EWSR1--ATF1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

EWSR1 ATF1

COSMIC

The fusion gene pair EWSR1--ATF1 information is available in COSMIC database.

Link
EWSR1--ATF1

ChimerKB

Top
The fusion gene pair EWSR1--ATF1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
EWSR1_ATF1-/1293/ -/217/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1112/ -/351/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1364/ -/351/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1293+504/ -/217-5458/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1112+689/ -/351-2234/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1112+1389/ -/351-736/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1364/ -/217/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1331+476/ -/217-5304/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1112+547/ -/313/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1293+2102/ -/217-1369/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/1293/ -/217-2075/ Exonic hg19 - - - Transcription_Factor Cosmic_recurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 11064357 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 8401579 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 16021514 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 melanoma - 15712185 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 12935923 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 10504528 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 10849331 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 9824209 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 10398127 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 16517477 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 16261586 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 11992546 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 9247632 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 9160316 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 dermatofibroma - 17188428 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 16878328 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 dermatofibroma - 18094413 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 dermatofibroma - 17724745 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 dermatofibroma - 18300800 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 18300804 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 16519562 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 18333903 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 19561568 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 18580682 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 18408594 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 dermatofibroma - 19654501 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 dermatofibroma - 20090505 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 22406360 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 20712646 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 22693489 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/-/ -/-/ - hg19 clear cell sarcoma - 22559980 Transcription_Factor Cosmic_nonrecurrent
EWSR1_ATF1-/0/ -/0/ Exonic hg18 - - - Transcription_Factor TICdb

