MSN--ALK

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

MSN ALK

COSMIC

The fusion gene pair MSN--ALK information is available in COSMIC database.

Link
MSN--ALK

ChimerKB

Top
The fusion gene pair MSN--ALK information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
MSN_ALK-/1516+352/ -/4097/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
MSN_ALK-/1516+169/ -/4141/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
MSN_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 11310834 Oncogene; Cosmic_nonrecurrent
MSN_ALK-/-/ -/-/ - hg19 lymphoid neoplasm - 15297972 Oncogene; Cosmic_nonrecurrent
MSN_ALK-/0/ -/18/ Exonic hg18 - - - Oncogene; TICdb
MSN_ALK-/37/ -/1919/ Exonic hg18 - - - Oncogene; TICdb
MSN_ALK-/169/ -/62/ Exonic hg18 - - - Oncogene; TICdb
MSN_ALK-/352/ -/18/ Exonic hg18 - - - Oncogene; TICdb

ChimerPUB

Top
The fusion gene pair MSN--ALK information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
MSN_ALKt(2;22) / p23;q11.2 / 12800156anaplastic large cell lymphoma;lymphoma FISH - It is localized in the same exonic sequence as MSN-ALK, but 6 bp downstream, resulting in an in-frame fusion of the two partner proteins.
MSN_ALKt(2;5)(p23;q35) / t(2;17)(p23;q25) / t(2;11;2)(p23;p15;q31) / 12112524anaplastic large cell lymphoma;lymphoma - - While most of the ALK-positive ALCL (ALKomas) are characterized by the presence of the NPM-ALK fusion protein, the product of the t(2;5)(p23;q35), 10-20% of ALKomas contain variant ALK fusions, including ATIC-ALK, TFG-ALK, CLTC-ALK (previously designated CLTCL-ALK), TMP3-ALK, and MSN-ALK.
MSN_ALK- 11310834anaplastic large cell lymphoma;lymphoma - - Molecular characterization of a new ALK translocation involving moesin (MSN-ALK) in anaplastic large cell lymphoma.. /// The hybrid MSN-ALK protein had a molecular weight of 125 kd and contained an active tyrosine kinase domain.
MSN_ALKt(2;5)(p23;q35) / 15297972anaplastic large cell lymphoma - - Heterogeneity of genomic breakpoints in MSN-ALK translocations in anaplastic large cell lymphoma..

ChimerSEQ

Top
The fusion gene pair MSN--ALK information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
MSN_ALKchrX/64958479/ chr2/29445405/ Xq12 2p23.2 Exonic hg19 - Inter-chr NA AF295356 Oncogene; ChiTaRs
MSN_ALKchrX/64958831/ chr2/29446322/ Xq12 2p23.2 Exonic hg19 - Inter-chr anaplastic large cell lymphoma AF295078 Oncogene; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair MSN--ALK information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF295356MSN--ALK MSNX 64887685 64958479 + 1 1368 100 ALK2 29445405 29446377 - 1369 1607 100
Human AF295078MSN--ALK MSNX 64958452 64958831 + 3 381 100 ALK2 29446322 29446377 - 382 437 100

FARE-CAFE

Top
The fusion gene pair MSN--ALK information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
MSN-ALK Anaplastic Large Cell Lymphoma PCR,Western blot,FISH,DNA sequencing,RT-PCR,RACE t(2;5)(p23;q35) PubMed:15297972

