FUS--CREB3L2

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

FUS CREB3L2

COSMIC

The fusion gene pair FUS--CREB3L2 information is available in COSMIC database.

Link
FUS--CREB3L2

ChimerKB

Top
The fusion gene pair FUS--CREB3L2 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
FUS_CREB3L2-/869/ -/936/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/869/ -/1121-1325/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/904/ -/936/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/904+1056/ -/936/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/904+785/ -/936/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/904+522/ -/936/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/869+617/ -/936/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/869/ -/904+1322/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/628/ -/936/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/628/ -/936-18/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/869+453/ -/936/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/869+458/ -/936/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/628/ -/1121/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
FUS_CREB3L2-/-/ -/-/ - hg19 fibrosarcoma - 15139001 Oncogene; Cosmic_nonrecurrent
FUS_CREB3L2-/-/ -/-/ - hg19 fibrosarcoma - 12915480 Oncogene; Cosmic_nonrecurrent
FUS_CREB3L2-/-/ -/-/ - hg19 fibrosarcoma - 16931951 Oncogene; Cosmic_nonrecurrent
FUS_CREB3L2-/-/ -/-/ - hg19 fibrosarcoma - 18382348 Oncogene; Cosmic_nonrecurrent
FUS_CREB3L2-/-/ -/-/ - hg19 fibrosarcoma - 15640831 Oncogene; Cosmic_nonrecurrent
FUS_CREB3L2-/-/ -/-/ - hg19 hyalinizing spindle cell tumor - 17295648 Oncogene; Cosmic_nonrecurrent
FUS_CREB3L2-/-/ -/-/ - hg19 fibrosarcoma - 17721195 Oncogene; Cosmic_nonrecurrent
FUS_CREB3L2-/-/ -/-/ - hg19 sclerosing epithelioid fibrosarcoma - 17721195 Oncogene; Cosmic_nonrecurrent
FUS_CREB3L2-/-/ -/-/ - hg18 fibromyxoid sarcoma - - Oncogene; Mitelman
FUS_CREB3L2-/0/ -/0/ Exonic hg18 - - - Oncogene; TICdb
FUS_CREB3L2-/124/ -/85/ Exonic hg18 - - - Oncogene; TICdb
FUS_CREB3L2-/1320/ -/94/ Exonic hg18 - - - Oncogene; TICdb
FUS_CREB3L2-/-/ -/-/ - hg18 low grade fibromyxoid sarcoma - 12915480 Oncogene; OMIM

