukemia;myeloid leukemia;leukemia;B cell lymphoma;lymphoma - - The PICALM-MLLT10 fusion gene, generated by the t(10;11)(p12-13;q14-21) translocation, is a rare but recurrent event in acute leukemias. /// PICALM-MLLT10 acute myeloid leukemia: a French cohort of 18 patients.. /// Three out of four therapy-related PICALM-MLLT10 AMLs had been previously treated for diffuse large B-cell lymphoma. /// "In this study, we assessed the characteristics and outcome of 18 PICALM-MLLT10 AML patients. " /// "As compared with non PICALM-MLLT10 patients (n=72), PICALM-MLLT10 AML were characterized by more frequent extramedullary diseases, CD7 expression and higher platelet counts. " /// PICALM-MLLT10 patients had a shorter median overall survival than patients with favorable cytogenetics (12 months vs.
PICALM_MLLT10t(9;22)(q34;q11) / t(9;22) / t(10;11)(p13;q14) / 16518848acute myeloid leukemia PCR;RT-PCR - Acute monocytic leukemia with coexpression of minor BCR-ABL1 and PICALM-MLLT10 fusion genes along with overexpression of HOXA9.. /// RT-PCR enabled identification of PICALM-MLLT10 and BCR-ABL1 e1-a2 fusion transcripts. /// This case fits with and extends a recently proposed multistage AML model in which constitutive activation of tyrosine kinases by mutations (BCR-ABL1) are associated with deregulation of transcription factors central to myeloid differentiation (HOXA9 secondary to PICALM-MLLT10).. /// "We also identified overexpression of HOXA9, a gene essential to myeloid differentiation that is expressed in PICALM-MLLT10 and MLL-rearranged acute leukemias. "
PICALM_MLLT10t(1;19) / t(12;21) / t(8;21) / t(8;14) / t(9;22) / t(10;11) / t(15;17) / inv(16) / 15843827hematologic malignancy - - Using cDNA microarrays, we determined the gene expression profiles of 40 cell lines as well as of primary leukemias harboring 11q23/MLL rearrangements, t(1;19)[TCF3/PBX1], t(12;21)[ETV6/RUNX1], t(8;21)[RUNX1/CBFA2T1], t(8;14)[IGH@/MYC], t(8;14)[TRA@/MYC], t(9;22)[BCR/ABL1], t(10;11)[PICALM/MLLT10], t(15;17)[PML/RARA], or inv(16)[CBFB/MYH11].

ChimerSEQ

Top
The fusion gene pair PICALM--MLLT10 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
PICALM_MLLT10chr11/85685750/- chr10/21940601/+ 11q14.2 10p12.31 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2849-03A - FusionScan
PICALM_MLLT10chr11/85692228/ chr10/21875222/ 11q14.2 10p12.31 Exonic hg19 - Inter-chr NA AF060932 - ChiTaRs
PICALM_MLLT10chr11/85692263/ chr10/21959376/ 11q14.2 10p12.31 Exonic hg19 - Inter-chr NA EF051633 - ChiTaRs
PICALM_MLLT10chr11/85685751/- chr10/21940602/+ 11q14.2 10p12.31 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2849-03A - PRADA
PICALM_MLLT10chr11/85685751/- chr10/21940602/+ 11q14.2 10p12.31 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2855-03A - PRADA

ChiTaRS 2.1

Top
The fusion gene pair PICALM--MLLT10 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF060932PICALM--MLLT10 PICALM11 85692172 85692228 - 1 57 96.5 MLLT1010 21875222 21884296 + 57 149 100
Human EF051633PICALM--MLLT10 PICALM11 85685751 85692263 - 1 257 99.7 MLLT1010 21959376 21959425 + 256 305 98

FARE-CAFE

Top
The fusion gene pair PICALM--MLLT10 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
PICALM-MLLT10 Acute Lymphoblastic Leukemia FISH,Southern blot,SSCP,PCR,DNA sequencing,LDI-PCR,Western blot,RT-PCR,Exontrapping,RACE,G-Banding t(10;11)(p13;q14) PubMed: 10554802

