EWSR1--ERG

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

EWSR1 ERG

COSMIC

The fusion gene pair EWSR1--ERG information is available in COSMIC database.

Link
EWSR1--ERG

ChimerKB

Top
The fusion gene pair EWSR1--ERG information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
EWSR1_ERG-/1112/ -/967/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_ERG-/1112/ -/1141/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_ERG-/1112/ -/1036/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_ERG-/1364/ -/967/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_ERG-/1112/ -/1093/ Exonic hg19 - - - - Cosmic_recurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 7591257 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 8707406 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 8040301 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 small round cell tumor - 11441341 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 8223458 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 15044653 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 11846300 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 9293447 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 12736494 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 15628889 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 8076344 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 15714060 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 7530783 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 7524604 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 16487358 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 desmoplastic small round cell tumor - 9706984 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 9646032 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 11064357 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 9836070 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 9071576 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 11823984 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 8625264 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 9242212 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 9586882 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 8162068 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 17334332 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 9475198 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 askins tumor - 10209495 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 8617485 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 7599072 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 8648380 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 15565546 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 9738976 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 11474174 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 8022439 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 sarcoma - 8022439 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 10492040 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 17487851 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 17342771 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 18615675 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 18459906 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 18580682 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 20633768 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 20308669 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg19 ewing sarcoma - 21181413 - Cosmic_nonrecurrent
EWSR1_ERG-/-/ -/-/ - hg18 ewing tumor - - - Mitelman
EWSR1_ERG-/0/ -/0/ Exonic hg18 - - - - TICdb
EWSR1_ERG-/32/ -/7/ Exonic hg18 - - - - TICdb
EWSR1_ERG-/37/ -/613/ Exonic hg18 - - - - TICdb
EWSR1_ERG-/-/ -/-/ - hg18 ewing tumor - 8084618 - OMIM

