FUS--ERG

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

FUS ERG

COSMIC

The fusion gene pair FUS--ERG information is available in COSMIC database.

Link
FUS--ERG

ChimerKB

Top
The fusion gene pair FUS--ERG information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
FUS_ERG-/904/ -/1141/ Exonic hg19 - - - Oncogene; Transcription_Factor Cosmic_recurrent
FUS_ERG-/937/ -/1036/ Exonic hg19 - - - Oncogene; Transcription_Factor Cosmic_recurrent
FUS_ERG-/(866_868)/ -/1141-(1575_1577)/ Exonic hg19 - - - Oncogene; Transcription_Factor Cosmic_recurrent
FUS_ERG-/904/ -/1093/ Exonic hg19 - - - Oncogene; Transcription_Factor Cosmic_recurrent
FUS_ERG-/628/ -/967/ Exonic hg19 - - - Oncogene; Transcription_Factor Cosmic_recurrent
FUS_ERG-/904/ -/967/ Exonic hg19 - - - Oncogene; Transcription_Factor Cosmic_recurrent
FUS_ERG-/-/ -/-/ - hg19 askins tumor - 12907633 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 ewing sarcoma - 12907633 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 haematopoietic neoplasm - 8187069 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 haematopoietic neoplasm - 7533529 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 haematopoietic neoplasm - 10354136 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 haematopoietic neoplasm - 9549830 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 haematopoietic neoplasm - 9242552 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 ewing sarcoma - 19737655 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 lymphoid neoplasm - 16263589 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 haematopoietic neoplasm - 11340253 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 haematopoietic neoplasm - 9096702 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 haematopoietic neoplasm - 20694842 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg19 haematopoietic neoplasm - 19781443 Oncogene; Transcription_Factor Cosmic_nonrecurrent
FUS_ERG-/-/ -/-/ - hg18 lymphoblastic leukemia - - Oncogene; Transcription_Factor Mitelman
FUS_ERG-/-/ -/-/ - hg18 acute megakaryoblastic leukemia - - Oncogene; Transcription_Factor Mitelman
FUS_ERG-/-/ -/-/ - hg18 acute monoblastic leukemia - - Oncogene; Transcription_Factor Mitelman
FUS_ERG-/-/ -/-/ - hg18 acute myelomonocytic leukemia - - Oncogene; Transcription_Factor Mitelman
FUS_ERG-/-/ -/-/ - hg18 ewing tumor - - Oncogene; Transcription_Factor Mitelman
FUS_ERG-/412/ -/4754/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
FUS_ERG-/-/ -/-/ - hg18 myeloid leukemia - 8187069 Oncogene; Transcription_Factor OMIM

