EWSR1--FLI1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

EWSR1 FLI1

COSMIC

The fusion gene pair EWSR1--FLI1 information is available in COSMIC database.

Link
EWSR1--FLI1

ChimerKB

Top
The fusion gene pair EWSR1--FLI1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
EWSR1_FLI1-/1112/ -/920/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1112/ -/854/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1364/ -/920/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1364/ -/854/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1112/ -/1046/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1112/ -/986/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1364/ -/1046/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1331/ -/650/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1331/ -/986/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1112/ -/1094/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1364/ -/986/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1293/ -/986/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/1293/ -/920/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 7591257 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 8040301 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 askins tumor - 8040301 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 8223458 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11471459 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11846300 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9293447 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 12736494 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 15714060 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 small round cell tumor - 7530783 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 7530783 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 7524604 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 16487358 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9646032 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11064357 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9836070 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9586882 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 17334332 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 8617485 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 askins tumor - 8617485 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 16157025 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 7599072 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 8648380 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9242212 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9104953 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 1522903 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 askins tumor - 8076344 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 15565546 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 8516324 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 8339272 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 7495283 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9738976 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 17879630 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 17592716 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 17762498 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 8022439 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 sarcoma - 8022439 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 16100468 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 15354743 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 16784984 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 15188147 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 10702731 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 7522496 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 10492040 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9130994 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11178636 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11176062 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11878783 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11464048 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11261815 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11570916 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11573731 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11890993 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11679946 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11567233 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11815873 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 12377657 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 biphenotypic sarcoma - 9490279 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 16990715 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 16639307 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 16864960 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 17016721 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 12606131 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 12683899 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 biphenotypic sarcoma - 7882340 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9135495 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 neuroblastoma - 9135495 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 10379685 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 10842247 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 10565682 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 10571517 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 pancreas tumors - 11000339 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 - - 10897036 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 17525681 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 17487851 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 16803953 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 15929128 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 15926159 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 14615834 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11304041 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 medulloblastoma - 11304041 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 small round cell tumor - 8644855 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 rhabdomyosarcoma - 8644855 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 askins tumor - 17970070 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 10493837 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11903609 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 10989634 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 9552022 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 18090934 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 17154184 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 17342771 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 19150107 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 askins tumor - 19036597 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 18769338 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 18623202 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 11123763 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 18602673 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 18615675 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 19273933 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 18525469 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 18580682 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 19820381 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 askins tumor - 20962673 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 21063743 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 21073841 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 20513536 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 22508822 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 22508822 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 20308669 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 20495444 - Cosmic_nonrecurrent
EWSR1_FLI1-/-/ -/-/ - hg19 ewing sarcoma - 21181413 - Cosmic_nonrecurrent
EWSR1_FLI1-/0/ -/0/ Exonic hg18 - - - - TICdb
EWSR1_FLI1-/1570/ -/21553/ Exonic hg18 - - - - TICdb
EWSR1_FLI1-/2704/ -/1016/ Exonic hg18 - - - - TICdb

