NCOA4--RET

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

NCOA4 RET

COSMIC

The fusion gene pair NCOA4--RET information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair NCOA4--RET information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
NCOA4_RET-/1014/ -/2369/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
NCOA4_RET-/870+196/ -/2369-1570/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
NCOA4_RET-/1014+21/ -/2369-1591/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
NCOA4_RET-/996/ -/2369-?/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
NCOA4_RET-/1014+1186/ -/2273/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
NCOA4_RET-/870+42/ -/2369-1673/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 17464312 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 18226854 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 - - 19744101 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 goitre - 20703476 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid cancer - 20703476 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 20564403 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 18757433 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 21498916 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 20840674 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 non small cell lung cancer - 23150706 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid cancer - 23436219 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 8187085 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid carcinoma - 8806700 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 9482114 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid cancer - 8806699 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 12720532 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 16015630 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 11747322 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 chronic thyroiditis - 11747322 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid papillary carcinoma - 8290261 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 10083732 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 rhabdoid tumor - 15737050 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 11927965 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 goitre - 21411555 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 goitre - 21048359 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 15876154 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid cancer - 8545102 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 22481925 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 18393128 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 17727338 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 9516913 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 9528832 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid cancer - 9466701 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 11786418 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 10720057 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 chronic thyroiditis - 9001272 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary carcinoma - 9001272 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 goitre - 9001272 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 10946873 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid cancer - 15788648 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 goitre - 15788648 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 11443191 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 goitre - 11443191 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 follicular thyroid carcinoma - 14668719 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 10773666 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 goitre - 10773666 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 8180971 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 9935226 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 16595592 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 chronic thyroiditis - 16595592 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid cancer - 22745248 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid carcinoma - 23806056 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 goitre - 12057919 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 goitre - 21173509 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid nodules - 21173509 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid cancer - 22895275 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid cancer - 22961909 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 papillary thyroid cancer - 9669285 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 thyroid carcinoma - 25111330 Oncogene; Cosmic_nonrecurrent
NCOA4_RET-/-/ -/-/ - hg19 follicular variant papillary thyroid carcinoma - 16784981 Oncogene; Cosmic_nonrecurrent
NCOA4_RETchr10/51252946/ chr10/42932035/ Exonic hg18 - - - Oncogene; ChimerDB2
NCOA4_RET-/556/ -/1255/ Exonic hg18 - - - Oncogene; TICdb
NCOA4_RET-/990/ -/247/ Exonic hg18 - - - Oncogene; TICdb
NCOA4_RET-/1138/ -/754/ Exonic hg18 - - - Oncogene; TICdb
NCOA4_RET-/1187/ -/3396/ Exonic hg18 - - - Oncogene; TICdb
NCOA4_RET-/1308/ -/410/ Exonic hg18 - - - Oncogene; TICdb
NCOA4_RET-/1312/ -/410/ Exonic hg18 - - - Oncogene; TICdb
NCOA4_RET-/1430/ -/1136/ Exonic hg18 - - - Oncogene; TICdb
NCOA4_RET-/1516/ -/1333/ Exonic hg18 - - - Oncogene; TICdb

ChimerPUB

Top
The fusion gene pair NCOA4--RET information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
NCOA4_RET- 23856031lung cancer - - In cellular assays, lenvatinib inhibited auto-phosphorylation of KIF5B-RET, CCDC6-RET, and NcoA4-RET. /// "In cellular assays, lenvatinib inhibited auto-phosphorylation of KIF5B-RET, CCDC6-RET, and NcoA4-RET. "

ChimerSEQ

Top
The fusion gene pair NCOA4--RET information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
NCOA4_RETchr10/51582939/+ chr10/43612032/+ 10q11.23 10q11.21 Exonic hg19 In-frame Intra-chr THCA TCGA-CE-A482-01A Oncogene; PRADA
NCOA4_RETchr10/51582939/+ chr10/43612032/+ 10q11.23 10q11.21 Exonic hg19 In-frame Intra-chr THCA TCGA-DE-A3KN-01A Oncogene; PRADA
NCOA4_RETchr10/51582939/+ chr10/43612032/+ 10q11.23 10q11.21 Exonic hg19 In-frame Intra-chr THCA TCGA-EL-A3H3-01A Oncogene; PRADA
NCOA4_RETchr10/51582939/+ chr10/43612032/+ 10q11.23 10q11.21 Exonic hg19 In-frame Intra-chr THCA TCGA-EM-A2CU-01A Oncogene; PRADA

ChiTaRS 2.1

Top
The fusion gene pair NCOA4--RET information is not available in CHITARS database.