ChimerPUB

Top
The fusion gene pair FUS--CREB3L2 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
FUS_CREB3L2t(7;16)(q34;p11) / / 21399449fibrous histiocytoma;sarcoma;histiocytoma FISH - A t(7;16)(q34;p11) translocation, yielding a FUS/CREB3L2 fusion gene, has been identified in approximately 80%-90% of deep soft tissue LGFMS. /// "A t(7;16)(q34;p11) translocation, yielding a FUS/CREB3L2 fusion gene, has been identified in approximately 80%-90% of deep soft tissue LGFMS. "
FUS_CREB3L2- 24441665sarcoma FISH - LGFMS is characterized by expression of the MUC4 protein, and about 90% of cases display a distinctive FUS-CREB3L2 gene fusion. /// "LGFMS is characterized by expression of the MUC4 protein, and about 90% of cases display a distinctive FUS-CREB3L2 gene fusion. " /// All 5 cases of LGFMS with progression to SEF morphology or hybrid features had FUS-CREB3L2 fusion transcripts. /// All 5 cases of LGFMS with progression to SEF morphology or hybrid features had FUS-CREB3L2 fusion transcripts.
FUS_CREB3L2t(7;16)(q32-34;p11) / t(7;16) / 20471519sarcoma FISH;PCR;RT-PCR - Chromosome banding analysis revealed a supernumerary ring chromosome, and further studies with fluorescence in situ hybridization and reverse transcriptase-polymerase chain reaction (RT-PCR) showed that the ring contained material from chromosomes 7 and 16, that the FUS gene was present in two rearranged copies, and that it expressed the FUS/CREB3L2 fusion gene. /// "However, supernumerary ring chromosomes have been identified in a subset of FUS/CREB3L2-positive LGFMS, but it has not yet been formally demonstrated that such ring chromosomes harbor the FUS/CREB3L2 fusion gene. "
FUS_CREB3L2t(12;16)(q13;p11) / t(7;16)(q34;p11) / t(9;22)(q31;q12) / 18162764chondrosarcoma;liposarcoma;sarcoma FISH - Distinct chromosomal translocations have been identified in several myxoid sarcomas, including t(12;16)(q13;p11) FUS-DDIT3 in myxoid liposarcoma, t(7;16)(q34;p11) FUS-CREB3L2 in low-grade fibromyxoid sarcoma, and t(9;22)(q31;q12) EWSR1-NR4A3 in extraskeletal myxoid chondrosarcoma.
FUS_CREB3L2t(7;16) / 20499220sarcoma FISH - Recently, a link has been suggested between SEF and low-grade fibromyxoid sarcoma (LGFMS) on the basis of the finding of the characteristic translocation t(7;16) (FUS-CREB3L2) of LGFMS in a small number of studied cases of SEF. /// "Recently, a link has been suggested between SEF and low-grade fibromyxoid sarcoma (LGFMS) on the basis of the finding of the characteristic translocation t(7;16) (FUS-CREB3L2) of LGFMS in a small number of studied cases of SEF."
FUS_CREB3L2t(7;16)(q33;p11) / 15139001sarcoma FISH;PCR;RT-PCR - To delineate the spectrum of tumors that may harbor the FUS/CREB3L2 gene, we selected 45 low-grade spindle cell sarcomas for reverse transcriptase polymerase chain reaction (RT-PCR) and/or fluorescence in situ hybridization (FISH) analyses. /// The results indicated that FUS/CREB3L2 is specifically associated with LGFMS and that RT-PCR or FISH analysis may be useful for the differential diagnosis.. /// "Of the 59 tumors analyzed, 12 were FUS/CREB3L2-positive, all of which were diagnosed at histopathologic re-examination as being LGFMS, of both the classical subtype and the subtype with giant collagen rosettes. " /// The chimeric FUS/CREB3l2 gene is specific for low-grade fibromyxoid sarcoma..
