Hyperlinks to databases below
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset

Link to Genecards:



The fusion gene pair EWSR1--WT1 information is available in COSMIC database.



The fusion gene pair EWSR1--WT1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
EWSR1_WT1-/1112/ -/1242/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_WT1-/1331/ -/1242/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_WT1-/1364/ -/1242/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_WT1-/1293/ -/1242/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_WT1-/732/ -/1425/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_WT1-/1293/ -/1425/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_WT1-/1112/ -/1332/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 7530783 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 10029456 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 9646031 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 8604806 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 14648792 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 7862627 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 7495283 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 10556013 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 10496592 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 10555010 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 14520438 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 12653957 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 11480729 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 15371955 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 15166674 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 12131150 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 12296765 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 16930335 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 17425400 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 leiomyosarcoma - 17325488 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 17414105 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 8187063 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 16730884 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 10208465 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 17964965 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 10999739 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 10989634 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 17021139 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 8522311 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 19263077 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 18561179 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 18580682 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 19913282 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 20861791 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 20739766 - Cosmic_nonrecurrent
EWSR1_WT1-/-/ -/-/ - hg18 desmoplastic small round cell tumor - - - Mitelman
EWSR1_WT1-/0/ -/0/ Exonic hg18 - - - - TICdb
EWSR1_WT1-/-/ -/-/ - hg18 small round cell tumor - 7862627 - OMIM


The fusion gene pair EWSR1--WT1 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
EWSR1_WT1- 24395394brachial plexopathy;peripheral nerve tumor - - A pathognomonic fusion of Ewing sarcoma breakpoint region 1 and Wilms tumor 1 genes (EWSR1/WT1) was present. /// A pathognomonic fusion of Ewing sarcoma breakpoint region 1 and Wilms tumor 1 genes (EWSR1/WT1) was present.


The fusion gene pair EWSR1--WT1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
EWSR1_WT1chr22/29683128/ chr11/32414261/ 22q12.2 11p13 Exonic hg19 - Inter-chr NA S79672 - ChiTaRs
EWSR1_WT1chr22/29683128/ chr11/32410699/ 22q12.2 11p13 Exonic hg19 - Inter-chr desmoplastic small round cell tumor S74529 - ChiTaRs

ChiTaRS 2.1

The fusion gene pair EWSR1--WT1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
Human S74529EWSR1--WT1 EWSR122 29683066 29683128 + 1 63 100 WT111 32410699 32414301 - 59 268 100
Human S79672EWSR1--WT1 EWSR122 29683093 29683128 + 1 36 100 WT111 32414261 32414301 - 32 72 100


The fusion gene pair EWSR1--WT1 information is available in FARE-CAFE.

Cancer Information
EWSR1-WT1 Desmoplastic small round cell tumor RT-PCR,PCR t(11;22)(p13;q12) PubMed: 7862627

Genomic Information
EWSR1-WT1 EWSR1-WT1-Isoform2 EWSR1 29674205 0 1 WT1 32410672 0 1 gcttatccagcctatgggcagccagcagccactgcacctacaagctgaaaagcccttcagctgtcggtggccaagttgtcagaaaaagtttgcccggt 16730884 _
EWSR1-WT1 EWSR1-WT1-Isoform5 EWSR1 29674205 0 1 WT1 32410672 0 1 gcttatccagcctatgggcagccagcagccactgcacctacaagctgaaaagcccttcagctgtcggtggccaagttgtcagaaaaagtttgcccggt 16730884 _

Domains and DDI Information
EWSR1-WT1 EWSR1-WT1-Isoform1 - - 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
WT1 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
EWSR1-WT1 EWSR1-WT1-Isoform2 - - 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
WT1 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
EWSR1-WT1 EWSR1-WT1-Isoform3 - - 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
WT1 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
EWSR1-WT1 EWSR1-WT1-Isoform4 - - 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
WT1 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
EWSR1-WT1 EWSR1-WT1-Isoform5 - - 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
WT1 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
EWSR1-WT1 EWSR1-WT1-Isoform6 - - 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
WT1 1) WT1
2) zf-H2C2_2
1) zf-C2H2 , zf-H2C2_2 , zf-C2H2_4 , zf-C2H2_6
1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras

miRNA Information
EWSR1-WT1 hsa-miR-16-5phsa-miR-15a-5phsa-miR-212-3p hsa-let-7a-5phsa-miR-877-3phsa-miR-615-3phsa-miR-423-3phsa-miR-328-3phsa-miR-362-5phsa-miR-320ahsa-miR-149-5phsa-miR-23b-3phsa-miR-196a-5phsa-miR-100-5phsa-let-7c-5p qPCR,Microarray

Transcription Factors Information
EWSR1-WT1 NM_001163285.1 - 1) PAX8_HUMAN
4) P53_HUMAN
10) E2F1_HUMAN


The fusion gene pair EWSR1--WT1 information is available in TICDB.
EWSR1 WT1 16730884 gcttatccagcctatgggcagccagcagccactgcacctacaagctgaaaagcccttcagctgtcggtggccaagttgtcagaaaaagtttgcccggt

TUMOR FUSION Gene Data Portal

The fusion gene pair EWSR1--WT1 information is not available in TUMOR FUSION Gene Data Portal.


The fusion gene pair EWSR1--WT1 information is not available in FusionCancer Database.


The fusion gene pair EWSR1--WT1 information is not available in ConjoinG Database.


Fusion gene EWSR1--WT1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]


Fusion gene EWSR1--WT1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )


Fusion gene EWSR1--WT1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]


Fusion gene EWSR1--WT1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]


Fusion gene EWSR1--WT1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]


The fusion gene pair EWSR1--WT1 information is not available in Babiceanu_Dataset.


Fusion gene EWSR1--WT1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]


Fusion gene EWSR1--WT1 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

The head gene EWSR1 is a known oncogene according to ONGENE database.

The tail gene WT1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

The head gene EWSR1 is cancer associated according to Bushman Cancer Gene database.

The tail gene WT1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

The head gene EWSR1 is proto-oncogene or tumor suppresor gene according to Uniprot database.

The tail gene WT1 is proto-oncogene or tumor suppresor gene according to Uniprot database.


Fusion gene EWSR1--WT1 is not found in oesophageal tumors from TCGA samples, which are published here.


Fusion gene EWSR1--WT1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.


The fusion gene pair EWSR1--WT1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).


Fusion gene EWSR1--WT1 is not found in pancreatic tumor dataset, published here.


Fusion gene EWSR1--WT1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]


The fusion gene pair EWSR1--WT1 information is not available in Klijn Dataset.


The fusion gene pair EWSR1--WT1 information is not found in Fimereli_Dataset.


The fusion gene pair EWSR1--WT1 is found in known fusion genelist compiled from literature.

EWSR1--WT1The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7


Fusion gene EWSR1--WT1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.


The fusion gene pair EWSR1--WT1 information is not available in ChromothripsisDB database.