PAX3--FOXO1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

PAX3 FOXO1

COSMIC

The fusion gene pair PAX3--FOXO1 information is available in COSMIC database.

Link
PAX3--FOXO1

ChimerKB

Top
The fusion gene pair PAX3--FOXO1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
PAX3_FOXO1-/1539/ -/1016/ Exonic hg19 - - - Oncogene; Tumor_suppressor; Cosmic_recurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 7530783 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 small round cell tumor - 7530783 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 7495283 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 biphenotypic sarcoma - 9490279 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 7887445 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 ectomesenchymoma - 7887445 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 9164192 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 8275086 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 sarcoma - 8275086 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 9543674 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 10063718 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 10718207 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 sarcoma - 10718207 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 11745240 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 12039929 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 15085762 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 15630526 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 16337856 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 16645206 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 16607381 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 17478770 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 7536457 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 12183429 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 15313887 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 17613043 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 11556833 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 10700864 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 8221646 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 12850375 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 18705836 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 18303411 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 18988640 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 18788887 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 19175284 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg19 rhabdomyosarcoma - 20470941 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
PAX3_FOXO1-/-/ -/-/ - hg18 alveolar rhabdomyosarcoma - - Oncogene; Tumor_suppressor; Mitelman
PAX3_FOXO1-/-/ -/-/ - hg18 alveolar rhabdomyosarcoma - 3691179 Oncogene; Tumor_suppressor; OMIM
PAX3_FOXO1-/-/ -/-/ - hg18 alveolar rhabdomyosarcoma - 8098985 Oncogene; Tumor_suppressor; OMIM
PAX3_FOXO1-/-/ -/-/ - hg18 alveolar rhabdomyosarcoma - 8275086 Oncogene; Tumor_suppressor; OMIM
PAX3_FOXO1-/-/ -/-/ - hg18 alveolar rhabdomyosarcoma - 9479491 Oncogene; Tumor_suppressor; OMIM

