LPP--HMGA2

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

LPP HMGA2

COSMIC

The fusion gene pair LPP--HMGA2 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair LPP--HMGA2 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
LPP_HMGA2-/1656/ -/1390/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
LPP_HMGA2-/1486/ -/1390/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
LPP_HMGA2-/-/ -/-/ - hg19 lipoma - 19528502 Oncogene; Cosmic_nonrecurrent
LPP_HMGA2-/-/ -/-/ - hg19 lipoma - 8812423 Oncogene; Cosmic_nonrecurrent
LPP_HMGA2-/-/ -/-/ - hg19 lipoma - 9772904 Oncogene; Cosmic_nonrecurrent
LPP_HMGA2-/-/ -/-/ - hg18 mesenchymal tumor - 7670494 Oncogene; OMIM
LPP_HMGA2-/-/ -/-/ - hg18 lipoma - 3349440 Oncogene; OMIM

ChimerPUB

Top
The fusion gene pair LPP--HMGA2 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
LPP_HMGA2t(3;12) / 12505264- FISH;PCR;RT-PCR - Herein, we have addressed this question by RT-PCR analyses of the HMGA2-LPP fusion resulting from t(3;12)(q27 approximately q28;q14 approximately q15) in a series of 61 pulmonary chondroid hamartomas (PCH) with an apparently normal karyotype. /// "Herein, we have addressed this question by RT-PCR analyses of the HMGA2-LPP fusion resulting from t(3;12)(q27 approximately q28;q14 approximately q15) in a series of 61 pulmonary chondroid hamartomas (PCH) with an apparently normal karyotype." /// Expression of the HMGA2-LPP fusion transcript in only 1 of 61 karyotypically normal pulmonary chondroid hamartomas.. /// "As a result, the HMGA2-LPP fusion transcript was amplified in only one of 61 PCH with a normal karyotype. " /// The absence of the HMGA2-LPP fusion in small populations of tumors with a normal karyotype suggests the primary nature of chromosomal rearrangements in the development of PCH affected by those aberrations..
LPP_HMGA2t(3;12)(q27;q15) / 14614053chondrosarcoma;sarcoma PCR;RT-PCR - One soft tissue chondroma had a t(3;12)(q27;q15), and the RT-PCR analysis revealed an HMGA2-LPP fusion transcript, composed of HMGA2 exons 1-3 and LPP exons 9-11. /// "One soft tissue chondroma had a t(3;12)(q27;q15), and the RT-PCR analysis revealed an HMGA2-LPP fusion transcript, composed of HMGA2 exons 1-3 and LPP exons 9-11."
LPP_HMGA2t(3;12) / 16271958- - - We analyzed 11 PCHs with a t(3;12)(q27 approximately 28;q14 approximately 15) for the expression of the LPP-HMGA2 fusion transcript. /// Expression patterns of the LPP-HMGA2 fusion transcript in pulmonary chondroid hamartomas with t(3;12)(q27 approximately 28;q14 approximately 15).. /// q14 approximately 15) in lipomas and pulmonary chondroid hamartomas (PCHs) makes the HMGA2-LPP fusion gene the most frequent fusion gene in human tumors. /// "In a previous study, all of these tumors were shown to express the HMGA2-LPP fusion transcript, composed of exons 1-3 of HMGA2 and exons 9-11 of LPP. " /// "To our knowledge, this is the first report of the expression of the LPP-HMGA2 fusion transcript in a series of PCHs. " /// "In a previous study, all of these tumors were shown to express the HMGA2-LPP fusion transcript, composed of exons 1-3 of HMGA2 and exons 9-11 of LPP." /// "Thus, based on this one finding, a role of LPP-HMGA2 in PCH should be considered.. "
LPP_HMGA2t(3;12)(q27-28;q14-15) / 19528502- - - Expression of HMGA2-LPP and LPP-HMGA2 fusion genes in lipoma: identification of a novel type of LPP-HMGA2 transcript in four cases.. /// "In addition to the HMGA2-LPP fusion gene, the LPP-HMGA2 fusion gene could have some specific roles for lipomagenesis. " /// "Although the expression of HMGA2-LPP fusion gene has been reported in lipomas, the reciprocal LPP-HMGA2 fusion gene has rarely been described. " /// Ninety-eight cases of lipoma were analyzed for the possible expression of HMGA2-LPP and LPP-HMGA2 fusion genes using a reverse-transcription polymerase chain reaction method. /// "Ten lipomas (10%) revealed both HMGA2-LPP and LPP-HMGA2 fusion transcripts, nine (9%) only HMGA2-LPP, and three (3%) only LPP-HMGA2. " /// The biological implications of the expression and the variation of LPP-HMGA2 fusion transcripts need to be elucidated.. /// "Out of 13 lipomas with LPP-HMGA2 transcript, 9 were associated with a previously reported LPP-HMGA2 fusion transcript, which fuses exon 8 of LPP to exon 4 of HMGA2, while 4 with a novel type of LPP-HMGA2 fusion transcript, which fuses exon 7 of LPP to exon 4 of HMGA2. " /// "DNA sequencing analysis demonstrated that the HMGA2-LPP transcript in 19 lipomas consisted of exons 1-3 of HMGA2 and exons 9-11 of LPP, which was described previously. "