FUS_CREB3L2- 25532939sarcoma FISH - We describe a case of superficial low-grade fibromyxoid sarcoma (LGFMS) in a 12-year-old boy, confirmed by the detection of FUS-CREB3L2 fusion transcripts by reverse-transcription polymerase chain reaction and FUS rearrangement with fluorescence in situ hybridization, which had morphological features similar to ossifying fibromyxoid tumor (OFMT), including an almost complete rim of mature, metaplastic bone.
FUS_CREB3L2- 26135531pelvic neoplasm FISH - In view of this we assessed DOG1 expression in 10 other LGFMS (all MUC4 positive, and 9 molecularly confirmed to harbor FUS-CREB3L2 fusion transcripts and/or FUS or EWSR1 gene rearrangement), of which 5 showed DOG1 expression in up to 75% of tumor cells, varying in intensity from weak to strong. /// "In view of this we assessed DOG1 expression in 10 other LGFMS (all MUC4 positive, and 9 molecularly confirmed to harbor FUS-CREB3L2 fusion transcripts and/or FUS or EWSR1 gene rearrangement), of which 5 showed DOG1 expression in up to 75% of tumor cells, varying in intensity from weak to strong. " /// "After referral to a tertiary center, repeat DOG1 immunohistochemistry again showed diffuse expression, but MUC4 was also positive, and this was confirmed to be LGFMS, harboring FUS-CREB3L2 fusion transcripts by reverse transcription-polymerase chain reaction and FUS rearrangement with fluorescence in situ hybridization. "
FUS_CREB3L2- 25231134fibrosarcoma;sarcoma FISH - These results further demarcate a relative cytogenetic dichotomy between pure SEF, often characterized by EWSR1 rearrangements, and hybrid SEF/LGFMS, harboring FUS-CREB3L2 fusion. /// "In contrast, recent studies pointed out that SEF harbor frequent EWSR1 rearrangements, with only a minority of cases showing FUS-CREB3L2 fusions. " /// "While the majority of LGFMS cases are characterized by a FUS-CREB3L1 fusion, both FUS-CREB3L2 and EWSR1-CREB3L1 fusions were recently demonstrated in a small number of LGFMS and SEF/LGFMS hybrid tumors. "
FUS_CREB3L2t(7;16) (q32-34;p11) / 15640831sarcoma - - Cytogenetic analyses have identified a recurrent balanced translocation t(7;16) (q32-34;p11), later shown by molecular genetic approaches to result in a FUS/CREB3L2 fusion gene. /// "Reverse transcriptase-polymerase chain reaction analysis disclosed a FUS/CREB3L2 fusion transcript in 22 of the 23 (96%) cases that remained classified as LGFMS after the histologic re-evaluation and from which RNA of sufficient quality could be extracted, whereas none of the cases that were classified as other tumor types was fusion-positive. " /// "Taken together, the results indicate that virtually all LGFMS are characterized by a chimeric FUS/CREB3L2 gene, and that rare cases may display a variant FUS/CREB3L1 fusion.. " /// "Taken together, the results indicate that virtually all LGFMS are characterized by a chimeric FUS/CREB3L2 gene, and that rare cases may display a variant FUS/CREB3L1 fusion.." /// "Thus, it is expected that the novel FUS/CREB3L1 chimera will have a similar impact at the cellular level as the much more common FUS/CREB3L2 fusion protein. "