ChimerPUB

Top
The fusion gene pair FUS--ERG information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
FUS_ERGt(16;21)(p11;q22) / t(16;21) / t(16;21) / 12907633ewing sarcoma FISH - FUS/ERG gene fusions in Ewing's tumors.. /// "In two of our Ewing's tumor cases, we were able to show at the sequence level that the translocation between chromosomes 16 and 21 similarly results in a FUS/ERG fusion. "
FUS_ERGt(2;16) / t(16;21)(p11;q24) / t(2;16)(q35;p11) / 17620387ewing sarcoma;sarcoma FISH - In rare cases, FUS can substitute for EWS, with translocation t(16;21)(p11;q24) producing a FUS-ERG fusion with no EWS rearrangement.
FUS_ERG- 19737655neuroectodermal tumor FISH;PCR;RT-PCR - The use of FISH in combination with RT-PCR led to identification of a novel FUS-ERG fusion transcript in the tumor, with FUS exons 1-5 fused in-frame to ERG exons 6-9. /// "The use of FISH in combination with RT-PCR led to identification of a novel FUS-ERG fusion transcript in the tumor, with FUS exons 1-5 fused in-frame to ERG exons 6-9." /// Ewing sarcoma-peripheral neuroectodermal tumor of the kidney with a FUS-ERG fusion transcript..
FUS_ERGt(16;21) / t(1;16) / t(16;21)(p11;q22) / t(16;21) / t(1;16) (q12;q13) / t(6;12)(q13;q13) / t(6;12)(q21;q13) / 9096702- FISH;PCR;RT-PCR - Both the FUS/ERG and ERG/FUS chimeric transcripts were identified by reverse transcriptase-polymerase chain reaction (RT-PCR) analysis.
FUS_ERG- 23210573acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR - BCR-ABL1, FUS-ERG, MLL-AF4, ETV6-RUNX1, E2A-PBX1, dupMLL, MLL-AF10, MLL-ENL, SET-NUP214 and SIL-TAL1 were detected in 36 (14.06%), 14 (5.47%), 14 (5.47%), four (1.56%), four (1.56%), five (1.95%), four (1.56%), two (0.78%), two (0.78%) and five patients (1.95%), respectively.
FUS_ERGt(16;21) / t(16;21)(p11;q22) / t(12;16)(q13;p11) / 8187069liposarcoma;myeloid leukemia;leukemia;ewing sarcoma;sarcoma - - Thus, the TLS/FUS-ERG gene fusion in t(16;21) leukemia is predicted to produce a protein that is very similar to the EWS-ERG chimeric protein responsible for Ewing's sarcoma.. /// We show here that the TLS/FUS gene on chromosome 16 is fused with the ERG gene to produce the TLS/FUS-ERG chimeric transcript by this translocation.
FUS_ERGt(2;3)(q21;q21) / del(3)(q21) / t(1;10)(q32;q24) / 24068373acute myeloid leukemia;myeloid leukemia;leukemia PCR - We performed RNA-Seq on an acute myeloid leukemia in a 2-year-old girl with the karyotype 46,XX,add(1)(p36), der(2)t(2;3)(q21;q21),del(3)(q21),der(10)t(1;10)(q32;q24),der(16)(2qter-->2q21::16p11-->16q24::16p11-->16pter)[13]/46,XX[2] and identified a cryptic FUS/ERG fusion gene. /// "The FUS-ERG transcript found here has been reported in only two other cases of childhood leukemia, in a 1-year-old boy and an 8-month-old boy, both diagnosed with precursor B cell ALL. " /// "The clinical significance, if any, of the amino acid residues which are coded by the exons 8, 9 and 10 of ERG in the fusion FUS-ERG proteins, remains unclear." /// Cryptic FUS-ERG fusion identified by RNA-sequencing in childhood acute myeloid leukemia.. /// "The clinical significance, if any, of the amino acid residues which are coded by the exons 8, 9 and 10 of ERG in the fusion FUS-ERG proteins, remains unclear. " /// "The fusion transcript codes for a 497 amino acid residues FUS-ERG protein and, similar to other AML-related FUS-ERG fusion proteins, contains both functional domains (TR1 and TR2) of the transactivation domain of FUS and the ETS domain of ERG. " /// PCR and direct sequencing verified the presence of the FUS-ERG chimeric transcript in which exon 7 of FUS from 16p11 (nt 904 in sequence with accession number NM_004960 version 3) was fused in frame to exon 8 of ERG from sub-band 21q22.2 (nt 967 in NM_004449 version 4).