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
PICALM-MLLT10 PICALM-MLLT10-Isoform1 PICALM 85692192 1 0 MLLT10 21940601 1 0 GCTTGGAATGCTGCAACAATgAAATATAAAGAGAAGGACAAA 10554802 _
PICALM-MLLT10 PICALM-MLLT10-Isoform2 PICALM 85692228 1 0 MLLT10 21884259 1 0 GGATCTAACTGCGAACCAAAGGTTGCACCAACAACCGCTTGGAATGCTGCAACAATGGTTGGGCCCATGTGGTTTGTGCCCTGTATATTCCAGA _ AF060933
PICALM-MLLT10 PICALM-MLLT10-Isoform3 PICALM 85692192 1 0 MLLT10 21875222 1 0 GCTTGGAATGCTGCAACAATgAGATGTGAACTTTGTCCCCAT 10554802 _
PICALM-MLLT10 PICALM-MLLT10-Isoform4 PICALM 85687686 0 0 MLLT10 21875223 1 0 GGCATGATAGGATATGGAATtAGATGTGAACTTTGTCCCCAT 10554802 _
PICALM-MLLT10 PICALM-MLLT10-Isoform5 PICALM 85685771 1 0 MLLT10 21959376 1 1 GGCCCTGTATCAGGAGCACAgACTTATACAAGCACTAGCAAC 10554802 _
PICALM-MLLT10 PICALM-MLLT10-Isoform6 PICALM 85685771 1 0 MLLT10 21875221 1 0 GGCCCTGTATCAGGAGCACAgAGATGTGAACTTTGTCCCCAT 10554802 _
PICALM-MLLT10 PICALM-MLLT10-Isoform7 PICALM _ _ 0 MLLT10 _ 1 _ GCAGCCAGAGTGATACAGTTTATGTAA 12555219 _
PICALM-MLLT10 PICALM-MLLT10-Isoform8 PICALM _ _ 0 MLLT10 _ 1 _ GCAGCCAGAGTgCCTCCACAAATGGGA 12555219 _
PICALM-MLLT10 PICALM-MLLT10-Isoform9 PICALM _ _ 0 MLLT10 _ 1 _ GCAGCCAGAGTgGCACCCCCTGTAATG 12555219 _
PICALM-MLLT10 PICALM-MLLT10-Isoform10 PICALM 85685857 0 0 MLLT10 21823678 1 1 CGAGAACCCGCTGGTTTATTGCGACGGGCACGGCTGCAGCGTCGCGGTGCATCAAGCTTGCTATGGCATTGTTCAAGTACCCACTGGACCGTGGTTTTGCAGGAAATGTGAATCTCAGGAGAGAGCAGCCAGAGTGTTATTGCTTACTGTGAGCTAAGACAGTTTTGCCTAACCTCGAAGTCATGAAGCCTCCACAAATGGGAAGTGTTCCTGTAATGACGCAACCAACCTTAATATACAGCCAGCCTGTCATGAGACCTCCAAACCCCTTTGGCCCTGTATCAGGAGCACAGATACAGTTTATGTAACTTGATGGAAGAAAATGGAATTACTCCAAAAAGACAAGTGCTCAAGCAGCAAAATCCTT _ AF060929

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
PICALM-MLLT10 PICALM-MLLT10-Isoform1 - - - -PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
2) PHD_2
3) zf-HC5HC2H_2
1) ANTH
2) PHD , Bromodomain , JmjC , RRM_1
PICALM-MLLT10 PICALM-MLLT10-Isoform2 - - 1) zf-HC5HC2H_2
-PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
2) PHD_2
1) ANTH
2) PHD , Bromodomain , JmjC , RRM_1
PICALM-MLLT10 PICALM-MLLT10-Isoform3 - - 1) zf-HC5HC2H_2
-PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
2) PHD_2
1) ANTH
2) PHD , Bromodomain , JmjC , RRM_1
PICALM-MLLT10 PICALM-MLLT10-Isoform4 - - 1) zf-HC5HC2H_2
-PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
2) PHD_2
1) ANTH
2) PHD , Bromodomain , JmjC , RRM_1
PICALM-MLLT10 PICALM-MLLT10-Isoform5 - - - -PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
2) PHD_2
3) zf-HC5HC2H_2
1) ANTH
2) PHD , Bromodomain , JmjC , RRM_1
PICALM-MLLT10 PICALM-MLLT10-Isoform6 - - 1) zf-HC5HC2H_2
-PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
2) PHD_2
1) ANTH
2) PHD , Bromodomain , JmjC , RRM_1
PICALM-MLLT10 PICALM-MLLT10-Isoform7 - - - -PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
2) PHD_2
3) zf-HC5HC2H_2
1) ANTH
2) PHD , Bromodomain , JmjC , RRM_1
PICALM-MLLT10 PICALM-MLLT10-Isoform8 - - - -PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
2) PHD_2
3) zf-HC5HC2H_2
1) ANTH
2) PHD , Bromodomain , JmjC , RRM_1
PICALM-MLLT10 PICALM-MLLT10-Isoform9 - - - -PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
2) PHD_2
3) zf-HC5HC2H_2
1) ANTH
2) PHD , Bromodomain , JmjC , RRM_1
PICALM-MLLT10 PICALM-MLLT10-Isoform10 - - 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
PICALM 1) ANTH
1) ANTH
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) ANTH
1) ANTH

