NPM1--ALK

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

NPM1 ALK

COSMIC

The fusion gene pair NPM1--ALK information is available in COSMIC database.

Link
NPM1--ALK

ChimerKB

Top
The fusion gene pair NPM1--ALK information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
NPM1_ALK-/487/ -/4080/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+192/ -/4080-616/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+201/ -/4080-24/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+230/ -/4080-1134/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+295/ -/4080-954/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+897/ -/4080-1511/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+443/ -/4080-1040/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+546/ -/4080-583/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+726/ -/4080-660/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+778/ -/4080-208/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+865/ -/4080-629/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/487+358/ -/4080-1128/ Exonic hg19 - - - Kinase; Oncogene; Transcription_Factor Cosmic_recurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 8122112 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 7780128 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 8616079 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 9777981 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 7662979 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 8558920 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 9598798 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 8781434 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 7772531 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 9450809 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 healty individual - 9886332 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 9517514 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 8683377 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 11178628 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 9250148 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 9209648 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 12401829 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 11215285 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 10555007 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 17464320 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 12816858 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 8562933 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 15921012 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 10552961 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 16651537 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 8701987 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 7579458 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 9844824 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 18776764 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 7856744 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 10192426 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 19131793 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 19135051 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 19545284 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 20658615 Kinase; Oncogene; Transcription_Factor Cosmic_nonrecurrent
NPM1_ALK-/-/ -/-/ - hg18 systemic anaplastic large cell lymphoma - - Kinase; Oncogene; Transcription_Factor Mitelman
NPM1_ALK-/-/ -/-/ - hg18 diffuse large cell lymphoma - - Kinase; Oncogene; Transcription_Factor Mitelman
NPM1_ALK-/-/ -/-/ - hg18 mature B cell neoplasms - - Kinase; Oncogene; Transcription_Factor Mitelman
NPM1_ALK-/-/ -/-/ - hg18 mature T and NK cell neoplasm - - Kinase; Oncogene; Transcription_Factor Mitelman
NPM1_ALK-/-/ -/-/ - hg18 peripheral T cell lymphoma - - Kinase; Oncogene; Transcription_Factor Mitelman
NPM1_ALK-/815/ -/1222/ Exonic hg18 - - - Kinase; Oncogene; Transcription_Factor TICdb
NPM1_ALK-/859/ -/1303/ Exonic hg18 - - - Kinase; Oncogene; Transcription_Factor TICdb
NPM1_ALK-/-/ -/-/ - hg18 lymphoma - - Kinase; Oncogene; Transcription_Factor OMIM
NPM1_ALK-/-/ -/-/ - hg18 non Hodgkin lymphoma - 8122112 Kinase; Oncogene; Transcription_Factor OMIM