ChimerPUB

Top
The fusion gene pair PAX3--FOXO1 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
PAX3_FOXO1t(2;13)(q35;q14) / t(1;13)(p36;q14) / 19704258liposarcoma;ewing sarcoma;rhabdomyosarcoma;neuroectodermal tumor;neuroblastoma;sarcoma FISH - Alveolar rhabdomyosarcoma (ARMS) is an aggressive neoplasm with unique t(2;13)(q35;q14) or t(1;13)(p36;q14) chromosomal translocations, resulting in PAX3/FOXO1 and PAX7/FOXO1 fusion genes, in approximately 80% of cases.
PAX3_FOXO1t(2;13)(q35;q14) / 26316324rhabdomyosarcoma;sarcoma FISH - This well-described translocation produces the gene fusion product PAX3-FOXO1.
PAX3_FOXO1t(2;13)(q35;q14) / t(1;13)(p36;q14) / / 18303411rhabdomyosarcoma;sarcoma FISH;PCR;RT-PCR - Chromosomal translocations of t(2;13)(q35;q14) and t(1;13)(p36;q14), resulting in PAX3-FOXO1 (FKHR) and PAX7-FOXO1 (FKHR) gene fusions, have been found to be specific molecular markers for alveolar rhabdomyosarcomas (ARMS) and can be identified in approximately 80% cases. /// A home-brew RT-PCR that could detect both PAX3-FOXO1 and PAX7-FOXO1 was also performed.
PAX3_FOXO1- 22089931rhabdomyosarcoma;sarcoma FISH - In pediatric alveolar rhabdomyosarcoma, the PAX3-FOXO1 and PAX7-FOXO1 gene fusions are prognostic indicators, while little is known concerning this disease in older patients. /// " In pediatric alveolar rhabdomyosarcoma, the PAX3-FOXO1 and PAX7-FOXO1 gene fusions are prognostic indicators, while little is known concerning this disease in older patients. " /// "Fifty-two percent of the samples exhibited a PAX3-FOXO1 fusion, 15% the PAX7-FOXO1 fusion, and 33% were negative for a rearrangement of these loci. "
PAX3_FOXO1t(2;13)(q35;q14) / t(1;13)(p36;q14) / 19215790rhabdomyosarcoma;sarcoma FISH - These translocations produce the PAX3-FOXO1 and PAX7-FOXO1 fusion genes, respectively.
PAX3_FOXO1- 21220470rhabdomyosarcoma;sarcoma FISH;PCR - This study determined the molecular characteristics and clinical significance of amplification of the 13q31 chromosomal region in alveolar rhabdomyosarcoma (ARMS), an aggressive pediatric cancer with frequent PAX3-FOXO1 and PAX7-FOXO1 gene fusions.
PAX3_FOXO1t(2;13)(q35;q14) / t(1;13)(p36;q14) / t(8;13;9) / p11.2;q14;9 / 8p12p11.2 / 21666686rhabdomyosarcoma;sarcoma FISH - Approximately 80% of alveolar rhabdomyosarcoma carry two signature chromosomal translocations, t(2;13)(q35;q14) resulting in PAX3-FOXO1 fusion, and t(1;13)(p36;q14) resulting in PAX7-FOXO1 fusion.
PAX3_FOXO1- 25912319rhabdomyosarcoma;sarcoma FISH;PCR - All solid variant ARMS harbored FOXO1 gene rearrangements and PAX3-FOXO1 ARMS were detected to the exclusion of PAX7-FOXO1. /// "In 24 histologic ARMS tested for FISH or PCR, 83.3 % were translocation-positive (all for PAX3-FOXO1 by PCR) and included 3 histologic solid variants. "
PAX3_FOXO1- 25300797osteosarcoma FISH;PCR;RT-PCR - The identification of fusion genes such as SYT-SSX1/SSX2, PAX3-FOXO1, TPM3/TPM4-ALK and EWS-FLI1 in human sarcomas has provided important insight into the diagnosis and targeted therapy of sarcomas.
PAX3_FOXO1- 22447499rhabdomyosarcoma;sarcoma FISH - Expression studies demonstrated that the fusion transcripts were generally expressed at higher levels in amplified cases, and that the PAX7-FOXO1 fusion transcript was expressed at higher levels than the PAX3-FOXO1 fusion transcript.
PAX3_FOXO1- 24730567rhabdomyosarcoma;sarcoma FISH - On FISH testing, none of the 10 tumours exhibited RMS1 (PAX3-FOXO1) or RMS 2 (PAX7-FOXO1) fusion.
PAX3_FOXO1t(2;13) / t(1;13) / 21177767rhabdomyosarcoma;sarcoma - - Alveolar rhabdomyosarcoma (ARMS) is characterized by the t(2;13) or t(1;13) chromosomal translocations, which generate the PAX3-FOXO1 or PAX7-FOXO1 fusion genes, respectively. /// IRIZIO: a novel gene cooperating with PAX3-FOXO1 in alveolar rhabdomyosarcoma (ARMS).. /// "Tumors formed by Arf-/-/PAX3-FOXO1/MarX-library myoblasts contained an unknown cDNA, encoding the C-terminus of the Homo sapiens hypothetical protein, FLJ10404, herein named IRIZIO. " /// Expression of full length IRIZIO cDNA also cooperated with PAX3-FOXO1 in the transformation of Arf-/- myoblasts. /// "The oncogenic activity of PAX3-FOXO1 has been demonstrated in vitro and in vivo, yet expression of the fusion protein alone in primary myoblasts or a mouse model is insufficient for tumorigenic transformation. " /// "To identify genes cooperating with PAX3-FOXO1 in ARMS tumorigenesis, we generated a retroviral complementary DNA (cDNA) expression library from the Rh30 ARMS cell line. " /// Arf-/- myoblasts expressing PAX3-FOXO1 and the retroviral cDNA library rapidly formed tumors after subcutaneous injection into NOD-SCID mice. /// "To identify genes cooperating with PAX3-FOXO1 in ARMS tumorigenesis, we generated a retroviral complementary DNA (cDNA) expression library from the Rh30 ARMS cell line."
PAX3_FOXO1- 24618610rhabdomyosarcoma;sarcoma - - The majority of ARMS contain a PAX3-FOXO1 or PAX7-FOXO1 gene fusion, but about 20% do not.
PAX3_FOXO1t(2;13)(q35;q14) / 23206814rhabdomyosarcoma;sarcoma - - In contrast to ERMS, the majority of ARMS tumors carry one of several characteristic chromosomal translocations, such as t(2;13)(q35;q14), which results in the expression of a PAX3-FOXO1 fusion transcription factor. /// "In this review we discuss the genes that cooperate with PAX3-FOXO1, as well as the target genes of the fusion transcription factor that contribute to various aspects of ARMS tumorigenesis. "
PAX3_FOXO1- 22648271rhabdomyosarcoma;sarcoma - - The signature aRMS gene fusion product, PAX3-FOXO1, induced FGFR4 expression in primary human myoblasts.
PAX3_FOXO1t(2;2) / t(2;8) / t(2;13)(q35;q14) / t(1;13)(p36;q14) / t(2;2)(p23;q35) / t(2;8)(q35;q13) / 19953635rhabdomyosarcoma;sarcoma FISH;PCR;RT-PCR - The fusion oncoproteins PAX3-FOXO1 [t(2;13)(q35;q14)] and PAX7-FOXO1 [t(1;13)(p36;q14)] typify alveolar rhabdomyosarcoma (ARMS).
PAX3_FOXO1t(2;13)(q36;q14) / 26179572rhabdomyosarcoma;sarcoma FISH;PCR;RT-PCR - Molecular Cytogenetics Detect an Unbalanced t(2;13)(q36;q14) and PAX3-FOXO1 Fusion in Rhabdomyosarcoma With Mixed Embryonal/Alveolar Features.. /// "Fluorescence in situ hybridization (FISH) detected losses of 3'PAX3 and 5'FOXO1, suggesting they had undergone an unbalanced rearrangement that probably produced the PAX3-FOXO1 fusion. " /// "Double-color FISH and reverse transcription-polymerase chain reaction (RT-PCR) revealed PAX3-FOXO1, which is characteristic of high-risk RMS. "