FUS_ERGt(16;21)(p11;q22) / 16263589acute myeloid leukemia;acute lymphoblastic leukemia;myeloid leukemia; PCR;RT-PCR - TLS/FUS-ERG fusion gene in acute lymphoblastic leukemia with t(16;21)(p11;q22) and monitoring of minimal residual disease.. /// This is the first report of an ALL patient with a TLS/FUS-ERG fusion transcript.. /// Reverse transcriptase-polymerase chain reaction (RT-PCR) and direct sequence analysis showed TLS/FUS-ERG chimeric mRNA with a novel junctional pattern of exon 7 of TLS/FUS and exon 6 of ERG. /// TLS/FUS-ERG chimeric mRNA was not detected after CR.
FUS_ERGt(16;21)(p11;q22) / t(16;21) / t(16;21) / 9242552acute myeloid leukemia;myeloid leukemia;myelodysplastic syndrome;leukemia PCR;RT-PCR - In this study, we analyzed the clinical characteristics of 19 patients with t(16;21)-AML, including 2 patients who evolved from myelodysplastic syndrome, and detected the chimeric transcripts of the TLS/FUS-ERG fusion gene in the patients during various clinical stages by the reverse transcriptase-polymerase chain reaction (RT-PCR) technique. /// The rearrangement of the two chromosomes forms the TLS/FUS-ERG fusion gene and produces a consistent chimeric transcript on the der (21) chromosome. /// Consistent detection of TLS/FUS-ERG chimeric transcripts in acute myeloid leukemia with t(16;21)(p11;q22) and identification of a novel transcript.. /// Four types of TLS/FUS-ERG chimeric transcripts including a novel type were noted in the RT-PCR analysis.
FUS_ERGt(16;21) / p11.2;q22 / 20620604acute myeloid leukemia;acute lymphoblastic leukemia;myeloid leukemia;leukemia RT-PCR - Although more clinical studies are necessary, we believe that a possible association between ALL and a specific type of FUS-ERG fusion transcript might be considered, especially in childhood cases with t(16;21).. /// We report two childhood cases of acute leukemia with t(16;21)(p11.2;q22) and FUS-ERG rearrangements. /// "Chromosome study showed a t(16;21)(p11.2;q22) clone in more than one third of the cells analyzed, and further investigation with reverse-transcriptase polymerase chain reaction, cloning, and sequencing confirmed FUS-ERG rearrangement (type B). " /// Two childhood cases of acute leukemia with t(16;21)(p11.2;q22): second case report of infantile acute lymphoblastic leukemia with unusual type of FUS-ERG chimeric transcript.. /// "Further studies for the detection of a FUS-ERG chimeric transcript were conducted, and an unusual type of FUS-ERG rearrangement was discovered, which has been reported in only three patients including a 1-year-old infant with ALL. "
FUS_ERGt(16;21)(p11;q22) / t(12;16) (q13;p11) / t(12;22;20)(q13;q12;q11) / t(12;16) / 9315104acute myeloid leukemia;liposarcoma;myeloid leukemia;leukemia;sarcoma - - We have sequenced the breakpoint regions in one acute myeloid leukemia (AML) with t(16;21)(p11;q22) resulting in the formation of a FUS/ERG hybrid gene and in four myxoid liposarcomas (MLS), three of which had the translocation t(12;16) (q13;p11) and a FUS/CHOP fusion gene and one with t(12;22;20)(q13;q12;q11) and an EWS/CHOP hybrid gene. /// "Characteristic sequence motifs at the breakpoints of the hybrid genes FUS/CHOP, EWS/CHOP and FUS/ERG in myxoid liposarcoma and acute myeloid leukemia.. "
FUS_ERGt(16;21)(p11;q22) / 9549830leukemia PCR;RT-PCR - A TLS/ERG-FUS fusion transcript, which is known to be expressed by t(16;21)(p11;q22) translocation, was detectable by RT-PCR both in BM and CSF cells in the first complete remission, suggesting the existence of MRD. /// A TLS/ERG-FUS fusion transcript became rapidly below the detection level after PBSCT.
FUS_ERGt(16;21)(p11;q22) / t(16;21)(p11;q22) / / 19893346acute myeloid leukemia PCR;RT-PCR - His karyotype was 46,XY,t(16;21)(p11;q22),del(18)(p11.2) and RT-PCR revealed the TLS/FUS-ERG fusion transcripts. /// We suggest that the presence of t(16;21)(p11;q22) and/or TLS/FUS-ERG fusion transcripts has to be considered in cases of AML with erythrophagocytosis.. /// [Two cases of acute myeloid leukemia with t(16;21)(p11;q22) and TLS/FUS-ERG fusion transcripts].. /// "His karyotype was 46,XY,t(16;21)(p11;q22),del(18)(p11.2) and RT-PCR revealed the TLS/FUS-ERG fusion transcripts. "