LPP_HMGA2t(3;12) / 16375854- PCR;RT-PCR - In a subset of human lipomas, a specific t(3;12) chromosome translocation gives rise to HMGA2-LPP fusion protein, containing the amino (N)-terminal DNA binding domains of HMGA2 fused to the carboxyl (C)-terminal LIM domains of LPP. /// Overexpression of HMGA2-LPP fusion transcripts promotes expression of the alpha 2 type XI collagen gene.. /// RT-PCR analysis revealed that HMGA2-LPP transcripts in lipomas with the fusion were 591-fold of full-length HMGA2 transcripts in lipomas without the fusion. /// "Here, we analyzed whether HMGA2-LPP promotes chondrogenic differentiation, a marker of which is transactivation of the alpha 2 type XI collagen gene (Col11a2). " /// Real-time PCR analysis showed that HMGA2-LPP and COL11A2 were co-expressed. /// "Luciferase assay demonstrated that either of HMGA2-LPP, wild-type HMGA2 or the N-terminal HMGA2 transactivated the Col11a2 promoter in HeLa cells, while the C-terminal LPP did not. " /// These results indicate that in vivo overexpression of HMGA2-LPP promotes chondrogenesis by upregulating cartilage-specific collagen gene expression through the N-terminal DNA binding domains.. /// "In addition to its role in adipogenesis, several observations suggest that HMGA2-LPP is linked to chondrogenesis. "
LPP_HMGA2- 16567472- - - Intrapatellar tendon lipoma with chondro-osseous differentiation: detection of HMGA2-LPP fusion gene transcript.. /// "Molecular analysis showed that the identical HMGA2-LPP fusion transcript-characteristic of lipoma, parosteal lipoma, and pulmonary chondroid hamartoma-was detectable in the both components.. "
LPP_HMGA2- 16821597liposarcoma;sarcoma - - MRI characteristics of parosteal lipomas associated with the HMGA2-LPP fusion gene.. /// The expression of HMGA2-LPP fusion transcripts was determined using the reverse transcription-polymerase chain reaction method. /// "Since the HMGA2-LPP fusion transcripts are exclusively detectable in benign mesenchymal tumors, testing HMGA2-LPP expression may be useful for differential diagnosis in cases of radiologically-suspected well-differentiated liposarcomas.. " /// The magnetic resonance (MR) characteristics of parosteal lipomas with the HMGA2-LPP fusion transcripts are described.
LPP_HMGA2- 18383898- - - The expressions of three previously reported gene fusion transcripts, including HMGA2/LPP, HMGA2/RDC1 and HMGA2/NFIB, were analyzed in 102 tumors from patients with lipomas. /// "There were 23 cases (22.5%) expressing HMGA2/LPP, 2 cases (1.9%) expressing HMGA2/RDC1 and no cases of HMGA2/NFIB expression (0%). "
LPP_HMGA2- 15755872- - - In these lipomas, HMGA2/LPP fusion transcripts are expressed, which encode for the three AT-hooks of HMGA2 followed by the two most carboxyl-terminal LIM domains (protein-protein interaction domains) of LPP. /// These results support the concept that the transactivation functions of the novel HMGA2/LPP transcription factor contribute to lipomagenesis.. /// These results support the concept that the transactivation functions of the novel HMGA2/LPP transcription factor contribute to lipomagenesis.. /// "We also show that HMGA2/LPP activates transcription from the BAT-1 element of the rhodopsin promoter, a HMGA1-binding element. " /// "Finally, in a number of lipomas, HMGA2/LPP and HMGA2 are coexpressed, and HMGA2 augments the transactivation functions of HMGA2/LPP. " /// "Here, we show that the HMGA2/LPP fusion protein retains the transactivation functions of the LPP LIM domains and thus functions as transcription factor. " /// "The HMGA2/LPP fusion protein activates transcription from the well-characterized PRDII element, which is a part of the IFN-beta enhancer and which is known to bind to HMGA2. " /// Transactivation functions of the tumor-specific HMGA2/LPP fusion protein are augmented by wild-type HMGA2..
LPP_HMGA2- 20332486liposarcoma;ewing sarcoma;sarcoma - - One hundred and seventy-two cases of adipocytic tumors, comprising 98 cases of lipoma and 74 cases of liposarcoma, were analyzed for the possible expression of HMGA2-LPP, LPP-HMGA2, TLS-CHOP and EWS-CHOP fusion genes, using a reverse-transcription polymerase chain reaction method. /// "One hundred and seventy-two cases of adipocytic tumors, comprising 98 cases of lipoma and 74 cases of liposarcoma, were analyzed for the possible expression of HMGA2-LPP, LPP-HMGA2, TLS-CHOP and EWS-CHOP fusion genes, using a reverse-transcription polymerase chain reaction method." /// "In lipoma, twenty-two cases (22.4%) were associated with either HMGA2-LPP or LPP-HMGA2, while neither TLS-CHOP nor EWS-CHOP transcript was detectable. " /// "On the contrary, in liposarcoma, neither HMGA2-LPP nor LPP-HMGA2 transcript was detectable, although twenty-five cases (33.8%) were related to either TLS-CHOP or EWS-CHOP. " /// "HMGA2-LPP and LPP-HMGA2 were specific to lipoma, and TLS-CHOP and EWS-CHOP were specific to liposarcoma.. "
LPP_HMGA2- 16133369pleomorphic adenoma - - For example, HMGA2/LPP has been reported in lipoma, pulmonary chondroid hamartoma, and soft tissue chondroma.
LPP_HMGA2t(3;12)(q27;q14-15) / 18551755liposarcoma;sarcoma ISH - Reverse-transcriptase polymerase chain reaction followed by sequencing analysis confirmed the presence of the HMGA2-LPP fusion gene, a characteristic and the most common fusion product found in lipoma. /// "Reverse-transcriptase polymerase chain reaction followed by sequencing analysis confirmed the presence of the HMGA2-LPP fusion gene, a characteristic and the most common fusion product found in lipoma."
LPP_HMGA2t(3;6)(q27;p21) / 19963137- - - The biological function of this novel fusion could be similar to the role of HMGA2-LPP in tumorigenesis..