PAX3_FOXO1t(2;13)(q35;q14) / t(1;13)(p36;q14) / / 18973919rhabdomyosarcoma;sarcoma;hematologic malignancy - - A valuable diagnostic aid and important prognostic parameter in alveolar rhabdomyosarcoma is the identification of PAX3-FOXO1 [t(2;13)(q35;q14)] or PAX7-FOXO1 [t(1;13)(p36;q14)] rearrangements. /// A valuable diagnostic aid and important prognostic parameter in alveolar rhabdomyosarcoma is the identification of PAX3-FOXO1 [t(2;13)(q35;q14)] or PAX7-FOXO1 [t(1;13)(p36;q14)] rearrangements.
PAX3_FOXO1- 18457914rhabdomyosarcoma;soft tissue sarcoma - - The PAX3-FOXO1 fusion gene, resulting from the stable reciprocal translocation of chromosomes 2 and 13, is a signature genetic change found only in aRMS, and thought to be responsible at least in part for its malignant phenotype. /// "This review will discuss the clinical significance of the PAX3-FOXO1 fusion gene, the pertinent historical and current models used to study its oncogenic contributions, the transcriptional targets that are thought to mediate these contributions, and the cellular mechanisms impacted by PAX3-FOXO1 that ultimately lead to aRMS.. " /// "This review will discuss the clinical significance of the PAX3-FOXO1 fusion gene, the pertinent historical and current models used to study its oncogenic contributions, the transcriptional targets that are thought to mediate these contributions, and the cellular mechanisms impacted by PAX3-FOXO1 that ultimately lead to aRMS.." /// PAX3-FOXO1 fusion gene in rhabdomyosarcoma..
PAX3_FOXO1- 19199574Waardenburg syndrome - - In humans, mutations in the PAX3 gene cause Waardenburg syndrome, whereas a chromosomal translocation that generates a PAX3-FOXO1 fusion gene is associated with the development of alveolar rhabdomyosarcoma.
PAX3_FOXO1- 22454413rhabdomyosarcoma;sarcoma - - A combined clinical and molecular risk-stratification scheme that incorporated the PAX3/FOXO1 fusion gene status was derived from 287 patients with RMS and evaluated. /// A combined clinical and molecular risk-stratification scheme that incorporated the PAX3/FOXO1 fusion gene status was derived from 287 patients with RMS and evaluated. /// "Furthermore, a new clinicomolecular risk score that incorporated fusion gene status (negative and PAX3/FOXO1 and PAX7/FOXO1 positive), Intergroup Rhabdomyosarcoma Study TNM stage, and age showed a significant increase in performance over the current risk-stratification scheme. " /// PAX3/FOXO1 fusion gene status is the key prognostic molecular marker in rhabdomyosarcoma and significantly improves current risk stratification.. /// A continuous risk score derived from the combination of clinical parameters with the presence or absence of PAX3/FOXO1 represents a robust approach to improving current risk-adapted therapy for RMS.. /// "Among nonmetastatic patients, patients who were PAX3/FOXO1 positive had a significantly poorer outcome compared with both alveolar-negative and PAX7/FOXO1-positive patients. "
PAX3_FOXO1t(2;13)(q35;q14) / 21440083rhabdomyosarcoma;sarcoma - - ARMS is primarily characterized by a t(2;13)(q35;q14) chromosomal translocation, which fuses the 5'-coding sequences of Pax3 with the 3'-coding sequence of the forkhead transcription factor FOXO1 generating the oncogenic fusion protein Pax3-FOXO1. /// "Taken together, our results allow us to propose a molecular model to describe the changing pattern of phosphorylation for Pax3 and the altered phosphorylation for Pax3-FOXO1 during early myogenic differentiation.." /// Identification of serines 201 and 209 as sites of Pax3 phosphorylation and the altered phosphorylation status of Pax3-FOXO1 during early myogenic differentiation. /// "Taken together, our results allow us to propose a molecular model to describe the changing pattern of phosphorylation for Pax3 and the altered phosphorylation for Pax3-FOXO1 during early myogenic differentiation.. " /// Identification of serines 201 and 209 as sites of Pax3 phosphorylation and the altered phosphorylation status of Pax3-FOXO1 during early myogenic differentiation.. /// "Using phospho-specific antibodies we demonstrate a changing pattern of phosphorylation at serines 201, 205, and 209 throughout early myogenic differentiation and that this pattern of phosphorylation is different for Pax3-FOXO1 in primary myoblasts and in several ARMS cell lines. " /// "We previously demonstrated that Pax3 and Pax3-FOXO1 are phosphorylated by the protein kinase CK2 at serine 205 in proliferating primary myoblasts and that this phosphorylation event is rapidly lost from Pax3, but not Pax3-FOXO1 upon the induction of differentiation. "
PAX3_FOXO1- 23032620rhabdomyosarcoma;sarcoma - - Questionable universal validity of PAX3/FOXO1 fusion gene status as molecular marker for improvement of risk stratification in rhabdomyosarcoma therapy..
PAX3_FOXO1- 26544916rhabdomyosarcoma;sarcoma - - GLI1 expression correlated with presence of the PAX3-FOXO1 fusion gene (P=0.040) and lymph node metastasis (P=0.034), and a significant association was found between GLI1 expression and overall survival (OS) (P=0.008).
PAX3_FOXO1- 24787670rhabdomyosarcoma;sarcoma - - FANCD2 is a potential therapeutic target and biomarker in alveolar rhabdomyosarcoma harboring the PAX3-FOXO1 fusion gene.. /// "In the second patient set, we show that on a protein level, FANCD2 expression correlates with PAX3-FOXO1 fusion gene and is strongly associated with phospho-P70S6K expression in cases with the fusion gene. " /// Alveolar rhabdomyosarcoma that harbors the PAX3-FOXO1 fusion gene (t-ARMS) is a common and lethal subtype of this childhood malignancy.
PAX3_FOXO1t(2;13) / 18414034rhabdomyosarcoma;sarcoma - - The t(2;13) translocation is characteristic of the pediatric muscle tumor, alveolar rhabdomyosarcoma, and produces the chimeric transcription factor, PAX3-FOXO1, that contains the DNA binding elements of PAX3 and the transcriptional activation domain of FOXO1. /// Guilt by association: PAX3-FOXO1 regulates gene expression through selective destabilization of the EGR1 transcription factor.. /// Experiments designed to determine how PAX3-FOXO1 expression contributes to the development of muscle cell-derived tumors resulted in the discovery that the fusion protein misregulates gene expression and interrupts myogenic differentiation through a unique gain of function mechanism.