FUS_CREB3L2t(7;16)(q33;p11) / t(7;16) / 21536545sarcoma - - Low-grade fibromyxoid sarcoma (LGFMS) is typically characterized by the specific translocation t(7;16)(q33;p11) and the corresponding fusion gene FUS-CREB3L2. /// "FUS-CREB3L2 was capable of activating transcription from CD24 regulatory sequences in luciferase assays, suggesting an important role for the upregulation of this gene in LGFMS. " /// FOXL1 was identified as the top upregulated gene in LGFMS and CD24 was upregulated in both LGFMS tumors and FUS-CREB3L2 expressing cells. /// "In addition, cells that stably expressed FUS-CREB3L2 were analyzed with gene expression array and the influence of FUS-CREB3L2 on gene expression was investigated in vitro. " /// The data could be used to identify a potential diagnostic marker for LGFMS and to identify possible FUS-CREB3L2 regulated genes.. /// FUS-CREB3L2/L1-positive sarcomas show a specific gene expression profile with upregulation of CD24 and FOXL1..
FUS_CREB3L2t(7;16)(q34;p11) / t(11;16)(p11;p11) / 22819758sarcoma - - Low-grade fibromyxoid sarcoma is a rare soft tissue sarcoma of fibroblastic differentiation characterized by a deceptively benign morphologic appearance with almost consistent MUC4 expression and recurrent chromosomal translocations, t(7;16)(q34;p11) and t(11;16)(p11;p11), resulting in the FUS-CREB3L2 and FUS-CREB3L1 fusion genes, respectively. /// "The diagnosis of the tumor was confirmed by positive immunoreactivity to MUC4 and the FUS-CREB3L2 fusion detected by molecular testing using formalin-fixed, paraffin-embedded tissue. "
FUS_CREB3L2t(7,16)(q33;p11) / / 19605340histiocytoma - - Such analyses have demonstrated that most cases of LGFMS have a characteristic t(7,16)(q33;p11) translocation, resulting in the FUS-CREB3L2 fusion gene.
FUS_CREB3L2t(7;16)(q33;p11) / 16931951perineurioma PCR - Recent cytogenetic and molecular analyses have shown that most LGFMSs have a characteristic chromosomal abnormality, t(7;16)(q33;p11), resulting in the FUS-CREB3L2 fusion gene. /// The primers were newly designed to specifically amplify most of the junctional regions of the FUS-CREB3L2 fusion gene transcripts previously reported. /// The FUS-CREB3L2 fusion gene transcripts were detected in 14/16 (88%) cases of LGFMS. /// "In the present study, we conducted a reverse transcription-polymerase chain reaction assay to detect the FUS-CREB3L2 fusion transcripts using formalin-fixed, paraffin-embedded tumor tissue specimens from 16 LGFMSs including 3 cases with giant collagen rosettes. " /// "Molecular detection of FUS-CREB3L2 fusion transcripts in low-grade fibromyxoid sarcoma using formalin-fixed, paraffin-embedded tissue specimens.. " /// "The FUS-CREB3L2 fusion transcripts were not detected in any of the 123 other soft-tissue tumors, including desmoid-type fibromatoses, myxofibrosarcomas, soft-tissue perineuriomas, and congenital or adult fibrosarcomas. " /// "These data suggest that our reverse transcription-polymerase chain reaction assay is a reliable method to detect FUS-CREB3L2, which can thus help in accurately diagnosing LGFMS.. " /// "These data suggest that our reverse transcription-polymerase chain reaction assay is a reliable method to detect FUS-CREB3L2, which can thus help in accurately diagnosing LGFMS.."
FUS_CREB3L2- 26276044sarcoma - - Most LGFMSs harbor a characteristic gene fusion of FUS-CREB3L2, and recently MUC4 immunostaining has been found to be highly sensitive and specific for the diagnosis.