ChimerPUB

Top
The fusion gene pair EWSR1--ATF1 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
EWSR1_ATF1t(12;16)(q13;p11) / t(12;22)(q13;q12) / t(2;22)(q33;q12) / / 19801966ewing sarcoma;histiocytoma;neuroectodermal tumor FISH - Angiomatoid fibrous histiocytoma has been found to harbor three related translocations, a t(12;16)(q13;p11) resulting in a FUS/ATF1 fusion gene, t(12;22)(q13;q12) resulting in a EWSR1/ATF1 fusion, and t(2;22)(q33;q12) resulting in a EWSR1/CREB1 fusion. /// "Angiomatoid fibrous histiocytoma has been found to harbor three related translocations, a t(12;16)(q13;p11) resulting in a FUS/ATF1 fusion gene, t(12;22)(q13;q12) resulting in a EWSR1/ATF1 fusion, and t(2;22)(q33;q12) resulting in a EWSR1/CREB1 fusion. "
EWSR1_ATF1- 25804255fibrous histiocytoma;histiocytoma FISH;PCR;RT-PCR - Angiomatoid fibrous histiocytoma is associated with recurrent chromosomal translocations, leading to characteristic EWSR1-CREB1, EWSR1-ATF1, and, rarely, FUS-ATF1 gene fusions. /// "Of 16, 14 (87.5%) had detectable EWSR1-CREB1 or EWSR1-ATF1 fusion transcripts by RT-PCR, whereas 13 (76.5%) of 17 had positive EWSR1 rearrangement with FISH." /// "fluorescence in situ hybridization (FISH), detecting EWSR1 or FUS rearrangements, and reverse transcription-polymerase chain reaction (RT-PCR) for EWSR1-CREB1 and EWSR1-ATF1 fusion transcripts have become routine ancillary tools. " /// "Of 16, 14 (87.5%) had detectable EWSR1-CREB1 or EWSR1-ATF1 fusion transcripts by RT-PCR, whereas 13 (76.5%) of 17 had positive EWSR1 rearrangement with FISH. " /// Seventeen neoplasms (from 16 patients) histologically diagnosed as AFH were assessed for EWSR1 rearrangements or EWSR1-CREB1 and EWSR1-ATF1 fusion transcripts. /// "All 13 of 13 non-AFH control neoplasms failed to show EWSR1-CREB1 or EWSR1-ATF1 fusion transcripts, whereas EWSR1 rearrangement was present in 2 of these 13 cases (which were histopathologically myoepithelial neoplasms)." /// "All 13 of 13 non-AFH control neoplasms failed to show EWSR1-CREB1 or EWSR1-ATF1 fusion transcripts, whereas EWSR1 rearrangement was present in 2 of these 13 cases (which were histopathologically myoepithelial neoplasms). " /// This study shows that EWSR1-CREB1 or EWSR1-ATF1 fusions predominate in AFH (supporting previous reports that FUS rearrangement is rare in AFH) and that RT-PCR has a comparable detection rate to FISH for AFH.
EWSR1_ATF1- 18094413clear cell sarcoma;fibrous histiocytoma;sarcoma;histiocytoma FISH;PCR - EWSR1-CREB1 and EWSR1-ATF1 fusion genes in angiomatoid fibrous histiocytoma.. /// "EWSR1-ATF1 also represents the most frequent genetic alteration in clear cell sarcoma, suggesting the existence of a molecular homology between these two histotypes. " /// "We investigated the presence of EWSR1-CREB1, recently found in gastrointestinal clear cell sarcoma, and FUS-CREB1, as well as the already reported FUS-ATF1 and EWSR1-ATF1 in a series of AFH. " /// "We identified the presence of either EWSR1-CREB1 or EWSR1-ATF1 in all the cases, strengthening the concept of chromosomal promiscuity between AFH and clear cell sarcoma. " /// "Either FUS-ATF1 or EWSR1-ATF1 have been detected in the few cases published, pointing to the interchangeable role of FUS and EWSR1 in this entity. "
EWSR1_ATF1- 25359601mucoepidermoid carcinoma FISH;PCR;RT-PCR - Recently, the EWSR1-ATF1 fusion gene was found in HCCCs. /// Hyalinizing clear cell carcinoma with EWSR1-ATF1 fusion gene: report of three cases with molecular analyses.. /// We found EWSR1-ATF1 in two of three HCCCs using reverse transcription polymerase chain reaction (RT-PCR) with our original primer sets designed to detect the fusion gene transcripts in formalin-fixed paraffin-embedded (FFPE) tissues.
EWSR1_ATF1- 25693574epithelioid sarcoma FISH - The EWSR1 gene rearrangement was detected by fluorescence in situ hybridization (FISH), but molecular biology failed to detect EWSR1/ETS, EWSR1/NR4A3, EWSR1/DDIT3, EWSR1/ATF1, EWSR1-POU5F1, EWSR1/ZNF444, EWSR1-PBX1 gene fusions.
EWSR1_ATF1- 22588066fibrous histiocytoma;histiocytoma FISH - We describe 2 cases arising endobronchially harboring EWSR1 gene rearrangements by fluorescence in situ hybridization and, respectively, EWSR1-CREB1 and EWSR1-ATF1 gene fusions by reverse transcription polymerase chain reaction. /// Endobronchial pulmonary angiomatoid fibrous histiocytoma: two cases with EWSR1-CREB1 and EWSR1-ATF1 fusions..
EWSR1_ATF1- 24378390ewing sarcoma;sarcoma FISH;PCR;RT-PCR - Furthermore, the presence of identical gene fusions in completely different sarcoma types (i.e., EWSR1-ATF1, EWSR1-CREB1) or in non-mesenchymal malignancies (epithelial or haematological) has raised skepticism as to their diagnostic utility, and their lack of specificity has been compared to the limitations of other ancillary techniques, in particular immunohistochemistry.