PAX3_FOXO1- 26199390rhabdomyosarcoma;sarcoma - - CDK4 is preclinically validated as a therapeutic target in PAX3-FOXO1 fusion gene-positive rhabdomyosarcomas.
PAX3_FOXO1- 23435416rhabdomyosarcoma;sarcoma - - Here we show that JARID2, which encodes a protein known to recruit various complexes with histone-methylating activity to their target genes, is significantly overexpressed in RMS with PAX3-FOXO1 compared with the fusion gene-negative RMS (t-test. /// "JARID2 levels were altered by silencing or overexpressing PAX3-FOXO1 in RMS cell lines with and without the fusion gene, respectively. " /// "Therefore, JARID2 is a downstream effector of PAX3-FOXO1 that maintains an undifferentiated myogenic phenotype that is characteristic of RMS. " /// "Consistent with this, we demonstrated that JARID2 is a direct transcriptional target of the PAX3-FOXO1 fusion protein. " /// The alveolar subtype is frequently associated with a PAX3-FOXO1 fusion protein that is known to contribute to the undifferentiated myogenic phenotype of RMS cells. /// JARID2 is a direct target of the PAX3-FOXO1 fusion protein and inhibits myogenic differentiation of rhabdomyosarcoma cells..
PAX3_FOXO1- 23432728rhabdomyosarcoma;sarcoma - - The PAX3-FOXO1 oncoprotein in alveolar rhabdomyosarcoma (ARMS) is presented as a paradigm to examine therapeutic strategies for targeting sarcoma-associated fusion genes. /// This review discusses the role of PAX3-FOXO1 in ARMS tumors. /// "Besides evaluating various approaches to molecularly target PAX3-FOXO1 itself, this review highlights therapeutically attractive downstream genes activated by PAX3-FOXO1. " /// A call to ARMS: targeting the PAX3-FOXO1 gene in alveolar rhabdomyosarcoma..
PAX3_FOXO1- 26008753rhabdomyosarcoma;sarcoma - - There was no significant difference in the overall survival between patients with the positive and negative fusion gene, but there were indications of PAX3-FOXO1 being an unfavorable prognostic factor.. /// "Four eligible studies showed that PAX3-FOXO1 fusion variant may indicate a lower survival probability than PAX7-FOXO1, although the effect did not reach a level of statistical significance (pooled hazard ratios, 1.66; 95% CI, 0.95-2.89; p=0.07)." /// "Four eligible studies showed that PAX3-FOXO1 fusion variant may indicate a lower survival probability than PAX7-FOXO1, although the effect did not reach a level of statistical significance (pooled hazard ratios, 1.66. "
PAX3_FOXO1t(2;13) / 24089019rhabdomyosarcoma;sarcoma - - Importantly, both PAX3-FOXO1 RNA and protein could be detected in the samples of normal fetal muscle. /// "When constantly expressed, PAX3-FOXO1 interfered with the muscle differentiation process, which presumably contributes to tumorigenesis.. " /// "Here, we show that a chimeric RNA, PAX3-FOXO1, identical to that found in alveolar rhabdomyosarcoma, is transiently present in cells undergoing differentiation from pluripotent cells into skeletal muscle. " /// "A chimeric fusion RNA, PAX3-FOXO1, associated with alveolar rhabdomyosarcoma, is also present in normal non-cancer cells and tissues. " /// "Here, we show that a chimeric RNA, PAX3-FOXO1, identical to that found in alveolar rhabdomyosarcoma, is transiently present in cells undergoing differentiation from pluripotent cells into skeletal muscle."
PAX3_FOXO1- 23814486rhabdomyosarcoma;sarcoma - - We have shown that the proapoptotic BH3-only family member Noxa is upregulated by the PAX3-FOXO1 fusion transcription factor in a p53-independent manner. /// We therefore demonstrate that PAX3-FOXO1 up-regulation of Noxa represents an unanticipated aspect of ARMS tumor biology that creates a therapeutic window to allow induction of apoptosis in ARMS cells. /// PAX3-FOXO1 induces up-regulation of Noxa sensitizing alveolar rhabdomyosarcoma cells to apoptosis..
PAX3_FOXO1- 23469153rhabdomyosarcoma;sarcoma - - More than 80% of ARMSs harbor a PAX3-FOXO1 fusion transcription factor. /// More than 80% of ARMSs harbor a PAX3-FOXO1 fusion transcription factor. /// Here we report that inhibition of cyclin-dependent kinase 4 (Cdk4) by fascaplysin (a small molecule selective inhibitor of Cdk4/cyclin D1 that we identified in a screen for compounds that inhibit PAX3-FOXO1) led to inhibition of the transcriptional activity of PAX3-FOXO1 in ARMS cell line Rh30. /// Here we report that inhibition of cyclin-dependent kinase 4 (Cdk4) by fascaplysin (a small molecule selective inhibitor of Cdk4/cyclin D1 that we identified in a screen for compounds that inhibit PAX3-FOXO1) led to inhibition of the transcriptional activity of PAX3-FOXO1 in ARMS cell line Rh30. /// "Whereas fascaplysin did not affect the protein level of PAX3-FOXO1, it did increase the cytoplasmic level of PAX3-FOXO1 in a portion of cells." /// Cyclin-dependent kinase 4 phosphorylates and positively regulates PAX3-FOXO1 in human alveolar rhabdomyosarcoma cells.. /// This prompted us to examine the signaling pathways required to activate the function of PAX3-FOXO1 and to explore the functional interaction between the Ink4a/ARF and PAX3-FOXO1 signaling pathways. /// "Whereas fascaplysin did not affect the protein level of PAX3-FOXO1, it did increase the cytoplasmic level of PAX3-FOXO1 in a portion of cells. " /// Our findings indicate that Cdk4 phosphorylates and positively regulates PAX3-FOXO1 and suggest that inhibition of Cdk4 activity should be explored as a promising avenue for developing therapy for ARMS.. /// In vitro kinase assays revealed that Cdk4 directly phosphorylated PAX3-FOXO1 at Ser(430). /// "However, expression of PAX3-FOXO1 in muscle cells alone is not sufficient and requires the loss of function of Ink4a/ARF to promote malignant proliferation of muscle cells in vitro or initiate ARMS tumor formation in vivo. " /// "Consistent with this finding, activation of Cdk4 enhanced the activity of PAX3-FOXO1. "
PAX3_FOXO111p15.5 / 25768946rhabdomyosarcoma;sarcoma - - Moreover we predict that the PAX3-FOXO1 fusion event occurs earlier than the whole genome duplication.
PAX3_FOXO1- 24486246synovial sarcoma;rhabdomyosarcoma;desmoplastic small round cell tumor;ewing sarcoma;sarcoma PCR;RT-PCR - We found disagreement in only three samples: one ES/pPNET and one embryonal rhabdomyosarcoma harbor a PAX3-FOXO1 translocation (for ARMS), and one neuroepithelioma harboring a EWS-WT1 (for DSRCT).
PAX3_FOXO1- 23733015rhabdomyosarcoma;sarcoma - - Most ARMS express the PAX3-FOXO1 (P3F) fusion oncoprotein generated by the 2;13?chromosomal translocation. /// Identification of target genes of PAX3-FOXO1 in alveolar rhabdomyosarcoma. /// Identification of target genes of PAX3-FOXO1 in alveolar rhabdomyosarcoma..