ChimerPUB

Top
The fusion gene pair EWSR1--ERG information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
EWSR1_ERGt(11;22)(q24;q12) / t(1;21;7) / 20633768ewing sarcoma;sarcoma FISH - Reverse-transcriptase polymerase chain reaction analysis of RNA isolated from the tumor demonstrated a EWSR1-ERG fusion transcript, fusing exon 7 of EWSR1 and exon 11 of ERG. /// "To our knowledge, this is the first report of a EWSR1-ERG fusion in an ES tumor with an apparently duplicated 5' portion of EWSR1, and with a complex translocation involving chromosomes 1, 7, and 21. "
EWSR1_ERGt(11;22) / t(21;22) / 23706910ewing sarcoma;sarcoma FISH;PCR;RT-PCR - RT-PCR was positive in 27 (84.4%) of 32 patients, including 24 EWSR1-FLI1 and 3 EWSR1-ERG.
EWSR1_ERG- 18615675ewing tumor; nephroblastoma FISH - This approach revealed several submicroscopic chromosomal aberrations and three different seemingly balanced translocations, resulting in a heterozygous deletion of HACE1, an EWSR1/ERG fusion, and an EWSR1/FLI1 fusion, respectively.
EWSR1_ERG- 26675070clear cell sarcoma;ewing sarcoma;sarcoma FISH - However, polymerase chain reaction testing for ES-specific rearrangements (EWSR1/FLI1, EWSR1/ERG, EWSR1/ETV1, EWSR1/ETV4, EWS/FEV) failed to confirm the ES origin of the neoplastic tissue.
EWSR1_ERG- 24898918ewing sarcoma;sarcoma FISH;PCR;RT-PCR - Tumours were investigated by means of immunohistochemistry, RT-PCR (EWSR1-FLI1, EWSR1-ERG and EWSR1-FEV transcripts), FISH analysis (EWSR1 break-apart and specific EWSR1-FEV translocation) and spectral karyotyping (SKY).
EWSR1_ERG- 26690869ewing sarcoma;sarcoma FISH;PCR;RT-PCR - Ewing sarcoma with ERG gene rearrangements: A molecular study focusing on the prevalence of FUS-ERG and common pitfalls in detecting EWSR1-ERG fusions by FISH.. /// "In one case, RNA sequencing identified an EWSR1-ERG transcript despite the negative EWSR1 rearrangements by FISH. " /// "In fact, ERG gene rearrangements represent the second most common molecular alteration, with EWSR1-ERG being identified in 5-10% of cases, while only a handful of reports document a FUS-ERG fusion. "
EWSR1_ERG- 23494411ewing sarcoma;sarcoma PCR;RT-PCR - Here we present a retrospective study designed to detect all of the EWSR1-FLI1 and EWSR1-ERG fusion transcripts in a series of 23 fresh frozen EFT tissues. /// Nine different EWSR1-FLI1 fusion transcripts and one EWSR1-ERG fusion transcript were identified in 21 out of 23 fresh frozen EFT tissue samples. /// RT-PCR and nested fluorescent multiplex PCR were used to amplify EWSR1-FLI1 and EWSR1-ERG transcripts from EFT tissues.
EWSR1_ERG- 21987447osteosarcoma PCR;ISH - We report the case of a 12-year-old girl with multifocal small cell osteosarcoma positive for the Ewing sarcoma breakpoint region 1 (EWSR1) gene rearrangement by interphase fluorescent in situ hybridization and negative for EWSR1-FLI1, EWSR1-ERG, and EWSR1-WT1 fusion transcripts by reverse transcriptase PCR.
EWSR1_ERG- 25999740ewing sarcoma;sarcoma - - We report an uncommon case of primary paraesophageal Ewing's sarcoma in a 25-year-old male harboring the infrequent EWSR1/ERG fusion transcript with multiple splice variants coexisting in the same tumor.
EWSR1_ERG- 23015660ewing sarcoma;sarcoma PCR;RT-PCR - Our aim was to establish a sensitive method which is able to identify all combinatorially possible EWSR1-FLI1 and EWSR1-ERG translocation transcripts in FFPE tissue samples despite significant RNA-degradation. /// "Using this method, we processed 60 FFPE samples of Ewing sarcoma family of tumours, and identified six types EWSR1-FLI1 and one type EWSR1-ERG chimeric transcripts acceptable for RT-PCR analysis in 27 out of 45 samples. " /// "The combination of fluorescent multiplex PCR with laser-induced capillary electrophoresis was used to detect and identify EWSR1-FLI1 and EWSR1-ERG chimeric transcripts on the basis of amplicon size, and forward primers labelled by distinct fluorophores. "
EWSR1_ERG- 26847175myoepithelioma - - NKX2-2 was positive in 37/40 (93%) Ewing sarcomas, including all atypical Ewing sarcomas and cases with known EWSR1-FLI1 or EWSR1-ERG fusion.
EWSR1_ERG- 24723486ewing sarcoma;sarcoma PCR - All ES expressed CD99 and FLI1, while ERG positivity was only seen in EWSR1-ERG fusion positive ES. /// "All ES expressed CD99 and FLI1, while ERG positivity was only seen in EWSR1-ERG fusion positive ES. "
EWSR1_ERG- 25441687ewing sarcoma;sarcoma - - This is illustrated by a case previously thought to represent an atypical carcinoid tumor, in which an EWSR1-ERG translocation was detected during next generation sequencing using a hybrid capture approach, leading to a revised diagnosis of Ewing sarcoma.
EWSR1_ERG- 11823984ewing sarcoma;sarcoma - - A reverse transcriptase-polymerase chain reaction followed by sequencing revealed an EWSR1/ERG chimeric transcript, which combined EWSR1 exon 10 with ERG exon 6. /// This type of tumor is well characterized by recurrent chromosomal translocation such as t (11;22) (q24;q12) (EWSR1/FLI1) or t (21;22) (q22;q12) (EWSR1/ERG) and overexpression of MIC2/CD99 on tumor cell membrane.
EWSR1_ERGt(11;22) / t(21;22) / t(2;22) / 21458383- - - We found five distinct types of EWSR1-FLI1 fusion transcripts resulting from translocation t(11;22), three types of EWSR1-ERG transcripts resulting from t(21;22), and one type of t(2;22) resulting in EWSR1-FEV fusion. /// "We found five distinct types of EWSR1-FLI1 fusion transcripts resulting from translocation t(11;22), three types of EWSR1-ERG transcripts resulting from t(21;22), and one type of t(2;22) resulting in EWSR1-FEV fusion."

ChimerSEQ

Top
The fusion gene pair EWSR1--ERG information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
EWSR1_ERGchr22/29683123/ chr21/39755343/ 22q12.2 21q22.2 Exonic hg19 - Inter-chr NA S72621 - ChiTaRs
EWSR1_ERGchr22/29683124/ chr21/39755343/ 22q12.2 21q22.2 Exonic hg19 - Inter-chr NA S72865 - ChiTaRs
EWSR1_ERGchr22/29683124/ chr21/39755802/ 22q12.2 21q22.2 Exonic hg19 - Inter-chr NA S70593 - ChiTaRs
EWSR1_ERGchr22/29683123/ chr21/39764323/ 22q12.2 21q22.2 Exonic hg19 - Inter-chr desmoplastic small round cell tumor S70579 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair EWSR1--ERG information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human S72621EWSR1--ERG EWSR122 29683039 29683123 + 1 85 100 ERG21 39755343 39764366 - 86 762 100
Human S72865EWSR1--ERG EWSR122 29683039 29683124 + 1 86 100 ERG21 39755343 39755845 - 86 588 100
Human S70579EWSR1--ERG EWSR122 29683093 29683123 + 1 31 96.8 ERG21 39764323 39764366 - 32 75 100
Human S70593EWSR1--ERG EWSR122 29683093 29683124 + 1 32 96.9 ERG21 39755802 39755845 - 32 75 100