FUS_CREB3L2- 25183312sarcoma - - Deeply located low-grade fibromyxoid sarcoma with FUS-CREB3L2 gene fusion in a 5-year-old boy with review of literature.. /// "Despite the young age, this patient was accurately diagnosed by the typical histology and the detection of a FUS-CREB3L2 gene fusion. "
FUS_CREB3L2t(7;16)(q33;p11) / 17295648sarcoma PCR;RT-PCR - Reported herein is a case of primary pulmonary HSCT that had FUS-CREB3L2 fusion transcripts, a product of characteristic chromosomal abnormality t(7;16)(q33;p11) of HSCT and LGFMS. /// "Reverse transcription-polymerase chain reaction (RT-PCR) assay using formalin-fixed, paraffin-embedded tissue detected FUS-CREB3L2 fusion transcripts. " /// RT-PCR for detection of FUS-CREB3L2 fusion transcripts is a useful method for differential diagnosis of primary pulmonary HSCT.. /// Hyalinizing spindle cell tumor with giant rosettes arising in the lung: report of a case with FUS-CREB3L2 fusion transcripts..
FUS_CREB3L2- 16948525sarcoma - - both neoplasms share the same cytogenetic abnormality, a balanced translocation resulting in a FUS/CREB3L2 fusion gene. /// "A closely related but morphologically distinct tumor, the so-called hyalinizing spindle cell tumor with giant rosettes, has also been described; both neoplasms share the same cytogenetic abnormality, a balanced translocation resulting in a FUS/CREB3L2 fusion gene."
FUS_CREB3L2- 26772399sarcoma - - This diagnosis often hinges on the presence of the hallmark cytogenetic aberration, a balanced 7;16 translocation resulting in a FUS-CREB3L2 fusion gene.
FUS_CREB3L2- 18382348sarcoma PCR;RT-PCR - In 14 informative examples, including 11 with detectable fusion transcripts by RT-PCR, DNA-based PCR amplified the FUS-CREB3L2 fusion gene in 9 (64%) examples. /// " Detection of the tumor-specific fusion gene, FUS-CREB3L2, is useful in the diagnosis of low-grade fibromyxoid sarcoma (LGFMS), especially by reverse transcription (RT)-polymerase chain reaction (PCR) using formalin-fixed, paraffin-embedded (FFPE) tumor tissues. " /// "In this study, DNA and RNA were extracted from FFPE specimens of 16 and 19 LGFMSs, respectively, and PCR and RT-PCR were performed using primers that specifically amplify most of the junctional regions of the FUS-CREB3L2 fusion gene. " /// "Because FUS and CREB3L2 gene segments with their break points within exons are fused without interposed introns in many LGFMSs, DNA-based PCR may also be applicable to detect the FUS-CREB3L2 fusion gene using FFPE specimens. " /// "Although the sensitivity was not as high as RT-PCR, DNA-based PCR can be used as an alternative molecular approach for detecting the FUS-CREB3L2 fusion gene.. " /// "Because FUS and CREB3L2 gene segments with their break points within exons are fused without interposed introns in many LGFMSs, DNA-based PCR may also be applicable to detect the FUS-CREB3L2 fusion gene using FFPE specimens." /// RT-PCR analysis revealed FUS-CREB3L2 fusion transcripts in 16 of the 19 (84%) LGFMSs. /// "DNA-based polymerase chain reaction for detecting FUS-CREB3L2 in low-grade fibromyxoid sarcoma using formalin-fixed, paraffin-embedded tissue specimens.. "