PAX3_FOXO1- 19904978rhabdomyosarcoma;sarcoma - - Finally, we show that Pax3-FOXO1 is phosphorylated at Ser205 in a variety of translocation-containing ARMS cell lines.
PAX3_FOXO1- 25821947rhabdomyosarcoma;sarcoma - - We found that inhibiting the phosphorylation of PAX3-FOXO1 at Ser201 significantly reduced migration, invasion and proliferation in two independent ARMS tumor cell lines. /// "We found that inhibiting the phosphorylation of PAX3-FOXO1 at Ser201 significantly reduced migration, invasion and proliferation in two independent ARMS tumor cell lines. " /// Inhibiting phosphorylation of the oncogenic PAX3-FOXO1 reduces alveolar rhabdomyosarcoma phenotypes identifying novel therapy options.. /// "These results identify phosphorylation of PAX3-FOXO1, especially at Ser201, as a novel biological target that can be explored as a promising avenue for ARMS therapies. " /// "Along these lines, we demonstrated that PAX3-FOXO1 is phosphorylated at three specific sites and that its pattern of phosphorylation is altered relative to wild-type Pax3 throughout early myogenesis and in ARMS tumor cells. " /// "Consistent with these in vitro results, we demonstrate for the first time that PAX3-FOXO1 is phosphorylated at Ser201 and Ser205 in a primary tumor sample and in tumor cells actively invading the surrounding normal tissue. " /// This report is the first to demonstrate that the direct inhibition of PAX3-FOXO1 phosphorylation reduces ARMS tumor phenotypes in vitro and that these phosphorylation events are present in primary human ARMS tumors and invading tumor cells. /// " Patients with translocation-positive alveolar rhabdomyosarcoma (ARMS), an aggressive childhood tumor primarily characterized by the PAX3-FOXO1 oncogenic fusion protein, have a poor prognosis because of lack of therapies that specifically target ARMS tumors. " /// "To address this gap in knowledge, we used small molecule inhibitors or mutational analysis to specifically inhibit phosphorylation of PAX3-FOXO1 to investigate how altering phosphorylation of the oncogenic fusion protein affects ARMS phenotypes." /// "To address this gap in knowledge, we used small molecule inhibitors or mutational analysis to specifically inhibit phosphorylation of PAX3-FOXO1 to investigate how altering phosphorylation of the oncogenic fusion protein affects ARMS phenotypes. "
PAX3_FOXO1- 24107448rhabdomyosarcoma;sarcoma - - In this study, we screened small molecule chemical libraries for inhibitors of PAX3-FOXO1 transcriptional activity using a cell-based readout system. /// "In this study, we screened small molecule chemical libraries for inhibitors of PAX3-FOXO1 transcriptional activity using a cell-based readout system. " /// "The hallmark of the majority of alveolar rhabdomyosarcoma is a chromosomal translocation that generates the PAX3-FOXO1 fusion protein, which is an oncogenic transcription factor responsible for the development of the malignant phenotype of this tumor. " /// "Alveolar rhabdomyosarcoma cells are dependent on the oncogenic activity of PAX3-FOXO1, and its expression status in alveolar rhabdomyosarcoma tumors correlates with worst patient outcome, suggesting that blocking this activity of PAX3-FOXO1 may be an attractive therapeutic strategy against this fusion-positive disease. " /// These data reveal that thapsigargin-induced activation of AKT is an effective mechanism to inhibit PAX3-FOXO1 and a potential agent for targeted therapy against alveolar rhabdomyosarcoma.. /// We identified the Sarco/endoplasmic reticulum Ca(2+)-ATPases (SERCA) inhibitor thapsigargin as an effective inhibitor of PAX3-FOXO1. /// Small molecule inhibition of PAX3-FOXO1 through AKT activation suppresses malignant phenotypes of alveolar rhabdomyosarcoma.. /// "Furthermore, thapsigargin inhibited the binding of PAX3-FOXO1 to target genes and subsequently promoted its proteasomal degradation. " /// Subsequent experiments in alveolar rhabdomyosarcoma cells showed that activation of AKT by thapsigargin inhibited PAX3-FOXO1 activity via phosphorylation.
PAX3_FOXO1- 17986608rhabdomyosarcoma;sarcoma - - This defect is caused by reduced levels of the EGR1 transcriptional activator resulting from a direct, destabilizing interaction with PAX3-FOXO1. /// "To understand how PAX3-FOXO1 contributes to tumor development, we isolated and characterized muscle cells from transgenic mice expressing PAX3-FOXO1 under control of the PAX3 promoter. " /// PAX3-FOXO1 controls expression of the p57Kip2 cell-cycle regulator through degradation of EGR1.. /// "The chimeric protein PAX3-FOXO1, resulting from a translocation between chromosomes 2 and 13, is the most common genetic aberration in the alveolar subtype of the human skeletal muscle tumor, rhabdomyosarcoma." /// " The chimeric protein PAX3-FOXO1, resulting from a translocation between chromosomes 2 and 13, is the most common genetic aberration in the alveolar subtype of the human skeletal muscle tumor, rhabdomyosarcoma. "
PAX3_FOXO1- 24797362rhabdomyosarcoma;sarcoma - - Moreover, Notch3 depletion reduces PAX3-FOXO1 alveolar RMS tumor growth in vivo. /// "Moreover, Notch3 depletion reduces PAX3-FOXO1 alveolar RMS tumor growth in vivo. " /// "The majority of alveolar RMS expresses PAX3-FOXO1 fusion oncoprotein, associated with the worst prognosis. "
PAX3_FOXO1- 24334454rhabdomyosarcoma;sarcoma - - Previously, we reported that PAX3-FOXO1 supports aRMS initiation by enabling bypass of cellular senescence checkpoints. /// "Despite its discovery nearly two decades ago, the mechanisms by which PAX3-FOXO1 drives tumor development are not well characterized. " /// "Additionally, we identify a mechanism used by PAX3-FOXO1 to inhibit MST1 signaling and promote tumorigenesis in aRMS. " /// Alveolar rhabdomyosarcoma-associated PAX3-FOXO1 promotes tumorigenesis via Hippo pathway suppression.. /// "Previously, we reported that PAX3-FOXO1 supports aRMS initiation by enabling bypass of cellular senescence checkpoints. " /// Alveolar rhabdomyosarcoma (aRMS) is an aggressive sarcoma of skeletal muscle characterized by expression of the paired box 3-forkhead box protein O1 (PAX3-FOXO1) fusion oncogene.