FARE-CAFE

Top
The fusion gene pair EWSR1--ERG information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
EWSR1-ERG Ewing sarcoma RT-PCR t(21;22)(q22;q21) PubMed: 15044653

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
EWSR1-ERG EWSR1-ERG-Isoform1 EWSR1 _ _ 1 ERG _ 0 _ tacgggcagcagaGcagtggccagatc 20633768 _
EWSR1-ERG EWSR1-ERG-Isoform2 EWSR1 29683123 0 1 ERG 39764323 0 1 AGCCCACAGAGCAGCAGCTACGGGCAGCAGAATTTACCATATGAGCCCCCCAGGAGATCAGCCTGGACCGGTCAC _ S70579
EWSR1-ERG EWSR1-ERG-Isoform3 EWSR1 29683124 0 1 ERG 39755802 0 0 AGCCCACAGAGCAGCAGCTACGGGCAGCAGAGCAGTGGCCAGATCCAGCTTTGGCAGTTCCTCCTGGAGCTCCTG _ S70593
EWSR1-ERG EWSR1-ERG-Isoform4 EWSR1 29688158 0 1 ERG 39764341 0 1 ATGGATGAAGGACCAGATCTTGATCTAGATTTACCATATGAGCCCCCCAGGAGA _ S72622
EWSR1-ERG EWSR1-ERG-Isoform5 EWSR1 29682944 1 1 ERG 39762917 0 0 CTATTCCTCTACACAGCCGACTAGTTATGATCATCAGATTCTTGGACCAACAAGTAGCCGCCTTGCAAATCCAG _ S82335

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
EWSR1-ERG EWSR1-ERG-Isoform1 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
3) SAM_PNT
4) Ets
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) SAM_PNT , Phage_lysozyme
4) SRF-TF , Ank_2 , PAX , Ets
EWSR1-ERG EWSR1-ERG-Isoform2 - - 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
EWSR1-ERG EWSR1-ERG-Isoform3 - - 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
EWSR1-ERG EWSR1-ERG-Isoform4 - - 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
EWSR1-ERG EWSR1-ERG-Isoform5 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ERG 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
1) RRM_6
2) zf-RanBP
3) SAM_PNT
4) Ets
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) SAM_PNT , Phage_lysozyme
4) SRF-TF , Ank_2 , PAX , Ets

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
EWSR1-ERG hsa-miR-133a-3phsa-miR-145-5phsa-miR-133b hsa-let-7a-5phsa-miR-877-3phsa-miR-615-3phsa-miR-423-3phsa-miR-328-3phsa-miR-362-5phsa-miR-320ahsa-miR-149-5phsa-miR-23b-3phsa-miR-196a-5phsa-miR-100-5phsa-let-7c-5p Report assay

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
EWSR1-ERG NM_001163285.1 - - -

TicDB

Top
The fusion gene pair EWSR1--ERG information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
EWSR1 ERG 20633768 tacgggcagcagaGcagtggccagatc
EWSR1 ERG S70579 AGCCCACAGAGCAGCAGCTACGGGCAGCAGAATTTACCATATGAGCCCCCCAGGAGATCAGCCTGGACCGGTCAC
EWSR1 ERG S70593 AGCCCACAGAGCAGCAGCTACGGGCAGCAGAGCAGTGGCCAGATCCAGCTTTGGCAGTTCCTCCTGGAGCTCCTG
EWSR1 ERG S72622 ATGGATGAAGGACCAGATCTTGATCTAGATTTACCATATGAGCCCCCCAGGAGA
EWSR1 ERG S82335 CTATTCCTCTACACAGCCGACTAGTTATGATCATCAGATTCTTGGACCAACAAGTAGCCGCCTTGCAAATCCAG
EWSR1 ERG S82338 TGTCTAGGATTTGACTTTGTTTCTTTTTGCTGAAGATCCTTCAGTTACTCTCAGCAGAACACCTATGGGCAACCGAGCA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair EWSR1--ERG information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair EWSR1--ERG information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair EWSR1--ERG information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene EWSR1--ERG has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene EWSR1--ERG is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene EWSR1--ERG is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene EWSR1--ERG is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene EWSR1--ERG was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair EWSR1--ERG information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene EWSR1--ERG is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene EWSR1--ERG has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene EWSR1 is a known oncogene according to ONGENE database.


The tail gene ERG is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene EWSR1 is cancer associated according to Bushman Cancer Gene database.


The tail gene ERG is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene EWSR1 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ERG is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene EWSR1--ERG is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene EWSR1--ERG is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair EWSR1--ERG information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene EWSR1--ERG is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene EWSR1--ERG has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair EWSR1--ERG information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair EWSR1--ERG information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair EWSR1--ERG is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
EWSR1--ERGThe pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7

Cortex_Dataset

Top
Fusion gene EWSR1--ERG is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair EWSR1--ERG information is not available in ChromothripsisDB database.