EWSR1_ATF1- 24043718fibrous histiocytoma;histiocytoma FISH - Besides EWSR1 gene rearrangement detected in four cases by fluorescence in situ hybridisation (FISH), EWSR1-CREB1 fusion was confirmed in nine cases, including a schwannoma-like AFH, and EWSR1-ATF1 fusion detected in a myoepithelioma-like AFH.
EWSR1_ATF1- 23715163odontogenic tumor FISH - In this study, we demonstrate for the first time the EWSR1-ATF1 translocation in a CCOC and demonstrate a concrete link between CCCs and at least a subset of CCOCs.. /// "In this study, we demonstrate for the first time the EWSR1-ATF1 translocation in a CCOC and demonstrate a concrete link between CCCs and at least a subset of CCOCs.. "
EWSR1_ATF1t(12; 22)(q13; q12) / / 19620941clear cell sarcoma;melanoma;sarcoma FISH - Although morphologically similar to malignant melanoma, CCSST can be distinguished by the presence of a t(12; 22)(q13; q12) and/or associated EWSR1-ATF1 chimeric gene. /// q12) and/or associated EWSR1-ATF1 chimeric gene.
EWSR1_ATF1- 20090505fibrous histiocytoma;osteosarcoma;sarcoma;histiocytoma FISH - fluorescence in situ hybridization for EWSR1 gene disruption, and reverse transcription-polymerase chain reaction using newly designed primers on both frozen and decalcified, paraffin-embedded tissue samples showing an EWSR1-ATF1 translocation.
EWSR1_ATF1t(12;22)(q13;q12) / / 22421295clear cell sarcoma;melanoma;sarcoma - - It harbors a unique EWSR1-ATF1 gene fusion secondary to a t(12;22)(q13;q12) translocation. /// It harbors a unique EWSR1-ATF1 gene fusion secondary to a t(12;22)(q13;q12) translocation.
EWSR1_ATF1- 26163185clear cell sarcoma - - EWSR1 gene rearrangements including EWSR1-ATF1 or EWSR1-CREB1 GENE fusions are typically assessed in these tumors.
EWSR1_ATF1- 25927151fibrous histiocytoma;histiocytoma - - Angiomatoid fibrous histiocytoma is associated with 3 characteristic gene fusions, EWSR1-CREB1 and EWSR1-ATF1, which are also described in other neoplasms, and rarely FUS-ATF1. /// "To review the current status of AFH, discussing putative etiology, histopathology with variant morphology and differential diagnosis, and current genetics, including overlap with other tumors harboring EWSR1-CREB1 and EWSR1-ATF1 fusions." /// "To review the current status of AFH, discussing putative etiology, histopathology with variant morphology and differential diagnosis, and current genetics, including overlap with other tumors harboring EWSR1-CREB1 and EWSR1-ATF1 fusions. "
EWSR1_ATF1- 26586017neuroectodermal tumor - - The presence EWSR1-ATF1 gene fusions with any melanocytic differentiation leads to the diagnosis of GNET.
EWSR1_ATF1- 22510762clear cell sarcoma;fibrous histiocytoma;sarcoma;histiocytoma - - EWSR1-CREB1 and EWSR1-ATF1 are gene fusions of which one or both have now been consistently described in 5 histopathologically and behaviorally diverse neoplasms: angiomatoid fibrous histiocytoma, conventional clear cell sarcoma (of tendons and aponeuroses), clear cell sarcoma-like tumor of the gastrointestinal tract, hyalinizing clear cell carcinoma of the salivary gland, and primary pulmonary myxoid sarcoma. /// Tumors with EWSR1-CREB1 and EWSR1-ATF1 fusions: the current status.. /// We review the clinicopathologic and molecular features of this group of neoplasms unified by the presence of EWSR1-CREB1 and EWSR1-ATF1 genetic fusions.. /// "yet, the increasing frequency with which EWSR1-CREB1 and EWSR1-ATF1 fusions are being described in separate entities is noteworthy. "
EWSR1_ATF1t(12;22)(q13;q12) / / 15884099clear cell sarcoma;fibrous histiocytoma;sarcoma;histiocytoma FISH;PCR;RT-PCR - FISH,RT-PCR, and sequence analyses revealed an EWSR1-ATF1 fusion gene that has previously been reported in clear cell sarcoma (CCS), a soft tissue sarcoma that is morphologically and clinically distinct from AFH. /// "FISH,RT-PCR, and sequence analyses revealed an EWSR1-ATF1 fusion gene that has previously been reported in clear cell sarcoma (CCS), a soft tissue sarcoma that is morphologically and clinically distinct from AFH. " /// This study thus has demonstrated that the EWSR1-ATF1 chimera represents a fusion gene that can be associated with different tumor types. /// Simultaneous expression of the EWSR1-ATF1 and MITF-M transcripts in CCS has led to the proposal that the MITF-M promoter is transactivated by EWSR1-ATF1. /// "Activation of the EWSR1-ATF1 oncogene is probably an early step in the transformation process, but the overall gene expression patterns are likely to vary considerably between AFH and CCS, in keeping with their clinicopathologic differences.. " /// "The AFH, however, did not express the MITF-M transcript, supporting the theory that MITF-M expression in CCS is a reflection of its cellular origin, rather than a consequence of the presence of an EWSR1-ATF1 fusion protein. "
