FOXO1--PAX3

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

FOXO1 PAX3

COSMIC

The fusion gene pair FOXO1--PAX3 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair FOXO1--PAX3 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
FOXO1_PAX3-/1015/ -/1540/ Exonic hg19 - - - Oncogene; Tumor_suppressor; Cosmic_recurrent
FOXO1_PAX3-/-/ -/-/ - hg19 rhabdomyosarcoma - 8275086 Oncogene; Tumor_suppressor; Cosmic_nonrecurrent
FOXO1_PAX3-/-/ -/-/ - hg18 alveolar rhabdomyosarcoma - 3691179 Oncogene; Tumor_suppressor; OMIM
FOXO1_PAX3-/-/ -/-/ - hg18 alveolar rhabdomyosarcoma - 8098985 Oncogene; Tumor_suppressor; OMIM
FOXO1_PAX3-/-/ -/-/ - hg18 alveolar rhabdomyosarcoma - 8275086 Oncogene; Tumor_suppressor; OMIM
FOXO1_PAX3-/-/ -/-/ - hg18 alveolar rhabdomyosarcoma - 9479491 Oncogene; Tumor_suppressor; OMIM

ChimerPUB

Top
The fusion gene pair FOXO1--PAX3 information is not available in CHIMERPUB (CHIMERDB 3.0) database.

ChimerSEQ

Top
The fusion gene pair FOXO1--PAX3 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
FOXO1_PAX3chr13/41240779/ chr2/223065795/ 13q14.11 2q36.1 Exonic hg19 - Inter-chr NA JX141476 Oncogene; Tumor_suppressor; ChiTaRs
FOXO1_PAX3chr13/41240779/ chr2/223066051/ 13q14.11 2q36.1 Exonic hg19 - Inter-chr NA JX141475 Oncogene; Tumor_suppressor; ChiTaRs
FOXO1_PAX3chr13/41240779/ chr2/223066552/ 13q14.11 2q36.1 Exonic hg19 - Inter-chr rhabdomyosarcoma JX141474 Oncogene; Tumor_suppressor; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair FOXO1--PAX3 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human JX141476FOXO1--PAX3 FOXO113 41239718 41240779 - 1 1062 99.8 PAX32 223065795 223066911 - 1059 1503 100
Human JX141475FOXO1--PAX3 FOXO113 41239718 41240779 - 1 1062 99.8 PAX32 223066051 223066911 - 1059 1418 100
Human JX141474FOXO1--PAX3 FOXO113 41239718 41240779 - 1 1062 99.8 PAX32 223066552 223066911 - 1059 1418 100

FARE-CAFE

Top
The fusion gene pair FOXO1--PAX3 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
FOXO1-PAX3 Alveolar rhabdomyosarcoma _ t(2;13)(q35;q14) PubMed:8275086

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
FOXO1-PAX3 FOXO1-PAX3 FOXO1 _ _ 0 PAX3 _ 0 _ _ _ _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
FOXO1-PAX3 FOXO1-PAX3 - - - -FOXO1 1) Fork_head
2) FOXO_KIX_bdg
3) FOXO-TAD
1) Fork_head , RHD
PAX3 1) PAX
1) Ets
1) Fork_head
2) FOXO_KIX_bdg
3) FOXO-TAD
4) PAX
1) Fork_head , RHD
2) Ets

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
FOXO1-PAX3 hsa-miR-1hsa-miR-206hsa-miR-27a-3phsa-miR-27b-3phsa-miR-324-5phsa-let-7e-5phsa-let-7b-5p hsa-miR-182-5phsa-miR-96-5phsa-miR-186-5phsa-miR-183-5phsa-miR-153-3phsa-miR-9-5phsa-miR-223-3phsa-miR-335-5phsa-miR-98-5phsa-miR-106b-3phsa-miR-132-3phsa-miR-196a-5phsa-miR-15a-5p Report assay,Western Blot,Microarray,qPCR,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
FOXO1-PAX3 NM_002015.3 1) STAT1_HUMAN
2) E2F4_HUMAN
3) PRDM14_HUMAN
4) ESTROGEN RECEPTOR ALPHA_HUMAN
5) EGR1_HUMAN
6) FOS_HUMAN
7) GATA2_HUMAN
8) GATA3_HUMAN
9) CTCF_HUMAN
10) TAL1_HUMAN
11) BRG1_HUMAN
12) HNF4A_HUMAN
13) TFAP2C_HUMAN
14) FOXA1_HUMAN
15) CEBPA_HUMAN
16) CTCF_HUMAN
17) STAT6_HUMAN
18) ESR1_HUMAN
19) ESR2_HUMAN
20) SPI1_HUMAN
1) TRIM28_HUMAN
2) MITF_HUMAN
3) SOX2_HUMAN
1) 19122651
2) 21247883
3) 20953172
4) 20547749
5) 20690147
6) 20139302
7) 21808000
8) 21878914
9) 21795385
10) 21795385
11) 19505939
12) 21646355
13) 21572391
14) 21572391
15) 20219941
16) 20219941
17) 21828071
18) 21235772
19) 21235772
20) 21241896

TicDB

Top
The fusion gene pair FOXO1--PAX3 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
FOXO1 PAX3 8275086 AGCACCAGGCATGGATTTTCCAGCTATACAGACAGCTTTGTGCCTCCGTCGGGGCCCTCCAACCCCATGAACCCCACCATTGGCAATGGCCTCTCACCTCAGAATTCAATTCGTCATAATCTGTCCCTACACAGCAAGTTCATTCGTGTGCAGAATGAAGGAACTGGAAAAAGTTCTTGGTGGATGCTCAATCCAGAGGGTGGCAAGAGC

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair FOXO1--PAX3 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair FOXO1--PAX3 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair FOXO1--PAX3 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene FOXO1--PAX3 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene FOXO1--PAX3 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene FOXO1--PAX3 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene FOXO1--PAX3 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene FOXO1--PAX3 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair FOXO1--PAX3 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene FOXO1--PAX3 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene FOXO1--PAX3 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene FOXO1 is a known oncogene according to ONGENE database.


The tail gene PAX3 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene FOXO1 is cancer associated according to Bushman Cancer Gene database.


The tail gene PAX3 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene FOXO1 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene PAX3 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene FOXO1--PAX3 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene FOXO1--PAX3 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair FOXO1--PAX3 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene FOXO1--PAX3 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene FOXO1--PAX3 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair FOXO1--PAX3 information is available in Klijn Dataset.

Cell lineGene 5'Gene 3'Read evidenceKinaseChromosome 5'Position 5'Chromosome 3'Position 3'Fusion type DNAFusion type RNAFusion protein lengthTissueKnown Fusion
SJCRH30FOXO1PAX314N13412397202223066909TranslocinFrame324SarcomatoidFull fusion known

Fimereli_Dataset

Top
The fusion gene pair FOXO1--PAX3 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair FOXO1--PAX3 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene FOXO1--PAX3 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair FOXO1--PAX3 information is not available in ChromothripsisDB database.