ChimerPUB

Top
The fusion gene pair EWSR1--FLI1 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
EWSR1_FLI1- 23494411ewing sarcoma;sarcoma PCR;RT-PCR - Nine different EWSR1-FLI1 fusion transcripts and one EWSR1-ERG fusion transcript were identified in 21 out of 23 fresh frozen EFT tissue samples. /// Here we present a retrospective study designed to detect all of the EWSR1-FLI1 and EWSR1-ERG fusion transcripts in a series of 23 fresh frozen EFT tissues. /// RT-PCR and nested fluorescent multiplex PCR were used to amplify EWSR1-FLI1 and EWSR1-ERG transcripts from EFT tissues.
EWSR1_FLI1- 23637256small cell carcinoma - - The tumor disclosed the EWSR1-FLI1 rearrangement, and we propose to designate it as a carcinoma of the thyroid with Ewing family tumor elements.. /// "The tumor disclosed the EWSR1-FLI1 rearrangement, and we propose to designate it as a carcinoma of the thyroid with Ewing family tumor elements.. "
EWSR1_FLI1- 24275884medullary carcinoma - - The existence of small cell thyroid tumors with EWSR1-FLI1 rearrangement together with neuroendocrine and/or carcinomatous differentiation raises not only differential diagnostic problems but also a very interesting therapeutic dilemma. /// The existence of small cell thyroid tumors with EWSR1-FLI1 rearrangement together with neuroendocrine and/or carcinomatous differentiation raises not only differential diagnostic problems but also a very interesting therapeutic dilemma.
EWSR1_FLI1- 21987447osteosarcoma PCR;ISH - We report the case of a 12-year-old girl with multifocal small cell osteosarcoma positive for the Ewing sarcoma breakpoint region 1 (EWSR1) gene rearrangement by interphase fluorescent in situ hybridization and negative for EWSR1-FLI1, EWSR1-ERG, and EWSR1-WT1 fusion transcripts by reverse transcriptase PCR. /// "We report the case of a 12-year-old girl with multifocal small cell osteosarcoma positive for the Ewing sarcoma breakpoint region 1 (EWSR1) gene rearrangement by interphase fluorescent in situ hybridization and negative for EWSR1-FLI1, EWSR1-ERG, and EWSR1-WT1 fusion transcripts by reverse transcriptase PCR. "
EWSR1_FLI1- 26214589ewing sarcoma;sarcoma - - Ewing sarcoma is characterized by fusions between EWSR1 and members of the ETS gene family, usually EWSR1-FLI1, leading to the generation of oncogenic transcription factors that bind DNA at GGAA motifs. /// "Ewing sarcoma is characterized by fusions between EWSR1 and members of the ETS gene family, usually EWSR1-FLI1, leading to the generation of oncogenic transcription factors that bind DNA at GGAA motifs. " /// Chimeric EWSR1-FLI1 regulates the Ewing sarcoma susceptibility gene EGR2 via a GGAA microsatellite. /// "EWSR1-FLI1 preferentially bound to the A risk allele, which increased global and allele-specific EGR2 expression. " /// Chimeric EWSR1-FLI1 regulates the Ewing sarcoma susceptibility gene EGR2 via a GGAA microsatellite..
EWSR1_FLI1- 25031013olfactory neuroblastoma - - A recent study using a limited number of tumor samples has shown that NKX2.2, a putative transcriptional target of EWSR1-FLI1, is a useful marker for the diagnosis of ES. /// "A recent study using a limited number of tumor samples has shown that NKX2.2, a putative transcriptional target of EWSR1-FLI1, is a useful marker for the diagnosis of ES. " /// "The combination of CD99 and NKX2.2, a transcriptional target of EWSR1-FLI1, is highly specific for the diagnosis of Ewing sarcoma.. " /// "In the present study, the immunohistochemical expression of NKX2.2 was evaluated on 46 genetically confirmed ES and 85 non-ES SRCTs, together with comparative assessment of CD99 and other molecular targets of EWSR1-FLI1, including NR0B1, E2F3, and EZH2. "