FUS_ERGt(16;21)(p11;q22) / t(16;21) / t(16;21) / 20694842acute myeloid leukemia;myeloid leukemia;leukemia PCR - The translocation t(16;21)(p11;q22) is rare, occurs with an incidence of 1%, in acute myeloid leukemia (AML), forming TLS/FUS-ERG fusion transcript, and it is known to cause the hemophagocytosis and vacuolation of leukemic cells. /// "All of these 3 patients showed the fusion transcript TLS/FUS-ERG, which was detected by multiplex or nested PCR. "
FUS_ERGp11;q22 / t(16;21) (p11;q22) / 27033758acute myeloid leukemia;myeloid leukemia;leukemia - - All cases could be detected TLS/FUS-ERG fusion genes.
FUS_ERGt(16;21) / p11.2;q22 / 25830133- - - A case of pediatric ALL with t(16;21)(p11.2;q22) and FUS-ERG rearrangement..
FUS_ERGt(16;21)(p11;q22) / t(16;21)(p11;q22) / / 11505530leukemia PCR;RT-PCR - [AML(M7) associated with t(16;21)(p11;q22) showing relapse after unrelated bone marrow transplantation and disappearance of TLS/FUS-ERG mRNA]. /// [AML(M7) associated with t(16;21)(p11;q22) showing relapse after unrelated bone marrow transplantation and disappearance of TLS/FUS-ERG mRNA].. /// "During hematological remission before U-BMT, the TLS/FUS-ERG chimeric transcript of t(16;21)(p11;q22) was consistently detectable as minimal residual disease (MRD) by RT-PCR. "
FUS_ERGt(16;21) / t(16;21) / 26148230acute myeloid leukemia;myeloid leukemia;leukemia - - In acute myeloid leukemias harboring t(16;21), ERG function is deregulated due to a fusion with FUS/TLS resulting in the expression of a FUS-ERG oncofusion protein. /// The oncofusion protein FUS-ERG targets key hematopoietic regulators and modulates the all-trans retinoic acid signaling pathway in t(16;21) acute myeloid leukemia.. /// All-trans retinoic acid treatment of t(16;21) cells as well as FUS-ERG knockdown alleviate the myeloid-differentiation block. /// "Moreover, in t(16;21) FUS-ERG co-occupies genomic regions bound by the nuclear receptor heterodimer RXR:RARA inhibiting target gene expression and interfering with hematopoietic differentiation. " /// "Together, the results suggest that FUS-ERG acts as a transcriptional repressor of the retinoic acid signaling pathway. " /// "Here, we show that FUS-ERG acts in the context of a heptad of proteins (ERG, FLI1, GATA2, LYL1, LMO2, RUNX1 and TAL1) central to proper expression of genes involved in maintaining a stem cell hematopoietic phenotype. "
FUS_ERGt(16;21)(p11;q22) / t(16;21) / t(16;21) / 27183148acute myeloid leukemia;myeloid leukemia;leukemia - - The t(16;21) results in the TLS(FUS)-ERG fusion protein, which is believed to function as a transcriptional activator in leukemogenesis and has been demonstrated to interfere in normal pre-mRNA splicing functions of FUS/TLS.
FUS_ERGt(16;21) / p11.2;q22 / t(16;21)(p11;q22) / 19781443acute myeloid leukemia;myeloid leukemia;leukemia - - Detection of FUS-ERG chimeric transcript in two cases of acute myeloid leukemia with t(16;21)(p11.2;q22) with unusual characteristics.. /// "The chimeric transcript FUS-ERG formed by this translocation which causes the replacement of RNA-binding domain of FUS (alias TLS) with the DNA-binding domain of ERG, and this event is thought to be responsible for leukemogenesis. " /// "The chimeric transcript FUS-ERG formed by this translocation which causes the replacement of RNA-binding domain of FUS (alias TLS) with the DNA-binding domain of ERG, and this event is thought to be responsible for leukemogenesis."
FUS_ERGt(16;21)(p11.2;q22) / t(16;21)(p11.2;q22) / / 21536242acute myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - Establishment and characterization of a novel acute myeloid leukemia cell line, JIH-4, carrying a t(16;21)(p11.2;q22) and expressing the FUS-ERG fusion. /// "Establishment and characterization of a novel acute myeloid leukemia cell line, JIH-4, carrying a t(16;21)(p11.2;q22) and expressing the FUS-ERG fusion.. " /// " Human leukemia cell lines are powerful tools in the study of leukemogenesis, particularly for rare but recurrent subtypes such as acute myeloid leukemia (AML) with the t(16;21)(p11.2;q22) and FUS-ERG fusion. " /// The FUS-ERG fusion transcript was identified by reverse transcriptase polymerase chain reaction (RT-PCR).
