MLL--MLLT10

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

MLL MLLT10

COSMIC

The fusion gene pair MLL--MLLT10 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair MLL--MLLT10 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
MLL_MLLT10-/-/ -/-/ - hg18 lymphoblastic leukemia - - - Mitelman
MLL_MLLT10-/-/ -/-/ - hg18 acute monoblastic leukemia - - - Mitelman
MLL_MLLT10-/-/ -/-/ - hg18 acute myeloblastic leukemia - - - Mitelman
MLL_MLLT10-/0/ -/0/ Exonic hg18 - - - - TICdb
MLL_MLLT10-/175/ -/72/ Exonic hg18 - - - - TICdb
MLL_MLLT10-/216/ -/21987/ Exonic hg18 - - - - TICdb
MLL_MLLT10-/-/ -/-/ - hg18 acute myeloid leukemia - 8896421 - OMIM
MLL_MLLT10-/-/ -/-/ - hg18 acute leukemia - 7888665 - OMIM

ChimerPUB

Top
The fusion gene pair MLL--MLLT10 information is not available in CHIMERPUB (CHIMERDB 3.0) database.

ChimerSEQ

Top
The fusion gene pair MLL--MLLT10 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
MLL_MLLT10chr11/118355690/+ chr10/21940601/+ 11q23.3 10p12.31 Exonic hg19 Out-of-Frame Inter-chr LAML TCGA-AB-2985-03A - FusionScan
MLL_MLLT10chr11/118355690/ chr10/21959376/ 11q23.3 10p12.31 Exonic hg19 - Inter-chr NA AF272384 - ChiTaRs
MLL_MLLT10chr11/118355029/ chr10/21959376/ 11q23.3 10p12.31 Exonic hg19 - Inter-chr NA AF272383 - ChiTaRs
MLL_MLLT10chr11/118355029/ chr10/21875216/ 11q23.3 10p12.31 Exonic hg19 - Inter-chr NA AY187923 - ChiTaRs
MLL_MLLT10chr11/118358749/ chr10/21943434/ 11q23.3 10p12.31 Exonic hg19 - Inter-chr NA DQ525423 - ChiTaRs
MLL_MLLT10chr11/118355029/+ chr10/21959378/+ 11q23.3 10p12.31 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2832-03A - PRADA
MLL_MLLT10chr11/118353210/+ chr10/21875223/+ 11q23.3 10p12.31 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2842-03A - PRADA
MLL_MLLT10chr11/118355690/+ chr10/21940602/+ 11q23.3 10p12.31 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-2985-03A - PRADA
MLL_MLLT10chr11/118350953/+ chr10/22002701/+ 11q23.3 10p12.31 Exonic hg19 In-frame Inter-chr LAML TCGA-AB-3005-03A - PRADA
MLL_MLLT10chr11/118352983/ chr10/22015355/ 11q23.3 10p12.31 Exonic hg19 - Inter-chr acute myeloid leukemia;Acute lymphoblastic leukemia;lymphoblastic lymphoma AF242207 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair MLL--MLLT10 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF272384MLL--MLLT10 MLL11 118353172 118355690 + 1 285 100 MLLT1010 21959376 21959541 + 284 449 100
Human AF272383MLL--MLLT10 MLL11 118353172 118355029 + 1 171 100 MLLT1010 21959376 21959541 + 170 335 100
Human AF272385MLL--MLLT10 MLL11 118355585 118355690 + 1 106 100 MLLT1010 21959376 21959541 + 105 270 100
Human AF272375MLL--MLLT10 MLL11 118352703 118355029 + 2 312 100 MLLT1010 21959376 21959601 + 311 536 100
Human AY187923MLL--MLLT10 MLL11 118352792 118355029 + 1 222 100 MLLT1010 21875216 21906064 + 217 609 100
Human AF272376MLL--MLLT10 MLL11 118352703 118355690 + 2 426 100 MLLT1010 21959376 22019916 + 425 1778 99.9
Human DQ525423MLL--MLLT10 MLL11 118358490 118358749 + 1 260 100 MLLT1010 21943434 21943572 + 256 394 100
Human AF242207MLL--MLLT10 MLL11 118352808 118352983 + 1 177 98.3 MLLT1010 22015355 22016784 + 176 1598 99.6