EWSR1_FLI1- 19417137ewing sarcoma;sarcoma - - Because these mitotic abnormalities mimic those observed with the knockdown of EWSR1 in zebrafish embryos and HeLa cells, we investigated whether EWSR1/FLI1 interacts with EWSR1 and interferes with its function. /// "Because these mitotic abnormalities mimic those observed with the knockdown of EWSR1 in zebrafish embryos and HeLa cells, we investigated whether EWSR1/FLI1 interacts with EWSR1 and interferes with its function. " /// We show that injection of human or zebrafish EWSR1/FLI1 mRNA into developing zebrafish embryos leads to mitotic defects with multipolar and disorganized mitotic spindles. /// This interaction between EWSR1/FLI1 and EWSR1 in Ewing sarcoma may induce mitotic defects leading to genomic instability and subsequent malignant transformation.. /// "EWSR1 coimmunoprecipitates with EWSR1/FLI1, and overexpression of EWSR1 rescues the mitotic defects in EWSR1/FLI1-transfected HeLa cells. " /// Ewing sarcoma fusion protein EWSR1/FLI1 interacts with EWSR1 leading to mitotic defects in zebrafish embryos and human cell lines..
EWSR1_FLI1- 19528446- - - Synthetic RNAs corresponding to EWSR1-FLI1 were used as substrates. /// Cleavage of the Ewing tumour-specific EWSR1-FLI1 mRNA by hammerhead ribozymes.. /// "Therefore, inactivation of EWSR1-FLI1 is an interesting strategy for EFT therapy. " /// The RNA corresponding to EWSR1-FLI1 is accessible for ribozyme mediated inactivation and ribozymes are able to cleave EWSR1-FLI1 specific RNA in the presence of a high background of normal cellular RNAs.. /// A ribozyme with specificity for EWSR1-FLI1 was developed and the activity in vitro was investigated. /// "In the majority of EFT, EWSR1-FLI1 (Ewing sarcoma breakpoint region 1-Friend leukaemia virus integration 1) fusion proteins can be detected and EWSR1-FLI1 substantially contributes to the malignant phenotype of EFT." /// "In the majority of EFT, EWSR1-FLI1 (Ewing sarcoma breakpoint region 1-Friend leukaemia virus integration 1) fusion proteins can be detected and EWSR1-FLI1 substantially contributes to the malignant phenotype of EFT. "
EWSR1_FLI1- 18435455- PCR;RT-PCR - The sensitivity of the LIPI RT-PCR was similar to the sensitivity of the conventional EWSR1-FLI1 RT-PCR, suggesting that LIPI might be useful as additional diagnostic target structure. /// "The sensitivity of the LIPI RT-PCR was similar to the sensitivity of the conventional EWSR1-FLI1 RT-PCR, suggesting that LIPI might be useful as additional diagnostic target structure. "
EWSR1_FLI1- 26579494ewing sarcoma - - OX40L transgenic Ewing sarcoma cells showed preserved expression of Ewing sarcoma-associated (anti)gens including lipase member I, cyclin D1 (CCND1), cytochrome P450 family member 26B1 (CYP26B1), and the Ewing sarcoma breakpoint region 1-friend leukemia virus integration 1 (EWSR1-FLI1) oncogene. /// "OX40L transgenic Ewing sarcoma cells showed preserved expression of Ewing sarcoma-associated (anti)gens including lipase member I, cyclin D1 (CCND1), cytochrome P450 family member 26B1 (CYP26B1), and the Ewing sarcoma breakpoint region 1-friend leukemia virus integration 1 (EWSR1-FLI1) oncogene. "

