ETV6--RUNX1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

ETV6 RUNX1

COSMIC

The fusion gene pair ETV6--RUNX1 information is available in COSMIC database.

Link
ETV6--RUNX1

ChimerKB

Top
The fusion gene pair ETV6--RUNX1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
ETV6_RUNX1-/-/ -/-/ - hg18 lymphoblastic leukemia - - Oncogene; Transcription_Factor Mitelman
ETV6_RUNX1-/333/ -/109535/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/2492/ -/752/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/3266/ -/5491/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/4145/ -/135887/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/4356/ -/155638/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/4402/ -/100745/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/4446/ -/155509/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/4758/ -/86324/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/6171/ -/110261/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/6462/ -/72877/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/6526/ -/100725/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/6775/ -/103732/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/6938/ -/138098/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/7005/ -/104124/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/7285/ -/394/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/10256/ -/9003/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/10510/ -/111015/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/10735/ -/2465/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/12643/ -/359/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/13945/ -/139960/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/14001/ -/626/ Exonic hg18 - - - Oncogene; Transcription_Factor TICdb
ETV6_RUNX1-/-/ -/-/ - hg18 acute lymphoblastic leukemia - 7761424 Oncogene; Transcription_Factor OMIM
ETV6_RUNX1-/-/ -/-/ - hg18 acute lymphocytic leukemia - 12124316 Oncogene; Transcription_Factor OMIM

ChimerPUB

Top
The fusion gene pair ETV6--RUNX1 information is not available in CHIMERPUB (CHIMERDB 3.0) database.

ChimerSEQ

Top
The fusion gene pair ETV6--RUNX1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
ETV6_RUNX1chr12/12022903/ chr21/36259227/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA EU364772 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12268261/ chr21/36259324/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ451147 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12030685/ chr21/36343188/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ100458 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12028545/ chr21/36420636/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ207765 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12032960/ chr21/36308367/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ100456 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12031402/ chr21/36276078/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ207767 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12033885/ chr21/36408059/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ207762 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12032695/ chr21/36282745/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ207769 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12023073/ chr21/36376457/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ224378 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12024122/ chr21/36306734/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ207764 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12036826/ chr21/36407309/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ224380 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12026182/ chr21/36271404/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA DQ100455 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12036849/ chr21/36280991/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr NA AJ494736 Oncogene; Transcription_Factor ChiTaRs
ETV6_RUNX1chr12/12035545/ chr21/36264754/ 12p13.2 21q22.12 Exonic hg19 - Inter-chr biphenotypic leukemia;acute lymphoblastic leukemia;lymphoblastic lymphoma AJ494735 Oncogene; Transcription_Factor ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair ETV6--RUNX1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human EU364772ETV6--RUNX1 ETV612 12022813 12022903 + 1 91 99 RUNX121 36259227 36265263 - 89 164 100
Human DQ451147ETV6--RUNX1 ETV612 12022783 12268261 + 1 154 100 RUNX121 36259324 36265262 - 153 263 100
Human DQ100458ETV6--RUNX1 ETV612 12030620 12030685 + 1 66 100 RUNX121 36343188 36343241 - 66 119 100
Human DQ207765ETV6--RUNX1 ETV612 12028460 12028545 + 1 82 98.8 RUNX121 36420636 36421029 - 82 465 99.5
Human DQ100456ETV6--RUNX1 ETV612 12032913 12032960 + 1 48 100 RUNX121 36308367 36308426 - 48 107 100
Human DQ207767ETV6--RUNX1 ETV612 12031210 12031402 + 7 200 97.4 RUNX121 36276078 36276309 - 200 431 98.3
Human DQ207762ETV6--RUNX1 ETV612 12033783 12033885 + 12 113 99.1 RUNX121 36408059 36408483 - 114 527 99.1
Human DQ207769ETV6--RUNX1 ETV612 12032519 12032695 + 9 183 98.9 RUNX121 36282745 36283062 - 180 492 99.1
Human DQ224378ETV6--RUNX1 ETV612 12022897 12023073 + 1 178 97.2 RUNX121 36376457 36376489 - 171 203 100
Human DQ207764ETV6--RUNX1 ETV612 12023975 12024122 + 2 148 98.7 RUNX121 36306734 36306767 - 138 171 97.1
Human DQ224380ETV6--RUNX1 ETV612 12036578 12036826 + 2 249 99.2 RUNX121 36407309 36407500 - 249 438 100
Human DQ100455ETV6--RUNX1 ETV612 12026134 12026182 + 1 49 100 RUNX121 36271404 36271445 - 47 88 100
Human AJ494735ETV6--RUNX1 ETV612 12035224 12035545 + 1 322 100 RUNX121 36264754 36264863 - 322 429 100
Human AJ494736ETV6--RUNX1 ETV612 12036574 12036849 + 1 275 99.7 RUNX121 36280991 36281179 - 275 463 100