ChimerPUB

Top
The fusion gene pair NPM1--ALK information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
NPM1_ALKt(2;5)(p23;q35) / 25961701anaplastic large cell lymphoma;lymphoma - - Although most commonly fused to the nucleophosmin (NPM1) gene on chromosome 5q35, which results in the t(2;5)(p23;q35)/NPM1-ALK translocation, several other ALK translocation partners have meanwhile been identified.
NPM1_ALKt(11;22)(q24;q12) / t(2;5)(p23;q35) / / 23568838anaplastic large cell lymphoma;ewing sarcoma;sarcoma;lymphoma - - We recovered both translocations with high efficiency, resulting in the expression of the EWSR1-FLI1 and NPM1-ALK fusions. /// "We recovered both translocations with high efficiency, resulting in the expression of the EWSR1-FLI1 and NPM1-ALK fusions. "
NPM1_ALK- 19545284anaplastic large cell lymphoma;lymphoma - - Distribution of NPM1-ALK and X-ALK fusion transcripts in paediatric anaplastic large cell lymphoma: a molecular-histological correlation.. /// "Reverse transcription polymerase chain reaction detected NPM1-ALK in 58 tumours, all showing nuclear and cytoplasmic ALK staining. " /// "Reverse transcription polymerase chain reaction detected NPM1-ALK in 58 tumours, all showing nuclear and cytoplasmic ALK staining." /// Almost 90% of paediatric ALK-positive ALCLs express NPM1-ALK.
NPM1_ALK- 25602801melanoma - - In addition to ALK fusions previously described in other tumor types (NPM1-ALK, TPR-ALK), we identified 2 novel ALK fusions (CLIP1-ALK and GTF3C2-ALK) in our cohort of Spitz tumors.
NPM1_ALK- 17922009- - - The DNA methylation is induced by NPM1-ALK itself via STAT3, and is associated with binding to the promoter of the gene encoding MeCP2 capping protein and with lack of binding of the STAT5A gene transcription activator SP1. /// STAT5A is epigenetically silenced by the tyrosine kinase NPM1-ALK and acts as a tumor suppressor by reciprocally inhibiting NPM1-ALK expression. /// Here we report that STAT5A expression is selectively inhibited by DNA methylation of the STAT5A gene promoter region in cells expressing the oncogenic tyrosine kinase NPM1-ALK (also known as NPM-ALK). /// STAT5A is epigenetically silenced by the tyrosine kinase NPM1-ALK and acts as a tumor suppressor by reciprocally inhibiting NPM1-ALK expression.. /// These results show that NPM1-ALK induces epigenetic silencing of STAT5A gene and that STAT5A protein can act as a key tumor suppressor by reciprocally inhibiting expression of NPM1-ALK.. /// "Notably, the induced or exogenously expressed STAT5A protein binds to the enhancer and intron 14 of the NPM1-ALK gene and triggers selective suppression of NPM1-ALK expression. "
NPM1_ALKt(2;3)(p23;q27) / / 20207848B cell lymphoma;lymphoma ISH - ALK-positive large B-cell lymphomas with cryptic SEC31A-ALK and NPM1-ALK fusions.

ChimerSEQ

Top
The fusion gene pair NPM1--ALK information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
NPM1_ALKchr5/170818803/ chr2/29416090/ 5q35.1 2p23.2 Exonic hg19 - Inter-chr NA U04946 Kinase; Oncogene; Transcription_Factor ChiTaRs
NPM1_ALKchr5/170818803/ chr2/29415642/ 5q35.1 2p23.2 Exonic hg19 - Inter-chr anaplastic large cell lymphoma;Hodgkin disease;npn Hodgkin lymphoma D45915 Kinase; Oncogene; Transcription_Factor ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair NPM1--ALK information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human D45915NPM1--ALK NPM15 170814864 170818803 + 1 441 100 ALK2 29415642 29446396 - 440 2584 99.6
Human U04946NPM1--ALK NPM15 170814953 170818803 + 1 352 100 ALK2 29416090 29446396 - 351 2043 100

FARE-CAFE

Top
The fusion gene pair NPM1--ALK information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
NPM1-ALK Anaplastic large cell lymphoma PCR,Western blot,FISH,DNA sequencing,RT-PCR,RACE t(2;3)(p23;q27) PubMed: 17922009

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
NPM1-ALK NPM1-ALK-Isoform1 NPM1 _ _ 1 ALK _ 0 _ cacttagtagTgtaccgccgg 20207848 _
NPM1-ALK NPM1-ALK-Isoform2 NPM1 170819668 0 1 ALK 29446939 0 0 TCTCAGTTTTTAGAGTCATTTACTATCAGTGTTCTTTTTTTTCTGACCCCTGGGCCAGCTGCACCCTCAAATCCACTGCTGTGATTGCACTGAAGCTGCCCTACCCAATGGCTGAGCACAGCAGAAATACTAAGGCAGGC _ S82725

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
NPM1-ALK NPM1-ALK-Isoform1 - - - -NPM1 1) Nucleoplasmin
1) Nucleoplasmin
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) Nucleoplasmin
2) MAM
3) Gly_rich
4) Pkinase_Tyr
1) Nucleoplasmin
2) ig , Astacin , MATH
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NPM1-ALK NPM1-ALK-Isoform2 1) Nucleoplasmin
1) Nucleoplasmin
1) MAM
2) Gly_rich
1) ig , Astacin , MATH
NPM1 1) Nucleoplasmin
1) Nucleoplasmin
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
- -