ChimerSEQ

Top
The fusion gene pair LPP--HMGA2 information is not available in CHIMERSEQ (CHIMERDB 3.0) database.

ChiTaRS 2.1

Top
The fusion gene pair LPP--HMGA2 information is not available in CHITARS database.

FARE-CAFE

Top
The fusion gene pair LPP--HMGA2 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
LPP-HMGA2 Parosteal Lipoma ,Pulmonary chondroid hamartomas FISH,RT-PCR _ PubMed:12063392

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
LPP-HMGA2 LPP-HMGA2 LPP 188327633 0 1 HMGA2 66500965 1 0 CACCCAAATACCTGGAAACGGGAACCAGGGTACACTCCTCCTGGAGCAGGGAACCAGAACCCTCCTGGGATGTATCCAGTCACTGGTCCCAAGAAGACCTATATCACAGATCCTGTTTCAGCCCCCTGTGCGCCACCATTGCAGCCAAAGGAACAGATCCTGGGAGCCGACCTCGGTGCCTCAAAACCAAGATCCCAGCTGAAGCATTGTCTTGGAAGGAAGCACCATAAATTGTGACAGTGGAGGCCTAATGGAATGCAGCATCGCACGCGAGCCCCATGGATGGGAAACAGACCTGATTAGGTGCCATCAAAACAACACAACTGACCATTGGAAACTCTGCTGAGGTCTCAGGTGCTGAGGAGCAGGAGAGAAGAAGAGAAAGAAGTCCTGTGGGGCTCACACAGCCGGCCAGCCTCTCATCTCAAAGACAGAAACGAGGTTTGGCTTCATTCTTTTCTGCCCACTGATTGCTTTATTTCAAATTACCCTAACTACTTAGCATGGCAAATTAAGTTAAAACCCCCAAGAGTCTGCCGAAGAGGACTAGAATCTGATTAAAAGGAATAGTCCCGTCACAAGCTAGGGAGGAAATGGAAATTACTCTGAGTGCAGTGCTATTAAATAATT _ AF393503

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
LPP-HMGA2 LPP-HMGA2 - - 1) AT_hook
-LPP 1) LIM
1) Ank_2 , LIM , HLH , GATA , WH1 , V-set
HMGA2 1) AT_hook
- 1) LIM
1) Ank_2 , LIM , HLH , GATA , WH1 , V-set

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
LPP-HMGA2 hsa-miR-26a-5phsa-miR-125b-5phsa-miR-34a-5phsa-let-7d-5phsa-let-7e-5phsa-let-7b-5phsa-let-7g-5phsa-let-7c-5phsa-let-7a-5phsa-miR-98-5phsa-miR-370-3phsa-miR-185-5phsa-miR-29b-3phsa-miR-196a-5phsa-miR-16-5phsa-miR-15a-5phsa-miR-204-5phsa-miR-34b-3phsa-miR-760hsa-let-7f-5p hsa-miR-124-3p Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
LPP-HMGA2 _ - - -

TicDB

Top
The fusion gene pair LPP--HMGA2 information is not available in TicDB.

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair LPP--HMGA2 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair LPP--HMGA2 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair LPP--HMGA2 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene LPP--HMGA2 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene LPP--HMGA2 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene LPP--HMGA2 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene LPP--HMGA2 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene LPP--HMGA2 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair LPP--HMGA2 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene LPP--HMGA2 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene LPP--HMGA2 has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene LPP is not a known oncogene according to ONGENE database.


The tail gene HMGA2 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene LPP is cancer associated according to Bushman Cancer Gene database.


The tail gene HMGA2 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene LPP is not a proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene HMGA2 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene LPP--HMGA2 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene LPP--HMGA2 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair LPP--HMGA2 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene LPP--HMGA2 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene LPP--HMGA2 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair LPP--HMGA2 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair LPP--HMGA2 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair LPP--HMGA2 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene LPP--HMGA2 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair LPP--HMGA2 information is not available in ChromothripsisDB database.