FARE-CAFE

Top
The fusion gene pair MLL--MLLT10 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
MLL-MLLT10 Acute myelomonocytic leukemia (FAB type M4) PCR,DNA sequencing,RT-PCR t(10;11)(p12;q23) PubMed:17074587

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
MLL-MLLT10 MLL-MLLT10-Isoform1 MLL 118353210 0 1 MLLT10 21940600 1 0 aaacaaaaaccaaaagaaaagAaatataaagagaaggacaaa 17074587 _
MLL-MLLT10 MLL-MLLT10-Isoform2 MLL 118352809 0 1 MLLT10 22002698 1 0 CCTCCACCACCAGAATCAgGTATTTATAACAGCAAT 9305618 _
MLL-MLLT10 MLL-MLLT10-Isoform3 MLL 118352983 0 1 MLLT10 22015355 1 0 GCATTTGAAAGCAGGAAATGTATGATTTGAAGTCTTCAGTTCAAGAAAATCAGCTCTCTTTCTAACTATTATGTTTAATAATAAAGAAACAGGAAACAAAAAAAACATTTTATTTGAAAACATGCAGGGATGAGGTTAGTAGAGGATTCGTACTTTAAAAAAATATTCACAGTTGGAAAATGTTAAATATTTCAGGTGCTGGTTATGTTA _ AF242207
MLL-MLLT10 MLL-MLLT10-Isoform4 MLL 118351169 0 1 MLLT10 21999454 1 0 TATTTCCTGTATTGGGGGATATTTTTGAAATTTTCCATAATAAATTTTTTAAATTCTAGTATTTTTAGTTTGCAGGTTTACTTACTGTAACTTACCATGCTTCTCACTCC _ AF490423
MLL-MLLT10 MLL-MLLT10-Isoform5 MLL 118355029 0 1 MLLT10 21875216 1 0 CCTCAGCACTCTCTCCAATGGCAATAGTTCTAAGCAAAAAATTCCAGCAGATGGAGTCCACAGGATCAGAGTGGACTTTAAGAGATGTGAACTTTGTCCCCATAAGGATGGAGCTTTAAAAAGAACAGATAATGGGGGTTGGGCCCATGTGGTTTGTGCCCTGTATATTCCAGAGGTACAATTTGCCAATGTTTCCACAATGGAACCAAT _ AY187923

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
MLL-MLLT10 MLL-MLLT10-Isoform1 1) zf-CXXC
1) DNA_methylase
- -MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
6) PHD_2
7) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) MORN , Pre-SET , Rubis-subs-bind
5) PHD , Bromodomain , JmjC , RRM_1
MLL-MLLT10 MLL-MLLT10-Isoform2 1) zf-CXXC
1) DNA_methylase
- -MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
6) PHD_2
7) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) MORN , Pre-SET , Rubis-subs-bind
5) PHD , Bromodomain , JmjC , RRM_1
MLL-MLLT10 MLL-MLLT10-Isoform3 1) zf-CXXC
1) DNA_methylase
- -MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
6) PHD_2
7) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) MORN , Pre-SET , Rubis-subs-bind
5) PHD , Bromodomain , JmjC , RRM_1
MLL-MLLT10 MLL-MLLT10-Isoform4 1) zf-CXXC
1) DNA_methylase
- -MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
6) PHD_2
7) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) MORN , Pre-SET , Rubis-subs-bind
5) PHD , Bromodomain , JmjC , RRM_1
MLL-MLLT10 MLL-MLLT10-Isoform5 1) zf-CXXC
1) DNA_methylase
1) zf-HC5HC2H_2
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
MLLT10 1) PHD_2
2) zf-HC5HC2H_2
1) PHD , Bromodomain , JmjC , RRM_1
1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
6) PHD_2
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) MORN , Pre-SET , Rubis-subs-bind
5) PHD , Bromodomain , JmjC , RRM_1