EWSR1_ATF1- 17075294clear cell sarcoma;melanoma;fibrous histiocytoma;sarcoma;histiocytoma - - Ultrastructural and immunohistochemical studies have shown melanocytic differentiation, whereas molecular genetic studies have shown cytogenetic rearrangements resulting in a EWSR1-ATF1 fusion gene that is characteristic but not entirely unique for clear cell sarcoma (similar fusion genes are also seen in angiomatoid fibrous histiocytoma).
EWSR1_ATF1t(12;22) / 25671361chondrosarcoma;ewing sarcoma;clear cell sarcoma;melanoma;sarcoma - - The molecular analysis carried out in one of the cutaneous metastases revealed translocation t(12;22) (EWSR1-ATF1) and ultimately led to the correct diagnosis of unusual Ewing-like clear cell sarcoma.
EWSR1_ATF1t(12;22) / 23426715sarcoma - - Angiosarcoma of the parotid gland with a t(12;22) translocation creating a EWSR1-ATF1 fusion: a diagnostic dilemma..
EWSR1_ATF1t(12;22)(q13;q12) / t(2;22)(q34;q12) / 19561568clear cell sarcoma FISH;PCR;RT-PCR - Unlike melanoma, clear cell sarcoma harbors either a t(12;22)(q13;q12) recurrent translocation, resulting in an EWSR1/ATF1 chimeric gene, or less commonly a t(2;22)(q34;q12) translocation fusing EWSR1 and CREB1. /// Fluorescence in situ hybridization (FISH) analysis using the LSI EWSR1 break-apart probe and a reverse transcription polymerase chain reaction (RT-PCR) assay optimized for formalin-fixed paraffin-embedded tissue to detect all four reported EWSR1/ATF1 clear cell sarcoma chimeric types and the EWSR1/CREB1 variant was performed. /// Detection and characterization of EWSR1/ATF1 and EWSR1/CREB1 chimeric transcripts in clear cell sarcoma (melanoma of soft parts)..
EWSR1_ATF1- 26363999fibrous histiocytoma;histiocytoma - - A fusion gene (EWSR1-ATF1) was found in the 3 cases in which molecular investigation was performed.
EWSR1_ATF1t(2;22)(q33;q12) / 17724745clear cell sarcoma;fibrous histiocytoma;sarcoma;histiocytoma FISH;PCR;RT-PCR - The molecular hallmark of angiomatoid fibrous histiocytoma (AFH) is not well defined, with only six cases with specific gene fusions reported to date, consisting of either FUS-ATF1 or EWSR1-ATF1. /// "By RT-PCR, eight out of nine tumors showed the presence of the EWSR1-CREB1 fusion, while one had an EWSR1-ATF1 transcript. " /// "To address this, we investigated the presence of FUS-ATF1, EWSR1-ATF1, and the highly related EWSR1-CREB1 fusion in a group of nine AFHs. " /// All cases were subjected to RT-PCR for EWSR1-ATF1 and EWSR1-CREB1. /// "EWSR1-ATF1, identified in some AFH cases, is the most common genetic abnormality in soft tissue clear cell sarcoma. " /// "EWSR1-ATF1, identified in some AFH cases, is the most common genetic abnormality in soft tissue clear cell sarcoma." /// Transcriptional profiling was performed in three tumors and their gene expression was compared to five clear cell sarcomas expressing either the EWSR1-ATF1 or EWSR1-CREB1 fusion.
EWSR1_ATF1- 17188428fibrous histiocytoma;histiocytoma PCR;RT-PCR - Two of them displayed a FUS-ATF1 fusion gene and one showed an EWSR1-ATF1 chimera. /// "Using RT-PCR analysis, we have identified the EWSR1-ATF1 fusion transcript, and delineated the genomic breakpoints, in two new cases of AFH. " /// "Using RT-PCR analysis, we have identified the EWSR1-ATF1 fusion transcript, and delineated the genomic breakpoints, in two new cases of AFH." /// "Thus, of the five AFH that have been molecularly analyzed to date, two have displayed a FUS-ATF1 fusion gene and three have shown an EWSR1-ATF1 chimera. " /// "Previously, the EWSR1-ATF1 fusion protein has been suggested to activate expression of the MITF-M transcript, and therefore the expression pattern of the MITF gene was studied. "
EWSR1_ATF1t(12;22)(q13;q12) / 22559980clear cell sarcoma - - Clear cell sarcoma (CCS) of tendons and aponeuroses is an aggressive neoplasm that is characterized by a pathognomonic translocation, t(12;22)(q13;q12), resulting in an EWSR1-ATF1 chimeric gene. /// We report for the first time a female patient with CCS exhibiting both EWSR1-ATF1 fusion transcripts and hereditary homozygous point mutations in introns 11 and 16 of the KIT gene.
EWSR1_ATF1t(12;22)(q13;q12) / 17227118clear cell sarcoma;melanoma;sarcoma - - Most cases show a reciprocal cytogenetic translocation t(12;22)(q13;q12) that creates a unique chimeric fusion EWSR1/ATF1 gene transcript.
EWSR1_ATF1t(12;22)(q13;q12) / 15588860clear cell sarcoma;melanoma;sarcoma - - Malignant melanoma of soft parts (MMSP), also called clear cell sarcoma of tendons and aponeuroses, is cytogenetically characterized by the t(12;22)(q13;q12) resulting in the chimeric EWSR1/ATF1 gene. /// "Eight MMSP with an EWSR1/ATF1 chimeric transcript, one soft tissue metastasis of a malignant melanoma of the skin, and one malignant melanoma cell line were examined. "
EWSR1_ATF1- 25724038clear cell sarcoma;sarcoma - - The etiology of CCSLGT is unknown, but many studies have shown associations with EWSR1-CREB1 gene fusions and, less frequently, with EWSR1-ATF1 fusions. /// "The etiology of CCSLGT is unknown, but many studies have shown associations with EWSR1-CREB1 gene fusions and, less frequently, with EWSR1-ATF1 fusions. "