PAX3_FOXO1- 21882254rhabdomyosarcoma;sarcoma - - PAX3-FOXO1 and FGFR4 in alveolar rhabdomyosarcoma. /// PAX3-FOXO1 and FGFR4 in alveolar rhabdomyosarcoma.. /// "However, we demonstrate that enhanced expression of FGFR4 does not contribute to inhibited differentiation, enhanced proliferation, or transformation downstream of PAX3-FOXO1 in primary mouse myoblasts. " /// "We hypothesized fibroblast growth factor receptor 4 (FGFR4) may act as an effector of PAX3-FOXO1, contributing to PAX3-FOXO1 tumorigenic phenotypes. " /// Therefore we were unable to identify any contribution of up regulation of wild type FGFR4 to PAX3-FOXO1 driven tumorigenesis. /// " We and others have identified FGFR4 as a direct transcriptional target of the alveolar rhabdomyosarcoma (ARMS) specific fusion protein, PAX3-FOXO1. "
PAX3_FOXO1- 25398439alveolar rhabdomyosarcoma - - PLK1 phosphorylates PAX3-FOXO1, the inhibition of which triggers regression of alveolar Rhabdomyosarcoma.. /// "Mechanistically, PLK1 interacted with and phosphorylated PAX3-FOXO1 at the novel site S503, leading to protein stabilization. " /// "Notably, PLK1 inhibition led to elevated ubiquitination and rapid proteasomal degradation of the PAX3-FOXO1 chimeric oncoprotein." /// "Notably, PLK1 inhibition led to elevated ubiquitination and rapid proteasomal degradation of the PAX3-FOXO1 chimeric oncoprotein. "
PAX3_FOXO1- 24213577rhabdomyosarcoma;sarcoma - - Transcriptional derepression of F-box protein 32 (FBXO32) (Atrogin1/MAFbx), a gene associated with muscle homeostasis, was evidenced in PAX3-FOXO1 RMS cells silenced for EZH2. /// They also suggest that the reducing activity of EZH2 could represent a novel adjuvant strategy to eradicate high-risk PAX3-FOXO1 alveolar RMS. /// "Transcriptional derepression of F-box protein 32 (FBXO32) (Atrogin1/MAFbx), a gene associated with muscle homeostasis, was evidenced in PAX3-FOXO1 RMS cells silenced for EZH2. " /// "However, the role of EZH2 in the clinically aggressive subgroup of alveolar RMS, characterized by the expression of PAX3-FOXO1 oncoprotein, remains unknown. " /// "Collectively, these results indicate that EZH2 is a key factor in the proliferation and survival of PAX3-FOXO1 alveolar RMS cells working, at least in part, by repressing FBXO32. " /// The Polycomb group (PcG) protein EZH2 supports the survival of PAX3-FOXO1 alveolar rhabdomyosarcoma by repressing FBXO32 (Atrogin1/MAFbx).. /// "Simultaneous knockdown of FBXO32 and EZH2 in PAX3-FOXO1 RMS cells impaired the pro-apoptotic response, whereas the overexpression of FBXO32 facilitated programmed cell death in EZH2-depleted cells. "
PAX3_FOXO1- 23645752rhabdomyosarcoma;neuroblastoma;sarcoma - - The majority of alveolar rhabdomyosarcoma (ARMS) are distinguished through the paired box 3-forkhead box protein O1 (PAX3-FOXO1) fusion oncoprotein, being generated by a 2;13 chromosomal translocation. /// "Pulse-chase and cycloheximide experiments suggest that GREM1, DAPK1, and MYOD1 are directly regulated by PAX3-FOXO1." /// PAX3-FOXO1 appears to indirectly down-regulate HEY1 by up-regulating MYCN. /// Data reveal that the growth-suppressive activity of high PAX3-FOXO1 expression is closely-associated with up-regulation of the GREM1 and DAPK1 tumor-suppressor genes. /// "The present study characterized four genes [gremlin 1 (GREM1), death-associated protein kinase-1 (DAPK1), myogenic differentiation-1 (MYOD1), and hairy/enhancer-of-split related with YRPW motif-1 (HEY1)] as targets of PAX3-FOXO1. " /// The roles of PAX3-FOXO1 and MYCN expression were examined. /// This study characterized four downstream targets of PAX3-FOXO1 that contribute to the biological activities of growth suppression and myogenic differentiation.. /// "Pulse-chase and cycloheximide experiments suggest that GREM1, DAPK1, and MYOD1 are directly regulated by PAX3-FOXO1. " /// Regulation of target genes of PAX3-FOXO1 in alveolar rhabdomyosarcoma.. /// "The expression of the four genes, PAX3-FOXO1, and v-myc myelocytomatosis viral-related oncogene, neuroblastoma-derived (avian) (MYCN) was determined in various ARMS cell models and primary tumors. "
PAX3_FOXO1- 22037868rhabdomyosarcoma;sarcoma - - In primary myoblasts, Cnr1 was dispensable for PAX3-FOXO1 to mediate cell proliferation, differentiation, or transformation; however, Cnr1 function was essential to increase the invasive capacity conferred by PAX3-FOXO1 overexpression in these cells. /// "Here, we show that upregulation of the cannabinoid receptor 1 (Cnr1/Cb1) by PAX3-FOXO1 in mouse primary myoblasts and ARMS cell lines, contributes to PAX3-FOXO1 phenotypes, both in vivo and in vitro." /// Genetic or pharmacologic abrogation of Cnr1 inhibited the enhanced basement membrane invasion induced by PAX3-FOXO1.
PAX3_FOXO1t(2;13) / t(1;3) / 25659124- ISH - The reciprocal t(2;13)(q36.1;q14.1) in human alveolar rhabdomyosarcoma (A-RMS) creates a pathognomonic PAX3-FOXO1 fusion gene. /// "Indeed, more fusion genes were generated in fore limb myoblasts via a reciprocal t(1;3), which expressed correctly spliced Pax3-Foxo1 mRNA encoding Pax3-Foxo1 fusion protein. " /// "Given that the Pax3-Foxo1 fusion gene will contain all the regulatory sequences necessary for precise regulation of its expression, we propose that CRISPR-Cas9 provides a novel means to faithfully model human diseases caused by chromosome translocation in mice. " /// We tested if spatial proximity of the Pax3 and Foxo1 loci in myoblasts of mice homozygous for the inversion facilitated Pax3-Foxo1 fusion gene formation upon induction of targeted CRISPR-Cas9 nuclease-induced DNA double strand breaks in Pax3 and Foxo1. /// "In vivo mimicking of this translocation in mice is complicated by the fact that Pax3 and Foxo1 are in opposite orientation on their respective chromosomes, precluding formation of a functional Pax3-Foxo1 fusion via a simple translocation." /// "In vivo mimicking of this translocation in mice is complicated by the fact that Pax3 and Foxo1 are in opposite orientation on their respective chromosomes, precluding formation of a functional Pax3-Foxo1 fusion via a simple translocation. " /// Modeling of the human alveolar rhabdomyosarcoma Pax3-Foxo1 chromosome translocation in mouse myoblasts using CRISPR-Cas9 nuclease.. /// Fluorescent in situ hybridization indicated that fore limb myoblasts show a higher frequency of Pax3/Foxo1 co-localization than hind limb myoblasts. /// Fluorescent in situ hybridization indicated that fore limb myoblasts show a higher frequency of Pax3/Foxo1 co-localization than hind limb myoblasts.