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
MLL-MLLT10 hsa-miR-132-3p hsa-miR-128bhsa-miR-335-5phsa-miR-16-5phsa-let-7d-5phsa-miR-320bhsa-miR-1227-3phsa-miR-484hsa-miR-320ahsa-miR-193a-3phsa-miR-17-5p Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
MLL-MLLT10 NM_001197104.1 - - 1) 21258399
2) 20385362
3) 19122651
4) 20385362
5) 21247883
6) 20019798
7) 20690147
8) 20139302
9) 21808000
10) 21310950
11) 21795385
12) 21795385
13) 19505939
14) 21646355
15) 21572391
16) 21572391
17) 20219941
18) 22292898
19) 21430779
20) 21164480

TicDB

Top
The fusion gene pair MLL--MLLT10 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
MLL MLLT10 17074587 aaacaaaaaccaaaagaaaagAaatataaagagaaggacaaa
MLL MLLT10 9305618 CCTCCACCACCAGAATCAgGTATTTATAACAGCAAT
MLL MLLT10 AF242207 GCATTTGAAAGCAGGAAATGTATGATTTGAAGTCTTCAGTTCAAGAAAATCAGCTCTCTTTCTAACTATTATGTTTAATAATAAAGAAACAGGAAACAAAAAAAACATTTTATTTGAAAACATGCAGGGATGAGGTTAGTAGAGGATTCGTACTTTAAAAAAATATTCACAGTTGGAAAATGTTAAATATTTCAGGTGCTGGTTATGTTA
MLL MLLT10 AF490423 TATTTCCTGTATTGGGGGATATTTTTGAAATTTTCCATAATAAATTTTTTAAATTCTAGTATTTTTAGTTTGCAGGTTTACTTACTGTAACTTACCATGCTTCTCACTCC
MLL MLLT10 AY187923 CCTCAGCACTCTCTCCAATGGCAATAGTTCTAAGCAAAAAATTCCAGCAGATGGAGTCCACAGGATCAGAGTGGACTTTAAGAGATGTGAACTTTGTCCCCATAAGGATGGAGCTTTAAAAAGAACAGATAATGGGGGTTGGGCCCATGTGGTTTGTGCCCTGTATATTCCAGAGGTACAATTTGCCAATGTTTCCACAATGGAACCAAT

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair MLL--MLLT10 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
LAML AB-2832-03A MLL__MLLT10 0.87 11:118355029/1 10:21959378/1 tier1 In-frame 10451 NA
LAML AB-2842-03A MLL__MLLT10 0.87 11:118353210/1 10:21875223/1 tier1 In-frame 10452 NA
LAML AB-2985-03A MLL__MLLT10 0.87 11:118355690/1 10:21940602/1 tier1 In-frame 10453 non-validated
LAML AB-3005-03A MLL__MLLT10 0.87 11:118350953/1 10:22002701/1 tier1 In-frame 10454 validated

FusionCancer

Top
The fusion gene pair MLL--MLLT10 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair MLL--MLLT10 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene MLL--MLLT10 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene MLL--MLLT10 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene MLL--MLLT10 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene MLL--MLLT10 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene MLL--MLLT10 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair MLL--MLLT10 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene MLL--MLLT10 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene MLL--MLLT10 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene MLL is a known oncogene according to ONGENE database.
The tail gene MLLT10 is not a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene MLL is not cancer associated according to Bushman Cancer Gene database.


The tail gene MLLT10 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene MLL is not a proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene MLLT10 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene MLL--MLLT10 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene MLL--MLLT10 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair MLL--MLLT10 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene MLL--MLLT10 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene MLL--MLLT10 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair MLL--MLLT10 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair MLL--MLLT10 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair MLL--MLLT10 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene MLL--MLLT10 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair MLL--MLLT10 information is not available in ChromothripsisDB database.