EWSR1_ATF1- 24702653fibrous histiocytoma;sarcoma;histiocytoma FISH;PCR;RT-PCR - RT-PCR confirmed EWSR rearrangement, and detected an EWSR1-ATF1 fusion transcript. /// "RT-PCR confirmed EWSR rearrangement, and detected an EWSR1-ATF1 fusion transcript. "
EWSR1_ATF1- 21484932mucoepidermoid carcinoma;myoepithelial tumor FISH;PCR;RT-PCR - 3'RACE on an EWSR1 rearranged HCCC identified an EWSR1-ATF1 fusion, which was confirmed by RT-PCR. /// The presence of EWSR1-ATF1 fusion in most HCCCs reliably separates these tumors from its histological mimics. /// EWSR1-ATF1 fusion is a novel and consistent finding in hyalinizing clear-cell carcinoma of salivary gland..
EWSR1_ATF1- 23821218clear cell adenocarcinoma - - recently identified a consistent EWSR1-ATF1 fusion in HCCC.
EWSR1_ATF1- 23320232melanoma;fibrous histiocytoma;histiocytoma - - So far three translocations have been reported to arise in angiomatoid fibrous histiocytoma: FUS-ATF1, EWSR1-CREB1, or EWSR1-ATF1.
EWSR1_ATF1- 23953591clear cell sarcoma;sarcoma - - Clear cell sarcoma is a unique tumor which has EWSR1-ATF1 or EWSR1-CREB1 fusion. /// Clear cell sarcoma is a unique tumor which has EWSR1-ATF1 or EWSR1-CREB1 fusion. /// "In our case, increased splicing activity in the EWSR1-ATF1 fusion might be acquired at the metastatic site. " /// We examined EWSR1-ATF1 and EWSR1-CREB1 fusions in a single case of clear cell sarcoma with lung metastasis in a 36-year-old Japanese man. /// "As a result, we found only type 1 EWSR1-ATF1 fusion in the primary site, but 4 types of EWS-ATF1 fusion (type 1, 2, 5, 6) were detected in the metastatic site. " /// Several patterns of EWSR1-ATF1 fusion are observed in clear cell sarcoma. /// A rare case of clear cell sarcoma with 4 types of EWSR1-ATF1 fusions detected not in primary site but in metastatic site..
EWSR1_ATF1- 24595418cystadenocarcinoma - - The EWSR1-ATF1 fusion is specific for HCCC within the context of salivary neoplasia. /// The EWSR1-ATF1 fusion is specific for HCCC within the context of salivary neoplasia.
EWSR1_ATF1t(14;22)(q32;q12) / 23630070mesothelioma - - The EWSR1 breakpoint in exon 8 in the EWSR1-YY1 chimeric transcript is similar to what is found in other fusions involving EWSR1 such as EWSR1-FLI1, EWSR1-DDIT3, and EWSR1-ATF1.
EWSR1_ATF1t(12;22)(q13;q12) / 18300804clear cell sarcoma;malignant meningioma;microphthalmia - - Clear cell sarcoma (CCS) of soft tissue is a rare sarcoma with morphologic similarities to malignant melanoma but a distinct genetic background including a chromosomal translocation, t(12;22)(q13;q12), or a resultant EWSR1-ATF1 fusion gene. /// "Reverse transcription-polymerase chain reaction using RNA extracted from formalin-fixed, paraffin-embedded tissues demonstrated transcripts of the EWSR1-ATF1 (31/33) or EWSR1-CREB1 fusion gene (2/33). " /// "Reverse transcription-polymerase chain reaction using RNA extracted from formalin-fixed, paraffin-embedded tissues demonstrated transcripts of the EWSR1-ATF1 (31/33) or EWSR1-CREB1 fusion gene (2/33)." /// "In cases with unusual histologic findings, molecular detection of the EWSR1-ATF1/CREB1 fusion genes provides critical information regarding the diagnosis of the tumor.. "
EWSR1_ATF1t(12;22)(q13;q12) / 22406360clear cell sarcoma;melanoma;sarcoma ISH - The presence of type 1, 2, and 3 EWSR1/ATF1 fusion gene transcripts was confirmed by reverse transcriptase polymerase chain reaction analysis, but type 4 and EWSR1/CREB1 fusion gene transcripts were not found.
EWSR1_ATF1t(12;22)(q13;q12) / 21185830clear cell sarcoma;sarcoma ISH - The most common recurrent translocation in clear cell sarcoma t(12;22)(q13;q12) results in an EWSR1/ATF1 chimeric gene. /// Discovery of two novel EWSR1/ATF1 transcripts in four chimerical transcripts-expressing clear cell sarcoma and their quantitative evaluation. /// Reverse transcription-polymerase chain reaction analysis revealed the presence of four different EWSR1/ATF1 chimerical transcripts in the tumor sample as well as in both metastatic lymph nodes. /// Discovery of two novel EWSR1/ATF1 transcripts in four chimerical transcripts-expressing clear cell sarcoma and their quantitative evaluation..
EWSR1_ATF1- 25543160- ISH - Fluorescence in situ hybridization revealed Ewing Sarcoma Breakpoint Region 1 (EWSR1) rearrangement, and reverse-transcription polymerase chain reaction confirmed the presence of the EWSR1-Activating Transcription Factor 1 (ATF1) fusion transcript, which was subsequently sequenced. /// "Fluorescence in situ hybridization revealed Ewing Sarcoma Breakpoint Region 1 (EWSR1) rearrangement, and reverse-transcription polymerase chain reaction confirmed the presence of the EWSR1-Activating Transcription Factor 1 (ATF1) fusion transcript, which was subsequently sequenced. "

