EWSR1--DDIT3

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

EWSR1 DDIT3

COSMIC

The fusion gene pair EWSR1--DDIT3 information is available in COSMIC database.

Link
EWSR1--DDIT3

ChimerKB

Top
The fusion gene pair EWSR1--DDIT3 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
EWSR1_DDIT3-/1112/ -/76/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_DDIT3-/1364/ -/76/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_DDIT3-/1112+1382/ -/123-807/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_DDIT3-/1736/ -/142/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_DDIT3-/1112+(523_524)/ -/76-(604_605)/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_DDIT3-/1736+302/ -/76-629/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 12169678 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 16884691 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 8637704 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 9306965 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 10914725 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 11751490 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 17647282 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 12876210 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 12907366 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 17252290 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 18580682 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 20332486 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 18752119 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 21115923 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/-/ -/-/ - hg19 liposarcoma - 20473880 Transcription_Factor Cosmic_nonrecurrent
EWSR1_DDIT3-/0/ -/0/ Exonic hg18 - - - Transcription_Factor TICdb
EWSR1_DDIT3-/523/ -/2060/ Exonic hg18 - - - Transcription_Factor TICdb

ChimerPUB

Top
The fusion gene pair EWSR1--DDIT3 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
EWSR1_DDIT3- 25693574epithelioid sarcoma FISH - The EWSR1 gene rearrangement was detected by fluorescence in situ hybridization (FISH), but molecular biology failed to detect EWSR1/ETS, EWSR1/NR4A3, EWSR1/DDIT3, EWSR1/ATF1, EWSR1-POU5F1, EWSR1/ZNF444, EWSR1-PBX1 gene fusions. /// "The EWSR1 gene rearrangement was detected by fluorescence in situ hybridization (FISH), but molecular biology failed to detect EWSR1/ETS, EWSR1/NR4A3, EWSR1/DDIT3, EWSR1/ATF1, EWSR1-POU5F1, EWSR1/ZNF444, EWSR1-PBX1 gene fusions. "
EWSR1_DDIT3t(12;16) / t(12;22) / t(12;22) / 17647282liposarcoma;sarcoma FISH;PCR;RT-PCR - A single tumor carrying a t(12;22) translocation expressed a hitherto unknown EWSR1-DDIT3 fusion transcript (13-3) linking the complete RNA-binding domain of EWSR1 with a short piece of the 5'-UTR and the entire open reading frame of the DDIT3 gene. /// Nine FUS/DDIT3 and three EWSR1/DDIT3 variants of fusion transcripts have been described thus far. /// "Using break-apart FISH and RT-PCR combined with DNA sequencing, we detected FUS/DDIT3 fusions in 30 sarcomas, while an EWSR1/DDIT3 translocation was identified in one tumor. " /// Relevance of translocation type in myxoid liposarcoma and identification of a novel EWSR1-DDIT3 fusion..
EWSR1_DDIT3t(12;16)(q13;p11) / t(12;22)(q13;q12) / 17586092liposarcoma;sarcoma - - We aimed to study the usefulness of trabectedin in the treatment of patients with myxoid liposarcomas, a subtype of liposarcoma that is associated with specific chromosomal translocations t(12;16)(q13;p11) or t(12;22)(q13;q12) that result in the formation of DDIT3-FUS or DDIT3-EWSR1 fusion proteins.
EWSR1_DDIT3t(12,16) / / 23253485liposarcoma;sarcoma - - Molecular analysis of this tumor showed a t(12,16)?+?translocation resulting in a FUS-DDIT3 or EWSR1-DDIT3 fusion.
EWSR1_DDIT3t(12;22)(q13;q12) / 22570737liposarcoma;sarcoma - - EWSR1-DDIT3 is a chimeric fusion protein generated by the myxoid liposarcoma-specific chromosomal translocation t(12;22)(q13;q12). /// Myxoid liposarcoma-associated EWSR1-DDIT3 selectively represses osteoblastic and chondrocytic transcription in multipotent mesenchymal cells. /// Myxoid liposarcoma-associated EWSR1-DDIT3 selectively represses osteoblastic and chondrocytic transcription in multipotent mesenchymal cells.. /// "Another possible mechanism is an epigenetic action of EWSR1-DDIT3, which enhances histone deacetylation, DNA methylation, and histone H3K9 trimethylation at the transcriptional repression site. " /// The mechanism whereby EWSR1-DDIT3 contributes to the phenotypic selection of target cells during oncogenic transformation remains to be elucidated. /// This study elucidates the molecular mechanisms underlying EWSR1-DDIT3 fusion protein-mediated phenotypic selection of putative target multipotent mesenchymal cells during myxoid liposarcoma development. /// "Reporter assays showed that the EWSR1-DDIT3 myxoid liposarcoma fusion protein, but not its wild-type counterparts EWSR1 and DDIT3, selectively repressed the transcriptional activity of cell lineage-specific marker genes in multipotent mesenchymal C3H10T1/2 cells. " /// "The first is a genetic action of the EWSR1-DDIT3 fusion protein, which results in binding to the functional C/EBP site within Opn and Col11a2 promoters through interaction of its DNA-binding domain and subsequent interference with endogenous C/EBP? function. "
EWSR1_DDIT3- 25393000liposarcoma;sarcoma - - Myxoid/round-cell liposarcoma (MLS/RCLS) is characterized by either the fusion gene FUS-DDIT3 or the less commonly occurring EWSR1-DDIT3 and most cases carry few or no additional cytogenetic changes.
EWSR1_DDIT3- 26595521liposarcoma;sarcoma - - MLS is characterized by the FUS-DDIT3 or EWSR1-DDIT3 fusion oncogenes that encode abnormal transcription factors.
EWSR1_DDIT3t(14;22)(q32;q12) / 23630070mesothelioma - - The EWSR1 breakpoint in exon 8 in the EWSR1-YY1 chimeric transcript is similar to what is found in other fusions involving EWSR1 such as EWSR1-FLI1, EWSR1-DDIT3, and EWSR1-ATF1.