ChimerSEQ

Top
The fusion gene pair EWSR1--FLI1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
EWSR1_FLI1chr22/29683123/ chr11/128675261/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA EU487217 - ChiTaRs
EWSR1_FLI1chr22/29683123/ chr11/128679052/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA S72620 - ChiTaRs
EWSR1_FLI1chr22/29683125/ chr11/128651853/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JF290490 - ChiTaRs
EWSR1_FLI1chr22/29683696/ chr11/128649564/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JX266519 - ChiTaRs
EWSR1_FLI1chr22/29685527/ chr11/128664435/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JX266521 - ChiTaRs
EWSR1_FLI1chr22/29684045/ chr11/128678890/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JX266513 - ChiTaRs
EWSR1_FLI1chr22/29685434/ chr11/128656786/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JX266526 - ChiTaRs
EWSR1_FLI1chr22/29685391/ chr11/128652206/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JX266527 - ChiTaRs
EWSR1_FLI1chr22/29684445/ chr11/128660603/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JX266522 - ChiTaRs
EWSR1_FLI1chr22/29684890/ chr11/128646068/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JX266524 - ChiTaRs
EWSR1_FLI1chr22/29684308/ chr11/128649485/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JX266511 - ChiTaRs
EWSR1_FLI1chr22/29684012/ chr11/128675073/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA JX266515 - ChiTaRs
EWSR1_FLI1chr22/29684552/ chr11/128645452/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA AJ229253 - ChiTaRs
EWSR1_FLI1chr22/29684688/ chr11/128646996/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA AJ229255 - ChiTaRs
EWSR1_FLI1chr22/29684744/ chr11/128647366/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA AJ229262 - ChiTaRs
EWSR1_FLI1chr22/29683849/ chr11/128653317/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA AJ229264 - ChiTaRs
EWSR1_FLI1chr22/29683942/ chr11/128659590/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr NA AJ229259 - ChiTaRs
EWSR1_FLI1chr22/29683125/ chr11/128677075/ 22q12.2 11q24.3 Exonic hg19 - Inter-chr meduloblastoma AF327066 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair EWSR1--FLI1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF327066EWSR1--FLI1 EWSR122 29668204 29683125 + 13 795 100 FLI111 128677075 128680883 + 794 1431 99.7
Human EU487217EWSR1--FLI1 EWSR122 29668204 29683123 + 13 793 100 FLI111 128675261 128680883 + 794 1497 100
Human S72620EWSR1--FLI1 EWSR122 29683039 29683123 + 1 85 100 FLI111 128679052 128680449 + 86 229 100
Human JF290490EWSR1--FLI1 EWSR122 29663998 29683125 + 1 1141 100 FLI111 128651853 128683162 + 1140 4188 100
Human JX266519EWSR1--FLI1 EWSR122 29683594 29683696 + 4 106 100 FLI111 128649564 128649685 + 104 225 99.2
Human JX266521EWSR1--FLI1 EWSR122 29685417 29685527 + 1 112 97.3 FLI111 128664435 128664547 + 113 225 100
Human JX266513EWSR1--FLI1 EWSR122 29683940 29684045 + 1 106 100 FLI111 128678890 128679008 + 107 225 100
Human JX266526EWSR1--FLI1 EWSR122 29685285 29685434 + 1 150 100 FLI111 128656786 128656860 + 151 225 100
Human JX266527EWSR1--FLI1 EWSR122 29685282 29685391 + 1 99 99 FLI111 128652206 128652341 + 90 225 100
Human JX266522EWSR1--FLI1 EWSR122 29684298 29684445 + 1 148 100 FLI111 128660603 128660680 + 148 225 100
Human JF290489EWSR1--FLI1 EWSR122 29663998 29683123 + 1 1139 100 FLI111 128675261 128683162 + 1140 4122 100
Human JX266524EWSR1--FLI1 EWSR122 29684798 29684890 + 1 93 100 FLI111 128646068 128646199 + 94 225 99.3
Human JX266511EWSR1--FLI1 EWSR122 29684246 29684308 + 1 63 100 FLI111 128649485 128649647 + 63 225 100
Human JX266515EWSR1--FLI1 EWSR122 29683904 29684012 + 1 109 100 FLI111 128675073 128675191 + 107 225 100
Human AJ229253EWSR1--FLI1 EWSR122 29684486 29684552 + 1 67 100 FLI111 128645452 128645565 + 67 180 100
Human AJ229255EWSR1--FLI1 EWSR122 29684606 29684688 + 1 83 100 FLI111 128646996 128647094 + 82 180 100
Human AJ229262EWSR1--FLI1 EWSR122 29684666 29684744 + 1 79 100 FLI111 128647366 128647466 + 80 180 99.1
Human AJ229264EWSR1--FLI1 EWSR122 29683706 29683849 + 1 133 99.3 FLI111 128653317 128653378 + 119 180 100
Human AJ229259EWSR1--FLI1 EWSR122 29683826 29683942 + 1 119 96.4 FLI111 128659590 128659667 + 103 180 100

FARE-CAFE

Top
The fusion gene pair EWSR1--FLI1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
EWSR1-FLI1 Ewing Sarcoma Southern blot,PCR,DNA sequencing t(11;22)(q24;q12) PubMed: 10197607,8516324,9005992