FARE-CAFE

Top
The fusion gene pair ETV6--RUNX1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
ETV6-RUNX1/AML1 B-Cell Acute Lymphoblastic Leukemia FISH,Southern blot,SSCP,PCR,DNA sequencing,LDI-PCR,Western blot,RT-PCR,Exontrapping,RACE,G-Banding t(12;21)(p12;q22) PubMed: 7492786

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform1 ETV6 _ _ 1 RUNX1/AML1 36334741 0 0 GTGTATATATGTATATATGTGTGTATATATGTATATATGTATATGTGTATATATATAATCTTGCCAAATACTACAAATTTTATAAATCGTTCCTTTACTGGCTGTTTGGTGATATATCTTTTATATGC _ AF044317
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform2 ETV6 12035545 0 1 RUNX1/AML1 36264763 0 0 CTTGTCGAAGCCACAGCACAGTACCTACAAATAGCACCCACTGAGAGTAAAATGTTTACTAAGCATTCCTAAATTTTAAAAAGATTAATTTTAAAATGTCCTCAGCTTGCTACTTGTGAGGACACAATGGGTTATGAAGT _ AJ494735
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform3 ETV6 12036849 0 1 RUNX1/AML1 36281104 0 0 AGCCACAGTTCCCACAGTCAGAGTCACCAAGCCACATAGTTTTTCTTTTCCCACCATTTTTCACTTCTTTAGAATTATAAGATAAGCCTGTTACATATCCTGAATCATTGGTCCCATTCTATGTATATGCAAAAGAAGTT _ AJ494736
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform4 ETV6 12036904 0 1 RUNX1/AML1 36264596 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform5 ETV6 12029841 0 1 RUNX1/AML1 36283041 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform6 ETV6 12029678 0 1 RUNX1/AML1 36283041 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform7 ETV6 12029429 0 1 RUNX1/AML1 36320414 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform8 ETV6 12026170 0 1 RUNX1/AML1 36259729 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform9 ETV6 12033160 0 1 RUNX1/AML1 36412135 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform10 ETV6 12030188 0 1 RUNX1/AML1 36420745 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform11 ETV6 12029909 0 1 RUNX1/AML1 36317014 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform12 ETV6 12034030 0 1 RUNX1/AML1 36402705 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform13 ETV6 12023975 0 1 RUNX1/AML1 36297611 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform14 ETV6 12028217 0 1 RUNX1/AML1 36305041 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform15 ETV6 12028670 0 1 RUNX1/AML1 36410686 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform16 ETV6 12029968 0 1 RUNX1/AML1 36384967 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform17 ETV6 12030770 0 1 RUNX1/AML1 36260465 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform18 ETV6 12031617 0 1 RUNX1/AML1 36328707 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform19 ETV6 12032904 0 1 RUNX1/AML1 36287919 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform20 ETV6 12033802 0 1 RUNX1/AML1 36355598 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform21 ETV6 12029367 0 1 RUNX1/AML1 36348261 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform22 ETV6 12026252 0 1 RUNX1/AML1 36405363 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform23 ETV6 12027267 0 1 RUNX1/AML1 36265301 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform24 ETV6 12033393 0 1 RUNX1/AML1 36310131 0 0 _ _ _
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform25 ETV6 12023217 0 1 RUNX1/AML1 36311604 0 0 _ _ _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform1 - - - -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) SAM_PNT
2) Ets
3) Runt
4) RunxI
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
3) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform2 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform3 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform4 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform5 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform6 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform7 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform8 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform9 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform10 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform11 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform12 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
3) No
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform13 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform14 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform15 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform16 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform17 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform18 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform19 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform20 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform21 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform22 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform23 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform24 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta
ETV6-RUNX1/AML1 ETV6-RUNX1/AML1-Isoform25 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
- -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
RUNX1/AML1 1) Runt
2) RunxI
1) Runt , CBF_beta
1) Ets
2) Runt
3) RunxI
1) SRF-TF , Ank_2 , PAX , Ets
2) Runt , CBF_beta