FUS_ERGt(16;21)(p11;q22) / 16737920acute myeloid leukemia;leukemia RT-PCR - We report on a case of pediatric acute myelocytic leukemia showing 47,XX,+10,t(16;21)(p11;q22) that resulted in an unusual TLS/FUS-ERG chimeric transcript. /// "Unusual type of TLS/FUS-ERG chimeric transcript in a pediatric acute myelocytic leukemia with 47,XX,+10,t(16;21)(p11;q22).. " /// We also confirmed a very rare type of TLS/FUS-ERG chimeric transcript by fusion of the 5' part of the TLS/FUS gene in chromosome 16p11 and the 3' part of the ERG gene in chromosome 21q22 using reverse-transcriptase polymerase chain reaction and direct sequencing.
FUS_ERGt(16;21)(p11;q22) / 11340253leukemia - - Although we could not detect the TLS/FUS-ERG fusion transcripts by reverse transcriptase-polymerase chain reaction in pre-BMT remission phase, they were clearly detectable in bone marrow cells obtained 6 months after transplantation with no translocation detected by conventional cytogenetics.
FUS_ERGt(16;21)(p11;q22) / t(16;21) / t(16;21) / 24374719acute myeloid leukemia;myeloid leukemia;leukemia - - The TLS/FUS-ERG fusion transcript was detected in all diagnostic and relapsed samples, with the exception of one relapsed sample. /// TLS/FUS-ERG chimeric fusion transcript resulting from translocation changes involving chromosomes 16 and 21 is a rare genetic event associated with acute myeloid leukemia (AML). /// TLS/FUS-ERG chimeric fusion transcript resulting from translocation changes involving chromosomes 16 and 21 is a rare genetic event associated with acute myeloid leukemia (AML).
FUS_ERG- 26690869ewing sarcoma;sarcoma FISH;PCR;RT-PCR - Ewing sarcoma with ERG gene rearrangements: A molecular study focusing on the prevalence of FUS-ERG and common pitfalls in detecting EWSR1-ERG fusions by FISH.. /// "In fact, ERG gene rearrangements represent the second most common molecular alteration, with EWSR1-ERG being identified in 5-10% of cases, while only a handful of reports document a FUS-ERG fusion." /// "In fact, ERG gene rearrangements represent the second most common molecular alteration, with EWSR1-ERG being identified in 5-10% of cases, while only a handful of reports document a FUS-ERG fusion. " /// "In this study, we focus on ES with ERG gene abnormalities, specifically to investigate the prevalence and clinicopathologic features of FUS-ERG fusions in a large cohort of small blue round cell tumors (SBRCTs) and compare to the eight reported FUS-positive ES. "
FUS_ERGt(16;21)(p11;q22) / t(12;16)(q13;p11) / t(16;21) / 7533529acute myeloid leukemia;liposarcoma;myeloid leukemia;leukemia;ewing sarcoma;sarcoma PCR - Using specific primers for the 5' part of FUS and the 3' part of ERG, we amplified a 4.4 kb genomic FUS/ERG DNA fragment from the leukemic sample. /// Blotting and hybridization with specific probes for FUS and ERG revealed that the amplified fragments consisted of FUS/ERG and ERG/FUS hybrid DNA.
FUS_ERGt(16;21)(p11;q22) / t(16;21) / 10354136- PCR;RT-PCR - The FUS/ERG fusion mRNA was demonstrated in all cases by reverse transcriptase-polymerase chain reaction (RT-PCR). /// The relationship between the unique cellular characteristics (especially CD56 and IL-2Ralpha expression) and FUS/ERG protein remains undetermined..
FUS_ERGt(16;21) / p11.2;q22 / 26770812myeloid leukemia ISH - FUS-ERG gene fusion in isolated myeloid sarcoma showing uncommon clinical features.. /// "To our knowledge, this is the first report of isolated MS carrying FUS-ERG gene fusion. " /// " FUS-ERG gene fusion has not been reported in cases of myeloid sarcoma (MS), a subtype of acute myeloid leukemia involving extramedullary anatomic sites. " /// Reverse transcriptase polymerase chain reaction and direct sequencing demonstrated the presence of the FUS-ERG chimeric gene transcript.