FUS_CREB3L2- 23290535cardiac tumor - - Genomic polymerase chain reaction of genomic DNA revealed the typical FUS/Creb3L2 fusion gene products typical of low-grade fibromyxoid sarcoma.
FUS_CREB3L2t(7;16)(q33p11) / 17255901liposarcoma;dermatofibrosarcoma protuberans;fibrous histiocytoma;sarcoma;histiocytoma - - The chimeric FUS/CREB3L2 gene seems to be specific for LGFMS and its expression in the t(7;16)(q33p11) is a useful tool for the differential diagnosis.
FUS_CREB3L2- 21406083soft tissue neoplasm FISH;PCR;RT-PCR - RT-PCR and FISH for the FUS-CREB3L2 fusion transcript are useful tools for confirming LGFMS diagnosis, but have no role in predicting medium-term clinical outcome. /// "The FUS-CREB3L2 gene translocation, which occurs commonly in LGFMS, may be detected by reverse-transcriptase polymerase chain reaction (RT-PCR) and fluorescence in situ hybridisation (FISH). " /// "Results showed 50% of cases tested positive for the FUS-CREB3L2 translocation by RT-PCR and 81.8% by FISH, suggesting FISH is more sensitive than RT-PCR for confirming LGFMS diagnosis. " /// The clinical significance of the FUS-CREB3L2 translocation in low-grade fibromyxoid sarcoma..
FUS_CREB3L2- 22567356dermatofibrosarcoma, - - Cytogenetic and molecular genetic analyses have shown that many of these sarcomas are characterized by recurrent chromosomal translocations resulting in highly specific fusion genes (e.g., FUS-DDIT3 in MLS, FUS-CREB3L2 in LGFMS, EWSR1-NR4A3 in EMC, and COL1A1-PDGFB in myxoid DFSP).
FUS_CREB3L2- 24666374sarcoma - - MUC 4-negative FUS-CREB3L2 rearranged low-grade fibromyxoid sarcoma. /// MUC 4-negative FUS-CREB3L2 rearranged low-grade fibromyxoid sarcoma..
FUS_CREB3L2- 25437654sarcoma - - Reverse transcription polymerase chain reaction from a formalin-fixed, paraffin-embedded biopsy specimen revealed a FUS-CREB3L2 gene fusion (exon6/int/exon5), leading to the diagnosis of LGFMS. /// A case of low-grade fibromyxoid sarcoma with unusual central necrosis in a 77-year-old man confirmed by FUS-CREB3L2 gene fusion..
FUS_CREB3L2t(7;16)(q33;p11) / 21658743synovial sarcoma;osteosarcoma;sarcoma ISH - Subsequently, it was discovered to carry the recurrent chromosomal translocation t(7;16)(q33;p11) encoding a FUS-CREB3L2 fusion oncoprotein.
FUS_CREB3L2t(7,16) (q32-34;p11) / t(11,16) (p11;p11) / / 17721195sarcoma - - Low-grade fibromyxoid sarcomas (LGFMS) bear either the t(7,16) (q32-34;p11) or t(11,16) (p11;p11) translocations, resulting in FUS-CREB3L2 or FUS-CREB3L1 fusions, respectively. /// "Low-grade fibromyxoid sarcomas (LGFMS) bear either the t(7,16) (q32-34;p11) or t(11,16) (p11;p11) translocations, resulting in FUS-CREB3L2 or FUS-CREB3L1 fusions, respectively." /// "Of all, 7/52 non-LGMFS neoplasms contained FUS-CREB3L2 transcripts, of which 4 had been diagnosed as sclerosing epithelioid fibrosarcoma. " /// "Of all, 48/59 (sensitivity, 81%) LGFMS contained detectable transcripts (45 FUS-CREB3L2, 3 FUS-CREB3L1). " /// "Of all, 7/52 non-LGMFS neoplasms contained FUS-CREB3L2 transcripts, of which 4 had been diagnosed as sclerosing epithelioid fibrosarcoma."
FUS_CREB3L2- 16287497sarcoma - - It was not possible to detect the FUS/CREB3L2 and FUS/CREB3L1 fusion genes from the formalin-fixed and paraffin-embedded tissue, although the histological features of the present case were typical of LGFMS.