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
EWSR1-FLI1 EWSR1-FLI1-Isoform1 EWSR1 29683123 0 1 FLI1 128675261 1 0 agcagcagctacgggcagcagaAcccttcttatgactcagtc 18602673 _
EWSR1-FLI1 EWSR1-FLI1-Isoform2 EWSR1 29687479 0 1 FLI1 128676342 1 0 AAGGTTGTATATTGAGGAAATTTGAGCAAGCTGCCCTGAAGAAAGGCATAGTGACAAGATGAGAGAGATGCATTGTTTGGAGATGTGTTTAGCCAGTGCCCTTCTTCCCCACGATCAGGTTCCTGGAGCTTAGGATGTGTGATGCAGAAGAAGTCTGGAAAGGTAAGAAACAGAATTGTA _ AJ229311
EWSR1-FLI1 EWSR1-FLI1-Isoform3 EWSR1 29684693 1 1 FLI1 128673434 1 0 CAGGACCACCCCAGTAGCATGGGTGTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGCATGGAGGACACATAAAGGGTTCCTGGAGGTTGACAATCACAGTTACCCTCTCATACTCACATGCAAGGACGAGGAACTTGTTTCCTATTAC _ AJ229320
EWSR1-FLI1 EWSR1-FLI1-Isoform4 EWSR1 29683125 0 1 FLI1 128677075 1 0 AGCCAACAGAGCAGCAGCTACGGGCAGCAGAGTCCTCCCCTTGGAGGGGCACAAACGATC _ S62665
EWSR1-FLI1 EWSR1-FLI1-Isoform5 EWSR1 _ _ 1 FLI1 128651853 1 0 TACGGGCAGCAGAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCA _ S64709
EWSR1-FLI1 EWSR1-FLI1-Isoform6 EWSR1 29683123 0 1 FLI1 128679052 1 0 CCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGAATCCGTATCAGATCCTGGGCCCGACCAGCAGTCGCCTAGCCAACCCTGGAAGCGGGCAGATCCAGCTGTGGCAATTCCTCCTGGAGCTGCTCTCCGACAGCGCCAACGCCAGCTGTATCACCTGGGAGGGGACCAACGGGGAGT _ S72620

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
EWSR1-FLI1 EWSR1-FLI1-Isoform1 - - 1) Ets
1) SRF-TF , Ank_2 , PAX , Ets
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
FLI1 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
3) SAM_PNT
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) SAM_PNT , Phage_lysozyme
EWSR1-FLI1 EWSR1-FLI1-Isoform2 - - 1) Ets
1) SRF-TF , Ank_2 , PAX , Ets
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
FLI1 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
3) SAM_PNT
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) SAM_PNT , Phage_lysozyme
EWSR1-FLI1 EWSR1-FLI1-Isoform3 - - 1) Ets
1) SRF-TF , Ank_2 , PAX , Ets
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
FLI1 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
3) SAM_PNT
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) SAM_PNT , Phage_lysozyme
EWSR1-FLI1 EWSR1-FLI1-Isoform4 - - 1) Ets
1) SRF-TF , Ank_2 , PAX , Ets
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
FLI1 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
3) SAM_PNT
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) SAM_PNT , Phage_lysozyme
EWSR1-FLI1 EWSR1-FLI1-Isoform5 - - 1) Ets
1) SRF-TF , Ank_2 , PAX , Ets
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
FLI1 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
3) SAM_PNT
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) SAM_PNT , Phage_lysozyme
EWSR1-FLI1 EWSR1-FLI1-Isoform6 - - 1) Ets
1) SRF-TF , Ank_2 , PAX , Ets
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
FLI1 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
3) SAM_PNT
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) SAM_PNT , Phage_lysozyme