FARE-CAFE

Top
The fusion gene pair NCOA4--RET information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
NCOA4-RET Thyroid carcinomas RT-PCR,FISH _ PubMed:10597232

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
NCOA4-RET NCOA4-RET-Isoform1 NCOA4 _ _ 1 RET _ 1 _ ATCATGGCAGGCTTtATTCTGCTTACGCTT 10597232 _
NCOA4-RET NCOA4-RET-Isoform2 NCOA4 _ _ 1 RET _ 1 _ TCGAGACCATCCTGgGGGGGCCAGGGTGGG 10597232 _
NCOA4-RET NCOA4-RET-Isoform3 NCOA4 _ _ 1 RET _ 1 _ TGTCGACACTGACCTTgAATACAAAAAAAAAAA 10597232 _
NCOA4-RET NCOA4-RET-Isoform4 NCOA4 _ _ 1 RET _ 1 _ TTCCTACTAGCACTGtTGATCTGCCTGCCTC 10597232 _
NCOA4-RET NCOA4-RET-Isoform5 NCOA4 51584251 0 1 RET 43610593 1 0 AAATTTCAAAACACTGGGCAAGACAGTAAATATGCAGACAGGGCCCTGCCCCTTCAGTGTTCCTACTAGCACTGTCCAGG _ S74821
NCOA4-RET NCOA4-RET-Isoform6 NCOA4 _ _ 1 RET _ 1 _ CAGTCCCAAGTGGGCtGAAGCTGGGAGGCA 10597232 _
NCOA4-RET NCOA4-RET-Isoform7 NCOA4 _ _ 1 RET _ 1 _ CATCGGGCAGGGGAgTTTTTTAGTAGATACGG 10597232 _
NCOA4-RET NCOA4-RET-Isoform8 NCOA4 _ _ 1 RET _ 1 _ GAAAGTTTAGAAAAtAGAGACAGGCAGGTTC 10597232 _
NCOA4-RET NCOA4-RET-Isoform9 NCOA4 _ _ 1 RET _ 1 _ GCCTTCCCAGATGTGgTTTGATGACTTGCCT 10597232 _
NCOA4-RET NCOA4-RET-Isoform10 NCOA4 _ _ 1 RET _ 1 _ GCTGGGCAGACGAGGgAGGCAGAGCTTGCA 10597232 _
NCOA4-RET NCOA4-RET-Isoform11 NCOA4 _ _ 1 RET _ 1 _ GGCTTTGGCCTCCCtAGATTCTAATTCTGC 10597232 _
NCOA4-RET NCOA4-RET-Isoform12 NCOA4 _ _ 1 RET _ 1 _ GGTGTGAGCCAAGGaAGCTGGCGTGGTGG 10597232 _
NCOA4-RET NCOA4-RET-Isoform13 NCOA4 _ _ 1 RET _ 1 _ GTGGTGGCCTGCCcTCCTGCCTCAGCCTCC 10597232 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
NCOA4-RET NCOA4-RET-Isoform1 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform2 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform3 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform4 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform5 1) ARA70
- 1) Pkinase_Tyr
1) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) Cadherin
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
NCOA4-RET NCOA4-RET-Isoform6 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform7 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform8 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform9 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform10 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform11 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform12 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
NCOA4-RET NCOA4-RET-Isoform13 - - - -NCOA4 1) ARA70
-RET 1) Cadherin
2) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) ARA70
2) Cadherin
3) Pkinase_Tyr
1) LRR_4 , Cadherin , Lectin_C , Botulinum_HA-17 , RicinB_lectin_2
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
NCOA4-RET hsa-miR-31-5phsa-miR-29a-3phsa-miR-215-5phsa-miR-192-5p hsa-miR-93-3phsa-miR-484hsa-miR-365a-3p Report assay,qPCR,Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
NCOA4-RET NM_001145260.1 - 1) SOX10_HUMAN
2) TRIM28_HUMAN
3) MITF_HUMAN
4) STAT1_HUMAN
5) ZNF263_HUMAN
6) P53_HUMAN
7) ESTROGEN RECEPTOR ALPHA_HUMAN
8) EGR1_HUMAN
9) FOS_HUMAN
10) CTCF_HUMAN
11) BRG1_HUMAN
12) TFAP2C_HUMAN
13) FOXA1_HUMAN
14) ESR1_HUMAN
15) ESR2_HUMAN
16) FOXP1_HUMAN
17) SPI1_HUMAN
-