ChimerSEQ

Top
The fusion gene pair EWSR1--ATF1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
EWSR1_ATF1chr22/29687856/ chr12/51203238/ 22q12.2 12q13.12 Exonic hg19 - Inter-chr NA JN202449 Transcription_Factor ChiTaRs
EWSR1_ATF1chr22/29683123/ chr12/51208063/ 22q12.2 12q13.12 Exonic hg19 - Inter-chr NA JN624779 Transcription_Factor ChiTaRs
EWSR1_ATF1chr22/29684775/ chr12/51203238/ 22q12.2 12q13.12 Exonic hg19 - Inter-chr NA JF290487 Transcription_Factor ChiTaRs
EWSR1_ATF1chr22/29683123/ chr12/51203239/ 22q12.2 12q13.12 Exonic hg19 - Inter-chr NA JN202448 Transcription_Factor ChiTaRs
EWSR1_ATF1chr22/29683123/ chr12/51207793/ 22q12.2 12q13.12 Exonic hg19 - Inter-chr refractory anemia;malignant epithelial tumor;angiomatoid malignant fibrous histiocytoma;clear cell sarcoma;soft tissue tumor;miscellaneous soft tissue tumors;osteogenic/bone tumor;ewing tumor AF047022 Transcription_Factor ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair EWSR1--ATF1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF047022EWSR1--ATF1 EWSR122 29683059 29683123 + 1 65 100 ATF112 51207793 51208167 + 66 353 99.7
Human JF290488EWSR1--ATF1 EWSR122 29663998 29683123 + 1 1139 100 ATF112 51207793 51214943 + 1140 3008 100
Human JN202449EWSR1--ATF1 EWSR122 29687554 29687856 + 1 46 100 ATF112 51203238 51203372 + 35 169 100
Human JN624779EWSR1--ATF1 EWSR122 29682912 29683123 + 1 212 100 ATF112 51208063 51208222 + 213 372 100
Human JF290487EWSR1--ATF1 EWSR122 29663998 29684775 + 1 1320 100 ATF112 51203238 51214943 + 1320 3323 100
Human JN202448EWSR1--ATF1 EWSR122 29682912 29683123 + 1 212 100 ATF112 51203239 51203372 + 213 346 100