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
ETV6-RUNX1/AML1 hsa-miR-27a-3phsa-miR-17-5phsa-miR-20a-5phsa-miR-106a-5phsa-miR-423-5p hsa-miR-129-5phsa-miR-296-3phsa-miR-99b-5phsa-miR-92a-3p Report assay,Western Blot,qPCR,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
ETV6-RUNX1/AML1 NM_001987.4 1) TRIM28_HUMAN
2) MITF_HUMAN
3) STAT1_HUMAN
4) RBL2_HUMAN
5) P53_HUMAN
6) RUNX1_HUMAN
7) PRDM14_HUMAN
8) ETS1_HUMAN
9) EGR1_HUMAN
10) GATA2_HUMAN
11) GATA3_HUMAN
12) SOX2_HUMAN
13) TAL1_HUMAN
14) CTCF_HUMAN
15) BRG1_HUMAN
16) HNF4A_HUMAN
17) FOXA1_HUMAN
18) CEBPA_HUMAN
19) CTCF_HUMAN
20) ESR1_HUMAN
21) SETDB1_HUMAN
22) SPI1_HUMAN
23) TRIM24_HUMAN
1) HIF1A_HUMAN
2) RB1_HUMAN
3) ZNF263_HUMAN
4) E2F4_HUMAN
5) ESTROGEN RECEPTOR ALPHA_HUMAN
6) FOS_HUMAN
7) E2F1_HUMAN
8) TFAP2C_HUMAN
9) STAT6_HUMAN
10) ESR2_HUMAN
11) AR_HUMAN
12) MEIS1_HUMAN
13) FOXP1_HUMAN
14) NR1H3_HUMAN
15) VDR_HUMAN
1) 17542650
2) 21258399
3) 19122651
4) 20385362
5) 21394211
6) 20019798
7) 20953172
8) 20019798
9) 20690147
10) 21808000
11) 21878914
12) 21211035
13) 21795385
14) 21795385
15) 19505939
16) 21646355
17) 21572391
18) 20219941
19) 20219941
20) 21235772
21) 21430779
22) 21241896
23) 21164480

TicDB

Top
The fusion gene pair ETV6--RUNX1 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
ETV6 RUNX1 AF044317 GTGTATATATGTATATATGTGTGTATATATGTATATATGTATATGTGTATATATATAATCTTGCCAAATACTACAAATTTTATAAATCGTTCCTTTACTGGCTGTTTGGTGATATATCTTTTATATGC
ETV6 RUNX1 AJ494735 CTTGTCGAAGCCACAGCACAGTACCTACAAATAGCACCCACTGAGAGTAAAATGTTTACTAAGCATTCCTAAATTTTAAAAAGATTAATTTTAAAATGTCCTCAGCTTGCTACTTGTGAGGACACAATGGGTTATGAAGT
ETV6 RUNX1 AJ494736 AGCCACAGTTCCCACAGTCAGAGTCACCAAGCCACATAGTTTTTCTTTTCCCACCATTTTTCACTTCTTTAGAATTATAAGATAAGCCTGTTACATATCCTGAATCATTGGTCCCATTCTATGTATATGCAAAAGAAGTT

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair ETV6--RUNX1 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair ETV6--RUNX1 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair ETV6--RUNX1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene ETV6--RUNX1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene ETV6--RUNX1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene ETV6--RUNX1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene ETV6--RUNX1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene ETV6--RUNX1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair ETV6--RUNX1 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene ETV6--RUNX1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene ETV6--RUNX1 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene ETV6 is a known oncogene according to ONGENE database.


The tail gene RUNX1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene ETV6 is cancer associated according to Bushman Cancer Gene database.


The tail gene RUNX1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene ETV6 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene RUNX1 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene ETV6--RUNX1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene ETV6--RUNX1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair ETV6--RUNX1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene ETV6--RUNX1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene ETV6--RUNX1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair ETV6--RUNX1 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair ETV6--RUNX1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair ETV6--RUNX1 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene ETV6--RUNX1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair ETV6--RUNX1 information is not available in ChromothripsisDB database.