ChimerSEQ

Top
The fusion gene pair PAX3--FOXO1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
PAX3_FOXO1chr2/223163334/ chr13/41133662/ 2q36.1 13q14.11 Exonic hg19 - Inter-chr NA EU446645 Oncogene; Tumor_suppressor; ChiTaRs
PAX3_FOXO1chr2/223163383/ chr13/41132547/ 2q36.1 13q14.11 Exonic hg19 - Inter-chr NA U02368 Oncogene; Tumor_suppressor; ChiTaRs
PAX3_FOXO1chr2/223159023/ chr13/41131736/ 2q36.1 13q14.11 Exonic hg19 - Inter-chr NA U02308 Oncogene; Tumor_suppressor; ChiTaRs
PAX3_FOXO1chr2/223163513/ chr13/41133053/ 2q36.1 13q14.11 Exonic hg19 - Inter-chr NA BC008826 Oncogene; Tumor_suppressor; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair PAX3--FOXO1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human EU446645PAX3--FOXO1 PAX32 223084859 223163334 - 23 1192 100 FOXO113 41133662 41135000 - 1190 2528 100
Human U02368PAX3--FOXO1 PAX32 223084859 223163383 - 1 1221 100 FOXO113 41132547 41135000 - 1219 3199 100
Human U02308PAX3--FOXO1 PAX32 223084859 223159023 - 5 732 99.5 FOXO113 41131736 41135000 - 730 3517 99.8
Human BC008826PAX3--FOXO1 PAX32 223084859 223163513 - 9 1357 100 FOXO113 41133053 41135000 - 1355 2827 100