TicDB

Top
The fusion gene pair NCOA4--RET information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
NCOA4 RET 10597232 ATCATGGCAGGCTTtATTCTGCTTACGCTT
NCOA4 RET 10597232 CAGTCCCAAGTGGGCtGAAGCTGGGAGGCA
NCOA4 RET 10597232 CATCGGGCAGGGGAgTTTTTTAGTAGATACGG
NCOA4 RET 10597232 GAAAGTTTAGAAAAtAGAGACAGGCAGGTTC
NCOA4 RET 10597232 GCCTTCCCAGATGTGgTTTGATGACTTGCCT
NCOA4 RET 10597232 GCTGGGCAGACGAGGgAGGCAGAGCTTGCA
NCOA4 RET 10597232 GGCTTTGGCCTCCCtAGATTCTAATTCTGC
NCOA4 RET 10597232 GGTGTGAGCCAAGGaAGCTGGCGTGGTGG
NCOA4 RET 10597232 GTGGTGGCCTGCCcTCCTGCCTCAGCCTCC
NCOA4 RET 10597232 TCGAGACCATCCTGgGGGGGCCAGGGTGGG
NCOA4 RET 10597232 TGTCGACACTGACCTTgAATACAAAAAAAAAAA
NCOA4 RET 10597232 TTCCTACTAGCACTGtTGATCTGCCTGCCTC
NCOA4 RET S74821 AAATTTCAAAACACTGGGCAAGACAGTAAATATGCAGACAGGGCCCTGCCCCTTCAGTGTTCCTACTAGCACTGTCCAGG
NCOA4 RET S74825 TCCTGGCCAGGCAGGCCTCTGCCCTCTCCTGGTGGTGGCCGGGCCGGGCGTGGTGGCTCACGCCTGTAATCCCA
NCOA4 RET S83049 ACCCATCTCCTCAGCTGAGATGACCTTCCGGAGGCCCGCTGTAAAGGCATATTACACCCTTTTCTATCAGATAAGAGTA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair NCOA4--RET information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
THCA CE-A482-01A NCOA4__RET 0.22 10:51582939/1 10:43612032/1 tier1 In-frame 11213 NA
THCA DE-A3KN-01A NCOA4__RET 0.22 10:51582939/1 10:43612032/1 tier1 In-frame 11214 non-validated
THCA EL-A3H3-01A NCOA4__RET 0.22 10:51582939/1 10:43612032/1 tier1 In-frame 11215 NA
THCA EM-A2CU-01A NCOA4__RET 0.22 10:51582939/1 10:43612032/1 tier1 In-frame 11216 non-validated

FusionCancer

Top
The fusion gene pair NCOA4--RET information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair NCOA4--RET information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene NCOA4--RET has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene NCOA4--RET is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene NCOA4--RET is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene NCOA4--RET is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene NCOA4--RET was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair NCOA4--RET information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene NCOA4--RET is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene NCOA4--RET has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene NCOA4 is a known oncogene according to ONGENE database.


The tail gene RET is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene NCOA4 is cancer associated according to Bushman Cancer Gene database.


The tail gene RET is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene NCOA4 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene RET is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene NCOA4--RET is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene NCOA4--RET is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair NCOA4--RET information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene NCOA4--RET is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene NCOA4--RET has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair NCOA4--RET information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair NCOA4--RET information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair NCOA4--RET information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene NCOA4--RET is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair NCOA4--RET information is not available in ChromothripsisDB database.