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
NPM1-ALK hsa-miR-132-3p hsa-miR-296-3phsa-miR-93-3phsa-miR-421hsa-miR-625-5phsa-miR-598-3phsa-miR-92b-3phsa-miR-193b-3phsa-miR-320ahsa-miR-149-5phsa-miR-125a-5phsa-miR-125b-5phsa-miR-23b-3phsa-miR-15b-5phsa-miR-93-5phsa-miR-92a-3phsa-miR-25-3p Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
NPM1-ALK NM_001037738.2 1) MITF_HUMAN
2) RB1_HUMAN
3) RBL2_HUMAN
4) E2F4_HUMAN
5) ETS1_HUMAN
6) GATA3_HUMAN
7) SOX2_HUMAN
8) CTCF_HUMAN
9) BRG1_HUMAN
10) STAT6_HUMAN
1) TRIM28_HUMAN
2) P53_HUMAN
3) RUNX1_HUMAN
4) PRDM14_HUMAN
5) ESTROGEN RECEPTOR ALPHA_HUMAN
6) EGR1_HUMAN
7) FOS_HUMAN
8) E2F1_HUMAN
9) HNF4A_HUMAN
10) TFAP2C_HUMAN
11) FOXA1_HUMAN
12) ESR1_HUMAN
13) NR1H3_HUMAN
14) SETDB1_HUMAN
1) 21258399
2) 20385362
3) 20385362
4) 21247883
5) 20019798
6) 21878914
7) 21211035
8) 21795385
9) 19505939
10) 21828071

TicDB

Top
The fusion gene pair NPM1--ALK information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
NPM1 ALK 20207848 cacttagtagTgtaccgccgg
NPM1 ALK AF032882 GTTAGGGAAACAGGGCAGGAGTTACCATCCCTGCCTACAGAGAGGGAAACTGCAGTCCAAAGAGGTCCTGTGACCTGGTCCTCATGGCTCAGCTTGTAAGTAACAAGAGGCGGAATTAGAGCACAGATCCCCAGACACCAATTCAGATCCTAGGAAGTCTCAGTTTTTAGAGTATTTACTATCAGTGTTCTTTTTTTTTCTGACTTCTTGCTGCTTGAGTTTTATAATGTCTAATAAATTGTATTTTAGCTGTGGAGGAAGATGCAGAGTCAGAAGATGA
NPM1 ALK S82725 TCTCAGTTTTTAGAGTCATTTACTATCAGTGTTCTTTTTTTTCTGACCCCTGGGCCAGCTGCACCCTCAAATCCACTGCTGTGATTGCACTGAAGCTGCCCTACCCAATGGCTGAGCACAGCAGAAATACTAAGGCAGGC

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair NPM1--ALK information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair NPM1--ALK information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair NPM1--ALK information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene NPM1--ALK has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene NPM1--ALK is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene NPM1--ALK is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene NPM1--ALK is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene NPM1--ALK was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair NPM1--ALK information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene NPM1--ALK is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene NPM1--ALK has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene NPM1 is a known oncogene according to ONGENE database.


The tail gene ALK is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene NPM1 is cancer associated according to Bushman Cancer Gene database.


The tail gene ALK is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene NPM1 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ALK is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene NPM1--ALK is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene NPM1--ALK is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair NPM1--ALK information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene NPM1--ALK is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene NPM1--ALK has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair NPM1--ALK information is available in Klijn Dataset.

Cell lineGene 5'Gene 3'Read evidenceKinaseChromosome 5'Position 5'Chromosome 3'Position 3'Fusion type DNAFusion type RNAFusion protein lengthTissueKnown Fusion
SRNPM1ALK124Y5170818803229446394TranslocinFrame680LymphoidFull fusion known
SU-DHL-1NPM1ALK66Y5170818803229446394TranslocinFrame680LymphoidFull fusion known

Fimereli_Dataset

Top
The fusion gene pair NPM1--ALK information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair NPM1--ALK is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
NPM1--ALKDevelopment and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumorshttps://doi.org/10.1016/j.jmoldx.2018.03.007

Cortex_Dataset

Top
Fusion gene NPM1--ALK is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair NPM1--ALK information is not available in ChromothripsisDB database.