FARE-CAFE

Top
The fusion gene pair EWSR1--ATF1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
EWSR1-ATF1 Ewing sarcoma RT-PCR t(12;22)(q13;q12) PubMed: 17724745,15884099

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
EWSR1-ATF1 EWSR1-ATF1-Isoform1 EWSR1 _ _ 1 ATF1 _ 1 _ gcatttacaccactCtattcatttact 17188428 _
EWSR1-ATF1 EWSR1-ATF1-Isoform2 EWSR1 29684775 0 1 ATF1 51203238 1 0 ATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGgAAAAATTTTGAAAGACTTATCTTCTGAAGATACACGGGGCAGAAAAGGAGA 8401579 _
EWSR1-ATF1 EWSR1-ATF1-Isoform3 EWSR1 29683123 0 1 ATF1 51207793 1 0 AACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGATTGCCATTGCCCCAAATGGAGCCTTACAGTTGGCAAGTCCAGGCACAGATGGAGTACAGGGACTTCAGACATTAACCATGACAAATTCAGGCAGTACTCAGCAAGGTACAACTATTCTTCAGTATGCACAGACCTCTGATGGACAGCAGATACTTGTGCCCAGCAATCAGGTGGTCGTACAAACTGCATCAGGAGATATGCCAACATATCAGATCCGAACTACACCTTCAGCTACTTCTCTGCCACAAACTGTGGTGATGACATCTCCTGTGACTCTCACCTCTCAGA _ AF047022
EWSR1-ATF1 EWSR1-ATF1-Isoform4 EWSR1 _ _ 1 ATF1 _ 1 _ ggctaacatatagtAgatgggacatat 17188428 _
EWSR1-ATF1 EWSR1-ATF1-Isoform5 EWSR1 _ _ 1 ATF1 _ 1 _ tagtgccttggaattgagAactatcacttaagtaa 17188428 _
EWSR1-ATF1 EWSR1-ATF1-Isoform6 EWSR1 _ _ 1 ATF1 51205560 1 0 tattgcaggccactatCaagaccagtctcagaaaaag 17188428 _
EWSR1-ATF1 EWSR1-ATF1-Isoform7 EWSR1 _ _ 1 ATF1 _ 1 _ tgcttttggagacatcttaTctgaccacctgttgccgt 17188428 _
EWSR1-ATF1 EWSR1-ATF1-Isoform8 EWSR1 _ _ 1 ATF1 _ 1 _ ggtggaatgggAaaaattttg 18300800 _
EWSR1-ATF1 EWSR1-ATF1-Isoform9 EWSR1 _ _ 1 ATF1 _ 1 _ cggtggaatgggAaaaattttga 19561568 _
EWSR1-ATF1 EWSR1-ATF1-Isoform10 EWSR1 _ _ 1 ATF1 _ 1 _ cttgatctagTtgccattgc 19561568 _
EWSR1-ATF1 EWSR1-ATF1-Isoform11 EWSR1 _ _ 1 ATF1 _ 1 _ gggcagcagaTtgccattgc 19561568 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
EWSR1-ATF1 EWSR1-ATF1-Isoform1 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
4) bZIP_1
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
4) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1-ATF1 EWSR1-ATF1-Isoform2 - - 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
EWSR1-ATF1 EWSR1-ATF1-Isoform3 - - 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
EWSR1-ATF1 EWSR1-ATF1-Isoform4 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
4) bZIP_1
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
4) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1-ATF1 EWSR1-ATF1-Isoform5 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
4) bZIP_1
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
4) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1-ATF1 EWSR1-ATF1-Isoform6 - - 1) bZIP_1
1) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
EWSR1-ATF1 EWSR1-ATF1-Isoform7 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
4) bZIP_1
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
4) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1-ATF1 EWSR1-ATF1-Isoform8 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
4) bZIP_1
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
4) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1-ATF1 EWSR1-ATF1-Isoform9 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
4) bZIP_1
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
4) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1-ATF1 EWSR1-ATF1-Isoform10 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
4) bZIP_1
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
4) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
EWSR1-ATF1 EWSR1-ATF1-Isoform11 - - - -EWSR1 1) RRM_6
2) zf-RanBP
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
ATF1 1) pKID
2) bZIP_1
1) KIX
2) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF
1) RRM_6
2) zf-RanBP
3) pKID
4) bZIP_1
1) RRM_6 , RRM_5 , RRM_1 , NUDIX_2 , Vinculin , zf-RNPHF
2) ubiquitin , Ras
3) KIX
4) bZIP_Maf , bZIP_2 , bZIP_1 , RHD , IRF