ChimerSEQ

Top
The fusion gene pair FUS--CREB3L2 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
FUS_CREB3L2chr16/31196384/ chr7/137565145/ 16p11.2 7q33 Exonic hg19 - Inter-chr NA AJ549094 Oncogene; ChiTaRs
FUS_CREB3L2chr16/31199514/ chr7/137565145/ 16p11.2 7q33 Exonic hg19 - Inter-chr fibromyxoid sarcoma AJ549093 Oncogene; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair FUS--CREB3L2 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AJ549094FUS--CREB3L2 FUS16 31195544 31196384 + 1 299 100 CREB3L27 137565145 137593099 - 297 1270 100
Human AJ549093FUS--CREB3L2 FUS16 31199478 31199514 - 271 307 100 CREB3L27 137565145 137593090 - 306 1270 100

FARE-CAFE

Top
The fusion gene pair FUS--CREB3L2 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
FUS-CREB3L2 Low-grade fibromyxoid sarcoma FISH,RT-PCR t(7;16)(q34;p11) PubMed:15139001

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
FUS-CREB3L2 FUS-CREB3L2-Isoform1 FUS _ _ 1 CREB3L2 137593065 0 1 AGGTGGCCGTGGAGGCAGAGGTGGCATGcCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAG 17721195 _
FUS-CREB3L2 FUS-CREB3L2-Isoform2 FUS 31196358 1 1 CREB3L2 137593051 0 1 TAGTGGTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTCACAGCCTCACTCCAAACCCTTTCCTGGGTCGCCCTTCAGCCTGCCTCAGACCCACAGCCCCTCCAGAGCTG _ AJ549097
FUS-CREB3L2 FUS-CREB3L2-Isoform3 FUS _ _ 1 CREB3L2 137593072 0 1 GCAGAGGTGGCATGGGCGGAAGTGgCAGCCTGAGTCCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGA 17721195 _
FUS-CREB3L2 FUS-CREB3L2-Isoform4 FUS 31195702 1 1 CREB3L2 137590551 0 1 GTACAACAGCAGCAGTGGTGGTGGAGGTGaAACTGCAGGGATCAGGCCCTCTGGTCCTGACAGAGGAGGAGAA 17721195 _
FUS-CREB3L2 FUS-CREB3L2-Isoform5 FUS 31195702 1 1 CREB3L2 137593169 0 1 GTACAACAGCAGCAGTGGTGGTGGAGGTGtggtccactggggctgcaaaaaaggaagcacGAGTCCCAACCCACGCCTGCA 17721195 _
FUS-CREB3L2 FUS-CREB3L2-Isoform6 FUS 31196500 1 1 CREB3L2 137593090 0 1 GTGGCCGTGGAGGCAGAGGTGGCATGGGatgtctTGACTCAGAGGGCAGCCTGAGTCCCAACCCACGCCTGCACC 17721195 _
FUS-CREB3L2 FUS-CREB3L2-Isoform7 FUS 31196500 1 1 CREB3L2 137593072 0 1 GTGGCCGTGGAGGCAGAGGTGGCATGGGcCTGAGTCCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGA 17721195 _
FUS-CREB3L2 FUS-CREB3L2-Isoform8 FUS 31196953 0 1 CREB3L2 137593071 0 1 GTGGCCGTGGAGGCAGAGGTGGCATGGGcttccaggaattggctactCCACGCCTGCACCCCTTCAGCCTGCCTCAGAC 17721195 _
FUS-CREB3L2 FUS-CREB3L2-Isoform9 FUS 31196471 1 1 CREB3L2 137593062 0 1 GTGGTGGCTATGAACCCAGAGGTCGTGGAaACCCACGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAGCCC 17721195 _
FUS-CREB3L2 FUS-CREB3L2-Isoform10 FUS 31196384 1 1 CREB3L2 137590573 0 1 GTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTATGGACAGCAGGACCGTGGAGGCCGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAGCCCCTCCAGAGCTGCACCCCGGGCCCCCTCCGCCCTCTCCAGCTCCCCTCTCCTCACGGCTCCTCATAAACTGCAGGGATCAGGCCCTC _ AJ549094

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
FUS-CREB3L2 FUS-CREB3L2-Isoform1 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
FUS-CREB3L2 FUS-CREB3L2-Isoform2 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
FUS-CREB3L2 FUS-CREB3L2-Isoform3 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
FUS-CREB3L2 FUS-CREB3L2-Isoform4 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
FUS-CREB3L2 FUS-CREB3L2-Isoform5 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
FUS-CREB3L2 FUS-CREB3L2-Isoform6 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
FUS-CREB3L2 FUS-CREB3L2-Isoform7 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
FUS-CREB3L2 FUS-CREB3L2-Isoform8 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
FUS-CREB3L2 FUS-CREB3L2-Isoform9 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
FUS-CREB3L2 FUS-CREB3L2-Isoform10 - - - -FUS 1) RRM_1
2) zf-RanBP
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
CREB3L2 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_1
2) zf-RanBP
3) bZIP_1
1) 2OG-FeII_Oxy_2 , Mago-bind , PHD , RRM_6 , La , Mago_nashi , Pkinase , SAP18 , MIF4G_like , NOPS , RRM_1 , SF3b1 , MIF4G_like_2 , NUDIX_2 , RRM_5 , Vinculin
2) ubiquitin , Ras
3) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
FUS-CREB3L2 hsa-miR-124-3phsa-miR-19b-3phsa-miR-92a-3phsa-miR-16-5p hsa-miR-197-3phsa-miR-664a-3phsa-miR-1296-5phsa-miR-615-3phsa-miR-331-3phsa-miR-125b-5phsa-miR-221-3phsa-miR-181b-5phsa-miR-10a-5phsa-miR-1260b Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
FUS-CREB3L2 NM_001170634.1 - - -