ChimerSEQ

Top
The fusion gene pair FUS--ERG information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
FUS_ERGchr16/31198569/ chr21/39758105/ 16p11.2 21q22.2 Exonic hg19 - Inter-chr NA Y10001 Oncogene; Transcription_Factor ChiTaRs
FUS_ERGchr16/31198158/ chr21/39755726/ 16p11.2 21q22.2 Exonic hg19 - Inter-chr acute myeloid leukemia;ewing tumor S77574 Oncogene; Transcription_Factor ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair FUS--ERG information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human S77574FUS--ERG FUS16 31196445 31198158 + 1 92 100 ERG21 39755726 39755846 - 91 211 100
Human Y10001FUS--ERG FUS16 31198508 31198569 + 1 62 100 ERG21 39758105 39758163 - 62 120 100

FARE-CAFE

Top
The fusion gene pair FUS--ERG information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
FUS-ERG Ewing sarcoma,Acute megakaryoblastic leukemia (FAB type M7) FISH,G-Banding,RT-PCR,DNA sequencing,aCGH,PCR t(16;21)(p11;q22 PubMed:19737655

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
FUS-ERG FUS-ERG-Isoform1 FUS _ _ 1 ERG _ 0 _ gtggaggtggagAtttaccatatg 19737655 _
FUS-ERG FUS-ERG-Isoform2 FUS 31198569 0 1 ERG 39758105 0 0 ATCCTTTTGATCGTTGTGTCCAAGGCTTGTGTGTGTGTGAGTGTGTGGGAGACAACTCCGAACAGTCCTGAGCCCTATGTCTTTATGGCTACTGGGTAAAATAGTCAAGTGAGAAATTAG _ Y10001

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
FUS-ERG FUS-ERG-Isoform1 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_1
2) zf-RanBP
3) SAM_PNT
4) Ets
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) SAM_PNT , Phage_lysozyme
4) SRF-TF , Ank_2 , PAX , Ets
FUS-ERG FUS-ERG-Isoform2 - - 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
FUS-ERG hsa-miR-133a-3phsa-miR-145-5phsa-miR-133b hsa-miR-197-3phsa-miR-664a-3phsa-miR-1296-5phsa-miR-615-3phsa-miR-331-3phsa-miR-125b-5phsa-miR-221-3phsa-miR-181b-5phsa-miR-10a-5phsa-miR-1260b Report assay

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
FUS-ERG NM_001170634.1 - - -

TicDB

Top
The fusion gene pair FUS--ERG information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
FUS ERG 19737655 gtggaggtggagAtttaccatatg
FUS ERG Y10001 ATCCTTTTGATCGTTGTGTCCAAGGCTTGTGTGTGTGTGAGTGTGTGGGAGACAACTCCGAACAGTCCTGAGCCCTATGTCTTTATGGCTACTGGGTAAAATAGTCAAGTGAGAAATTAG

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair FUS--ERG information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair FUS--ERG information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair FUS--ERG information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene FUS--ERG has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene FUS--ERG is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene FUS--ERG is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene FUS--ERG is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene FUS--ERG was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair FUS--ERG information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene FUS--ERG is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene FUS--ERG has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene FUS is a known oncogene according to ONGENE database.


The tail gene ERG is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene FUS is cancer associated according to Bushman Cancer Gene database.


The tail gene ERG is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene FUS is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ERG is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene FUS--ERG is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene FUS--ERG is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair FUS--ERG information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene FUS--ERG is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene FUS--ERG has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair FUS--ERG information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair FUS--ERG information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair FUS--ERG is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
FUS--ERGThe pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7

Cortex_Dataset

Top
Fusion gene FUS--ERG is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair FUS--ERG information is not available in ChromothripsisDB database.