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
EWSR1-ATF1 hsa-miR-215-5phsa-miR-192-5phsa-miR-23a-5p hsa-let-7a-5phsa-miR-877-3phsa-miR-615-3phsa-miR-423-3phsa-miR-328-3phsa-miR-362-5phsa-miR-320ahsa-miR-149-5phsa-miR-23b-3phsa-miR-196a-5phsa-miR-100-5phsa-let-7c-5p Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
EWSR1-ATF1 NM_001163285.1 - 1) STAT1_HUMAN
2) RBL2_HUMAN
3) E2F4_HUMAN
4) ETS1_HUMAN
5) EGR1_HUMAN
6) FOS_HUMAN
7) GATA3_HUMAN
8) CTCF_HUMAN
9) BRG1_HUMAN
10) TFAP2C_HUMAN
11) FOXA1_HUMAN
12) CEBPA_HUMAN
13) STAT6_HUMAN
14) ESR1_HUMAN
-

TicDB

Top
The fusion gene pair EWSR1--ATF1 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
EWSR1 ATF1 17188428 gcatttacaccactCtattcatttact
EWSR1 ATF1 17188428 ggctaacatatagtAgatgggacatat
EWSR1 ATF1 17188428 tagtgccttggaattgagAactatcacttaagtaa
EWSR1 ATF1 17188428 tattgcaggccactatCaagaccagtctcagaaaaag
EWSR1 ATF1 17188428 tgcttttggagacatcttaTctgaccacctgttgccgt
EWSR1 ATF1 18300800 ggtggaatgggAaaaattttg
EWSR1 ATF1 19561568 cggtggaatgggAaaaattttga
EWSR1 ATF1 19561568 cttgatctagTtgccattgc
EWSR1 ATF1 19561568 gggcagcagaTtgccattgc
EWSR1 ATF1 8401579 ATGAGCAGAGGTGGGCGGGGAGGAGGACGCGGTGGAATGGgAAAAATTTTGAAAGACTTATCTTCTGAAGATACACGGGGCAGAAAAGGAGA
EWSR1 ATF1 AF047022 AACTGGATCCTACAGCCAAGCTCCAAGTCAATATAGCCAACAGAGCAGCAGCTACGGGCAGCAGATTGCCATTGCCCCAAATGGAGCCTTACAGTTGGCAAGTCCAGGCACAGATGGAGTACAGGGACTTCAGACATTAACCATGACAAATTCAGGCAGTACTCAGCAAGGTACAACTATTCTTCAGTATGCACAGACCTCTGATGGACAGCAGATACTTGTGCCCAGCAATCAGGTGGTCGTACAAACTGCATCAGGAGATATGCCAACATATCAGATCCGAACTACACCTTCAGCTACTTCTCTGCCACAAACTGTGGTGATGACATCTCCTGTGACTCTCACCTCTCAGA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair EWSR1--ATF1 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair EWSR1--ATF1 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair EWSR1--ATF1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene EWSR1--ATF1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene EWSR1--ATF1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene EWSR1--ATF1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene EWSR1--ATF1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene EWSR1--ATF1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair EWSR1--ATF1 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene EWSR1--ATF1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene EWSR1--ATF1 has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene EWSR1 is a known oncogene according to ONGENE database.


The tail gene ATF1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene EWSR1 is cancer associated according to Bushman Cancer Gene database.


The tail gene ATF1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene EWSR1 is proto-oncogene or tumor suppresor gene according to Uniprot database.
The tail gene ATF1 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene EWSR1--ATF1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene EWSR1--ATF1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair EWSR1--ATF1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene EWSR1--ATF1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene EWSR1--ATF1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair EWSR1--ATF1 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair EWSR1--ATF1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair EWSR1--ATF1 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
EWSR1--ATF1The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7
EWSR1--ATF1The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7
EWSR1--ATF1The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7

Cortex_Dataset

Top
Fusion gene EWSR1--ATF1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair EWSR1--ATF1 information is not available in ChromothripsisDB database.