FARE-CAFE

Top
The fusion gene pair PAX3--FOXO1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
PAX3-FOXO1 Rhabdomyo sarcoma RT-PCR,Southern blot t(2;13)(q35;q14) PubMed:19953635

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
PAX3-FOXO1 PAX3-FOXO1 PAX3 223084960 1 0 FOXO1 41134890 0 1 AGCACCAGGCATGGATTTTCCAGCTATACAGACAGCTTTGTGCCTCCGTCGGGGCCCTCCAACCCCATGAACCCCACCATTGGCAATGGCCTCTCACCTCAGAATTCAATTCGTCATAATCTGTCCCTACACAGCAAGTTCATTCGTGTGCAGAATGAAGGAACTGGAAAAAGTTCTTGGTGGATGCTCAATCCAGAGGGTGGCAAGAGC 8275086 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
PAX3-FOXO1 PAX3-FOXO1 1) Pax7
- 1) Fork_head
1) Fork_head , RHD
PAX3 1) PAX
1) Ets
FOXO1 1) Fork_head
1) Fork_head , RHD
- -

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
PAX3-FOXO1 hsa-miR-182-5phsa-miR-96-5phsa-miR-27a-3phsa-miR-186-5phsa-miR-183-5phsa-miR-153-3phsa-miR-9-5phsa-miR-223-3phsa-miR-335-5phsa-miR-98-5phsa-miR-106b-3phsa-miR-196a-5phsa-miR-15a-5p hsa-miR-1hsa-miR-206hsa-miR-27b-3phsa-miR-324-5phsa-let-7e-5phsa-let-7b-5p Report assay,Western Blot,Microarray,qPCR,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
PAX3-FOXO1 NM_000438.5 1) TRIM28_HUMAN
2) MITF_HUMAN
3) STAT1_HUMAN
4) PRDM14_HUMAN
5) EGR1_HUMAN
6) GATA3_HUMAN
7) SOX2_HUMAN
8) TFAP2C_HUMAN
9) FOXA1_HUMAN
10) CEBPA_HUMAN
11) CTCF_HUMAN
1) E2F4_HUMAN
2) ESTROGEN RECEPTOR ALPHA_HUMAN
3) FOS_HUMAN
4) GATA2_HUMAN
5) TAL1_HUMAN
6) BRG1_HUMAN
7) HNF4A_HUMAN
8) STAT6_HUMAN
9) ESR1_HUMAN
10) ESR2_HUMAN
11) SPI1_HUMAN
1) 17542650
2) 21258399
3) 19122651
4) 20953172
5) 20690147
6) 21878914
7) 21211035
8) 21572391
9) 21572391
10) 20219941
11) 20219941

TicDB

Top
The fusion gene pair PAX3--FOXO1 information is not available in TicDB.

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair PAX3--FOXO1 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair PAX3--FOXO1 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair PAX3--FOXO1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene PAX3--FOXO1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene PAX3--FOXO1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene PAX3--FOXO1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene PAX3--FOXO1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene PAX3--FOXO1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair PAX3--FOXO1 information is available in Babiceanu_Dataset (Recurrent chimeric fusion RNAs in non-cancer tissues and cells, Nucl. Acids Res. (2016), doi: 10.1093/nar/gkw032).

Sample_sourceUp_geneUp_chrUp_strandUp_Genome_posDown_geneDown_chrDown_strandDown_Genome_poslocus-locusFusion_TypeDown_fusion_part_frame-shift_or_not
MSC PAX3 chr2 - 223084859 FOXO1 chr13 - 41134997 E/E INTERCHR in-frame

Banned_Dataset

Top
Fusion gene PAX3--FOXO1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene PAX3--FOXO1 has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene PAX3 is a known oncogene according to ONGENE database.


The tail gene FOXO1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene PAX3 is cancer associated according to Bushman Cancer Gene database.


The tail gene FOXO1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene PAX3 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene FOXO1 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene PAX3--FOXO1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene PAX3--FOXO1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair PAX3--FOXO1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene PAX3--FOXO1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene PAX3--FOXO1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair PAX3--FOXO1 information is available in Klijn Dataset.

Cell lineGene 5'Gene 3'Read evidenceKinaseChromosome 5'Position 5'Chromosome 3'Position 3'Fusion type DNAFusion type RNAFusion protein lengthTissueKnown Fusion
SJCRH30PAX3FOXO153N22230848591341134997TranslocinFrame836SarcomatoidFull fusion known

Fimereli_Dataset

Top
The fusion gene pair PAX3--FOXO1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair PAX3--FOXO1 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
PAX3--FOXO1The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7
PAX3--FOXO1The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7
PAX3--FOXO1Development and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumorshttps://doi.org/10.1016/j.jmoldx.2018.03.007

Cortex_Dataset

Top
Fusion gene PAX3--FOXO1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair PAX3--FOXO1 information is not available in ChromothripsisDB database.