TicDB

Top
The fusion gene pair FUS--CREB3L2 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
FUS CREB3L2 17721195 AGGTGGCCGTGGAGGCAGAGGTGGCATGcCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAG
FUS CREB3L2 17721195 GCAGAGGTGGCATGGGCGGAAGTGgCAGCCTGAGTCCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGA
FUS CREB3L2 17721195 GTACAACAGCAGCAGTGGTGGTGGAGGTGaAACTGCAGGGATCAGGCCCTCTGGTCCTGACAGAGGAGGAGAA
FUS CREB3L2 17721195 GTACAACAGCAGCAGTGGTGGTGGAGGTGtggtccactggggctgcaaaaaaggaagcacGAGTCCCAACCCACGCCTGCA
FUS CREB3L2 17721195 GTGGCCGTGGAGGCAGAGGTGGCATGGGatgtctTGACTCAGAGGGCAGCCTGAGTCCCAACCCACGCCTGCACC
FUS CREB3L2 17721195 GTGGCCGTGGAGGCAGAGGTGGCATGGGcCTGAGTCCCAACCCACGCCTGCACCCCTTCAGCCTGCCTCAGA
FUS CREB3L2 17721195 GTGGCCGTGGAGGCAGAGGTGGCATGGGcttccaggaattggctactCCACGCCTGCACCCCTTCAGCCTGCCTCAGAC
FUS CREB3L2 17721195 GTGGTGGCTATGAACCCAGAGGTCGTGGAaACCCACGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAGCCC
FUS CREB3L2 AJ549094 GTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTATGGACAGCAGGACCGTGGAGGCCGCCTGCACCCCTTCAGCCTGCCTCAGACCCACAGCCCCTCCAGAGCTGCACCCCGGGCCCCCTCCGCCCTCTCCAGCTCCCCTCTCCTCACGGCTCCTCATAAACTGCAGGGATCAGGCCCTC
FUS CREB3L2 AJ549096 ACCGCCATGGAGGTGCTGGAGAGCGGGGAGCAGGGCGTGCTGCAGTGGGACCGCAAGCTGAGCGAGCTGTCAGAGCCCGGGGACGGCGAGGCCCTCATGTACCACACGGCCCTCGGGACCAAGGATCACGTCATGACTCCGACAAACAAGAAAACGGGACAGCCCATGATTAATTTGTACACAGACAGGGAAACTGGCAAGCTGAAGGGA
FUS CREB3L2 AJ549097 TAGTGGTGGTGGCAGTGGTGGCGGTTATGGCAATCAAGACCAGAGTGGTGGAGGTGGCAGCGGTGGCTCACAGCCTCACTCCAAACCCTTTCCTGGGTCGCCCTTCAGCCTGCCTCAGACCCACAGCCCCTCCAGAGCTG

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair FUS--CREB3L2 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair FUS--CREB3L2 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair FUS--CREB3L2 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene FUS--CREB3L2 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene FUS--CREB3L2 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene FUS--CREB3L2 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene FUS--CREB3L2 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene FUS--CREB3L2 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair FUS--CREB3L2 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene FUS--CREB3L2 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene FUS--CREB3L2 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene FUS is a known oncogene according to ONGENE database.
The tail gene CREB3L2 is not a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene FUS is cancer associated according to Bushman Cancer Gene database.


The tail gene CREB3L2 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene FUS is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene CREB3L2 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene FUS--CREB3L2 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene FUS--CREB3L2 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair FUS--CREB3L2 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene FUS--CREB3L2 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene FUS--CREB3L2 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair FUS--CREB3L2 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair FUS--CREB3L2 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair FUS--CREB3L2 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
FUS--CREB3L2The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7
FUS--CREB3L2The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7

Cortex_Dataset

Top
Fusion gene FUS--CREB3L2 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair FUS--CREB3L2 information is not available in ChromothripsisDB database.