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
PICALM-MLLT10 hsa-miR-132-3p hsa-miR-1hsa-miR-155-5phsa-miR-124-3phsa-miR-98-5phsa-miR-30a-5p Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
PICALM-MLLT10 NM_001008660.2 1) MITF_HUMAN
2) STAT1_HUMAN
3) RB1_HUMAN
4) RBL2_HUMAN
5) PRDM14_HUMAN
6) ETS1_HUMAN
7) EGR1_HUMAN
8) FOS_HUMAN
9) GATA2_HUMAN
10) GATA3_HUMAN
11) CTCF_HUMAN
12) TAL1_HUMAN
13) BRG1_HUMAN
14) HNF4A_HUMAN
15) TFAP2C_HUMAN
16) FOXA1_HUMAN
17) CEBPA_HUMAN
18) ESR1_HUMAN
19) SETDB1_HUMAN
20) SPI1_HUMAN
21) TRIM24_HUMAN
22) VDR_HUMAN
- 1) 21258399
2) 19122651
3) 20385362
4) 20385362
5) 20953172
6) 20019798
7) 20690147
8) 20139302
9) 21808000
10) 21878914
11) 21795385
12) 21795385
13) 19505939
14) 21646355
15) 21572391
16) 21572391
17) 20219941
18) 21235772
19) 21430779
20) 21241896
21) 21164480
22) 21846776

TicDB

Top
The fusion gene pair PICALM--MLLT10 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
PICALM MLLT10 10554802 GCTTGGAATGCTGCAACAATgAAATATAAAGAGAAGGACAAA
PICALM MLLT10 10554802 GCTTGGAATGCTGCAACAATgAGATGTGAACTTTGTCCCCAT
PICALM MLLT10 10554802 GGCATGATAGGATATGGAATtAGATGTGAACTTTGTCCCCAT
PICALM MLLT10 10554802 GGCCCTGTATCAGGAGCACAgACTTATACAAGCACTAGCAAC
PICALM MLLT10 10554802 GGCCCTGTATCAGGAGCACAgAGATGTGAACTTTGTCCCCAT
PICALM MLLT10 12555219 GCAGCCAGAGTGATACAGTTTATGTAA
PICALM MLLT10 12555219 GCAGCCAGAGTgCCTCCACAAATGGGA
PICALM MLLT10 12555219 GCAGCCAGAGTgGCACCCCCTGTAATG
PICALM MLLT10 AF060929 CGAGAACCCGCTGGTTTATTGCGACGGGCACGGCTGCAGCGTCGCGGTGCATCAAGCTTGCTATGGCATTGTTCAAGTACCCACTGGACCGTGGTTTTGCAGGAAATGTGAATCTCAGGAGAGAGCAGCCAGAGTGTTATTGCTTACTGTGAGCTAAGACAGTTTTGCCTAACCTCGAAGTCATGAAGCCTCCACAAATGGGAAGTGTTCCTGTAATGACGCAACCAACCTTAATATACAGCCAGCCTGTCATGAGACCTCCAAACCCCTTTGGCCCTGTATCAGGAGCACAGATACAGTTTATGTAACTTGATGGAAGAAAATGGAATTACTCCAAAAAGACAAGTGCTCAAGCAGCAAAATCCTT
PICALM MLLT10 AF060933 GGATCTAACTGCGAACCAAAGGTTGCACCAACAACCGCTTGGAATGCTGCAACAATGGTTGGGCCCATGTGGTTTGTGCCCTGTATATTCCAGA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair PICALM--MLLT10 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
LAML AB-2849-03A PICALM__MLLT10 0.66 11:85685751/-1 10:21940602/1 tier1 In-frame 12800 NA
LAML AB-2855-03A PICALM__MLLT10 0.66 11:85685751/-1 10:21940602/1 tier1 In-frame 12801 NA

FusionCancer

Top
The fusion gene pair PICALM--MLLT10 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair PICALM--MLLT10 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene PICALM--MLLT10 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene PICALM--MLLT10 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene PICALM--MLLT10 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene PICALM--MLLT10 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene PICALM--MLLT10 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair PICALM--MLLT10 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene PICALM--MLLT10 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene PICALM--MLLT10 has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene PICALM is not a known oncogene according to ONGENE database.
The tail gene MLLT10 is not a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene PICALM is cancer associated according to Bushman Cancer Gene database.


The tail gene MLLT10 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene PICALM is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene MLLT10 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene PICALM--MLLT10 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene PICALM--MLLT10 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair PICALM--MLLT10 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene PICALM--MLLT10 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene PICALM--MLLT10 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair PICALM--MLLT10 information is available in Klijn Dataset.

Cell lineGene 5'Gene 3'Read evidenceKinaseChromosome 5'Position 5'Chromosome 3'Position 3'Fusion type DNAFusion type RNAFusion protein lengthTissueKnown Fusion
U-937PICALMMLLT107N11856857511021875223TranslocinFrame1636LymphoidFull fusion known

Fimereli_Dataset

Top
The fusion gene pair PICALM--MLLT10 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair PICALM--MLLT10 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene PICALM--MLLT10 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair PICALM--MLLT10 information is not available in ChromothripsisDB database.