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
EWSR1-FLI1 hsa-miR-145-5phsa-miR-155-5phsa-miR-124-3p hsa-let-7a-5phsa-miR-877-3phsa-miR-615-3phsa-miR-423-3phsa-miR-328-3phsa-miR-362-5phsa-miR-320ahsa-miR-149-5phsa-miR-23b-3phsa-miR-196a-5phsa-miR-100-5phsa-let-7c-5p Report assay,Western Blot,Microarray,qPCR

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
EWSR1-FLI1 NM_001163285.1 - - -

TicDB

Top
The fusion gene pair EWSR1--FLI1 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
EWSR1 FLI1 18602673 agcagcagctacgggcagcagaAcccttcttatgactcagtc
EWSR1 FLI1 AJ229311 AAGGTTGTATATTGAGGAAATTTGAGCAAGCTGCCCTGAAGAAAGGCATAGTGACAAGATGAGAGAGATGCATTGTTTGGAGATGTGTTTAGCCAGTGCCCTTCTTCCCCACGATCAGGTTCCTGGAGCTTAGGATGTGTGATGCAGAAGAAGTCTGGAAAGGTAAGAAACAGAATTGTA
EWSR1 FLI1 AJ229320 CAGGACCACCCCAGTAGCATGGGTGTTTATGGGCAGGAGTCTGGAGGATTTTCCGGACCAGGAGAGAACCGGAGCATGAGTGGCCCTGCATGGAGGACACATAAAGGGTTCCTGGAGGTTGACAATCACAGTTACCCTCTCATACTCACATGCAAGGACGAGGAACTTGTTTCCTATTAC
EWSR1 FLI1 S62665 AGCCAACAGAGCAGCAGCTACGGGCAGCAGAGTCCTCCCCTTGGAGGGGCACAAACGATC
EWSR1 FLI1 S64709 TACGGGCAGCAGAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCA
EWSR1 FLI1 S72620 CCCACTAGTTACCCACCCCAAACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGAATCCGTATCAGATCCTGGGCCCGACCAGCAGTCGCCTAGCCAACCCTGGAAGCGGGCAGATCCAGCTGTGGCAATTCCTCCTGGAGCTGCTCTCCGACAGCGCCAACGCCAGCTGTATCACCTGGGAGGGGACCAACGGGGAGT

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair EWSR1--FLI1 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair EWSR1--FLI1 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair EWSR1--FLI1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene EWSR1--FLI1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene EWSR1--FLI1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene EWSR1--FLI1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene EWSR1--FLI1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene EWSR1--FLI1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair EWSR1--FLI1 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene EWSR1--FLI1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene EWSR1--FLI1 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene EWSR1 is a known oncogene according to ONGENE database.


The tail gene FLI1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene EWSR1 is cancer associated according to Bushman Cancer Gene database.


The tail gene FLI1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene EWSR1 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene FLI1 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene EWSR1--FLI1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene EWSR1--FLI1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair EWSR1--FLI1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene EWSR1--FLI1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene EWSR1--FLI1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair EWSR1--FLI1 information is available in Klijn Dataset.

Cell lineGene 5'Gene 3'Read evidenceKinaseChromosome 5'Position 5'Chromosome 3'Position 3'Fusion type DNAFusion type RNAFusion protein lengthTissueKnown Fusion
MHH-ES-1EWSR1FLI1179N222968312311128651853TranslocinFrame526SarcomatoidFull fusion known
A-673EWSR1FLI173N222968312311128675261TranslocinFrame504SarcomatoidFull fusion known
TC-71EWSR1FLI149N222968312311128675261TranslocinFrame504SarcomatoidFull fusion known

Fimereli_Dataset

Top
The fusion gene pair EWSR1--FLI1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair EWSR1--FLI1 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
EWSR1--FLI1The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7
EWSR1--FLI1Development and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumorshttps://doi.org/10.1016/j.jmoldx.2018.03.007

Cortex_Dataset

Top
Fusion gene EWSR1--FLI1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair EWSR1--FLI1 information is not available in ChromothripsisDB database.