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
MSN-ALK MSN-ALK-Isoform1 MSN _ _ 1 ALK _ 0 _ AGAAGGTAAGCACAGCAGGCAGCTACTGGAGTTCTCtCAAGCTGAGCAAGTCCGCACCTCGCAAGCTGAGCA 15297972 _
MSN-ALK MSN-ALK-Isoform2 MSN 64958648 0 1 ALK 29446276 0 1 ATGGCCCGACAGAAGAAGGAGAGTGAGGCTGTGGAGTGGCAGCAGAAGCAGGCAGCATGGGAGAAGGCACTCATGGTTTCGTCAAATACTTACTGGAGTTCTCtCAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGC 15297972 _
MSN-ALK MSN-ALK-Isoform3 MSN 64958831 0 1 ALK 29446322 0 1 ACCTGGTGCCTGCCTCTTGCCAGACCGTTCTAGGCATATACAGGATGCCACAGTTTAACTGGTCTCACTGACAGTCTTTCTCTCCTTCTGTCACTGGACAGCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAA _ AF295078
MSN-ALK MSN-ALK-Isoform4 MSN 64958479 0 1 ALK 29446346 0 1 AGAAGAAGGAGAGTGAGGCTGTGGAGTGGCAGCAGAAgCAGGAGCTGCAAGCCATGCAGATGGAGCTGCA _ AF295356
MSN-ALK MSN-ALK-Isoform5 MSN 64958648 0 1 ALK 29446351 0 0 _ _ _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
MSN-ALK MSN-ALK-Isoform1 - - - -MSN 1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
5) MAM
6) Gly_rich
7) Pkinase_Tyr
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
5) ig , Astacin , MATH
6) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
MSN-ALK MSN-ALK-Isoform2 1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
1) MAM
2) Gly_rich
1) ig , Astacin , MATH
MSN 1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
- -
MSN-ALK MSN-ALK-Isoform3 1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
1) MAM
2) Gly_rich
1) ig , Astacin , MATH
MSN 1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
- -
MSN-ALK MSN-ALK-Isoform4 1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
1) MAM
2) Gly_rich
1) ig , Astacin , MATH
MSN 1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
- -
MSN-ALK MSN-ALK-Isoform5 1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
- -MSN 1) FERM_N
2) FERM_M
3) FERM_C
4) ERM
1) FERM_C , FERM_M , ERM , MyTH4 , FERM_N
2) Pkinase_Tyr , FERM_N , FERM_C , Ras , RA , IRS , ERM , FERM_M
3) FERM_N , FERM_M , FERM_C , ERM , EBP50_C-term
4) ERM , FERM_C , FERM_M , FERM_N
ALK 1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) MAM
2) Gly_rich
3) Pkinase_Tyr
1) ig , Astacin , MATH
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
MSN-ALK hsa-miR-132-3p hsa-miR-192-5phsa-miR-200c-3phsa-miR-133a-3phsa-miR-124-3phsa-miR-215-5phsa-miR-615-3phsa-let-7b-5p Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
MSN-ALK NM_002444.2 1) SPI1_HUMAN
2) TRIM28_HUMAN
3) MITF_HUMAN
4) STAT1_HUMAN
5) RBL2_HUMAN
6) RUNX1_HUMAN
7) ESTROGEN RECEPTOR ALPHA_HUMAN
8) ETS1_HUMAN
9) FOS_HUMAN
10) GATA2_HUMAN
11) SOX2_HUMAN
12) TAL1_HUMAN
13) CTCF_HUMAN
14) BRG1_HUMAN
1) P53_HUMAN
2) PRDM14_HUMAN
3) EGR1_HUMAN
4) GATA3_HUMAN
5) E2F1_HUMAN
6) HNF4A_HUMAN
7) TFAP2C_HUMAN
8) FOXA1_HUMAN
9) ESR1_HUMAN
10) NR1H3_HUMAN
11) SETDB1_HUMAN
1) 21241896
2) 17542650
3) 21258399
4) 19122651
5) 20385362
6) 20019798
7) 20547749
8) 20019798
9) 20139302
10) 21808000
11) 21211035
12) 21795385
13) 21795385
14) 19505939

TicDB

Top
The fusion gene pair MSN--ALK information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
MSN ALK 15297972 AGAAGGTAAGCACAGCAGGCAGCTACTGGAGTTCTCtCAAGCTGAGCAAGTCCGCACCTCGCAAGCTGAGCA
MSN ALK 15297972 ATGGCCCGACAGAAGAAGGAGAGTGAGGCTGTGGAGTGGCAGCAGAAGCAGGCAGCATGGGAGAAGGCACTCATGGTTTCGTCAAATACTTACTGGAGTTCTCtCAAGCTGAGCAAGCTCCGCACCTCGACCATCATGACCGACTACAACCCCAACTACTGC
MSN ALK AF295078 ACCTGGTGCCTGCCTCTTGCCAGACCGTTCTAGGCATATACAGGATGCCACAGTTTAACTGGTCTCACTGACAGTCTTTCTCTCCTTCTGTCACTGGACAGCAGGAGCTGCAAGCCATGCAGATGGAGCTGCAGAGCCCTGAGTACAAGCTGAGCAA
MSN ALK AF295079 AGTGCTTCAAGGGCCAGGCTGCCAGGCCATGTTGCAGCTGACGCTGAGCTGAAGACTGCCATGAGTACACCTCATGTGGCAGAGCCTGCTGAGAATGAGCAGGATGAGCAGGATGAGAATGGGGCAGAGGCTAGTGCTGACCTACGGGCTGATGCA
MSN ALK AF295356 AGAAGAAGGAGAGTGAGGCTGTGGAGTGGCAGCAGAAgCAGGAGCTGCAAGCCATGCAGATGGAGCTGCA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair MSN--ALK information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair MSN--ALK information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair MSN--ALK information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene MSN--ALK has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene MSN--ALK is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene MSN--ALK is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene MSN--ALK is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene MSN--ALK was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair MSN--ALK information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene MSN--ALK is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene MSN--ALK has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene MSN is not a known oncogene according to ONGENE database.


The tail gene ALK is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene MSN is cancer associated according to Bushman Cancer Gene database.


The tail gene ALK is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene MSN is not a proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ALK is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene MSN--ALK is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene MSN--ALK is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair MSN--ALK information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene MSN--ALK is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene MSN--ALK has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair MSN--ALK information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair MSN--ALK information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair MSN--ALK information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene MSN--ALK is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair MSN--ALK information is not available in ChromothripsisDB database.