ChimerSEQ

Top
The fusion gene pair EWSR1--DDIT3 information is not available in CHIMERSEQ (CHIMERDB 3.0) database.

ChiTaRS 2.1

Top
The fusion gene pair EWSR1--DDIT3 information is not available in CHITARS database.

FARE-CAFE

Top
The fusion gene pair EWSR1--DDIT3 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
EWSR1-DDIT3 Myxoid liposarcoma FISH,PCR t(12;22)(q13;q12) PubMed:16884691

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
EWSR1-DDIT3 EWSR1-DDIT3-Isoform1 EWSR1 29694242 0 1 DDIT3 57912126 0 0 attgtgggagttcagccaggtgcagtggctcacgcctgtaaTtaggaaaatgctatgatttgttcccttccctgtagttta 16884691 _
EWSR1-DDIT3 EWSR1-DDIT3-Isoform2 EWSR1 29693939 0 1 DDIT3 57911499 0 1 caccccgtgagggcagaggcatgccaccaccactccgtggagTgttcaagaaggaagtgtatcttcatacatcaccacac 16884691 _
EWSR1-DDIT3 EWSR1-DDIT3-Isoform3 EWSR1 29683647 1 1 DDIT3 57912083 0 0 TAACATCTTGGATGCCCCAGTGAAGATTTCAGTGCTTTTTTCCAATTTGTTTTTAGTATGCCCTTCCCTGTAGTTTAGTTTTTACCCTGGCAGATTTGAGGCCTGCTTTGGATTTAGAGA _ Y10005

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
EWSR1-DDIT3 EWSR1-DDIT3-Isoform1 1) RRM_6
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
- -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
DDIT3 1) bZIP_2
1) RHD , TIG , bZIP_1 , bZIP_2
1) zf-RanBP
2) bZIP_2
1) ubiquitin , Ras
2) bZIP_2 , bZIP_1 , TIG , RHD
EWSR1-DDIT3 EWSR1-DDIT3-Isoform2 1) RRM_6
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
- -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
DDIT3 1) bZIP_2
1) RHD , TIG , bZIP_1 , bZIP_2
1) zf-RanBP
2) bZIP_2
1) ubiquitin , Ras
2) bZIP_2 , bZIP_1 , TIG , RHD
EWSR1-DDIT3 EWSR1-DDIT3-Isoform3 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
DDIT3 1) bZIP_2
1) RHD , TIG , bZIP_1 , bZIP_2
1) RRM_6
2) zf-RanBP
3) bZIP_2
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) bZIP_2 , bZIP_1 , TIG , RHD

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
EWSR1-DDIT3 hsa-miR-335-5phsa-miR-122-5phsa-miR-96-5p hsa-let-7a-5phsa-miR-877-3phsa-miR-615-3phsa-miR-423-3phsa-miR-328-3phsa-miR-362-5phsa-miR-320ahsa-miR-149-5phsa-miR-23b-3phsa-miR-196a-5phsa-miR-100-5phsa-let-7c-5p Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
EWSR1-DDIT3 NM_001163285.1 - - -

TicDB

Top
The fusion gene pair EWSR1--DDIT3 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
EWSR1 DDIT3 16884691 attgtgggagttcagccaggtgcagtggctcacgcctgtaaTtaggaaaatgctatgatttgttcccttccctgtagttta
EWSR1 DDIT3 16884691 caccccgtgagggcagaggcatgccaccaccactccgtggagTgttcaagaaggaagtgtatcttcatacatcaccacac
EWSR1 DDIT3 Y10005 TAACATCTTGGATGCCCCAGTGAAGATTTCAGTGCTTTTTTCCAATTTGTTTTTAGTATGCCCTTCCCTGTAGTTTAGTTTTTACCCTGGCAGATTTGAGGCCTGCTTTGGATTTAGAGA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair EWSR1--DDIT3 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair EWSR1--DDIT3 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair EWSR1--DDIT3 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene EWSR1--DDIT3 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene EWSR1--DDIT3 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene EWSR1--DDIT3 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene EWSR1--DDIT3 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene EWSR1--DDIT3 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair EWSR1--DDIT3 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene EWSR1--DDIT3 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene EWSR1--DDIT3 has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene EWSR1 is a known oncogene according to ONGENE database.


The tail gene DDIT3 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene EWSR1 is cancer associated according to Bushman Cancer Gene database.


The tail gene DDIT3 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene EWSR1 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene DDIT3 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene EWSR1--DDIT3 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene EWSR1--DDIT3 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair EWSR1--DDIT3 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene EWSR1--DDIT3 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene EWSR1--DDIT3 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair EWSR1--DDIT3 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair EWSR1--DDIT3 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair EWSR1--DDIT3 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
EWSR1--DDIT3The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7

Cortex_Dataset

Top
Fusion gene EWSR1--DDIT3 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair EWSR1--DDIT3 information is not available in ChromothripsisDB database.