ETV6--NTRK3

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

ETV6 NTRK3

COSMIC

The fusion gene pair ETV6--NTRK3 information is available in COSMIC database.

Link
ETV6--NTRK3

ChimerKB

Top
The fusion gene pair ETV6--NTRK3 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
ETV6_NTRK3-/1283/ -/1908/ Exonic hg19 - - - Kinase; Cosmic_recurrent
ETV6_NTRK3-/737/ -/1719/ Exonic hg19 - - - Kinase; Cosmic_recurrent
ETV6_NTRK3-/1283/ -/1719/ Exonic hg19 - - - Kinase; Cosmic_recurrent
ETV6_NTRK3-/737/ -/1908/ Exonic hg19 - - - Kinase; Cosmic_recurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 10895816 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 11242790 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 - - 11441343 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 secretory breast carcinoma - 12450792 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 secretory breast carcinoma - 16888913 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 12652616 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 - - 12652616 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 secretory breast carcinoma - 15101049 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 15801689 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 - - 16681692 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 secretory breast carcinoma - 15963235 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 9462753 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 14578034 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 15022058 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 - - 12650516 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 12406191 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 - - 12165445 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 9811336 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 - - 10658907 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 10918240 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 11684968 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 mesoblastic nephroma, congenital fibrosarcoma - 9823307 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 - - 19629465 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 salivary gland cancer - 20410810 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 haematopoietic neoplasm - 9949179 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 11169520 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 congenital fibrosarcoma - 21084177 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 haematopoietic neoplasm - 21226763 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 colon cancer - 22895193 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 mammary analogue secretory carcinoma of salivary gland origin - 23807775 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 mammary analogue secretory carcinoma of salivary gland origin - 24145651 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/-/ -/-/ - hg19 thyroid cancer - 24327398 Kinase; Cosmic_nonrecurrent
ETV6_NTRK3-/0/ -/0/ Exonic hg18 - - - Kinase; TICdb
ETV6_NTRK3-/-/ -/-/ - hg18 fibrosarcoma - 9462753 Kinase; OMIM

ChimerPUB

Top
The fusion gene pair ETV6--NTRK3 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
ETV6_NTRK3- 21401966acute myeloid leukemia;myeloid leukemia;leukemia;breast carcinoma;sarcoma FISH;PCR - The NTRK3 gene on chromosome 15 was found to constitute the 3' end of the fusion gene and the underlying ETV6-NTRK3 rearrangement was verified by reverse transcriptase PCR. /// The NTRK3 gene on chromosome 15 was found to constitute the 3' end of the fusion gene and the underlying ETV6-NTRK3 rearrangement was verified by reverse transcriptase PCR. /// No RNA of the reciprocal NTRK3-ETV6 fusion gene could be detected. /// No RNA of the reciprocal NTRK3-ETV6 fusion gene could be detected. /// ETV6-NTRK3 rearrangements have been described in secretory breast carcinoma and congenital fibrosarcoma.. /// ETV6-NTRK3 rearrangements have been described in secretory breast carcinoma and congenital fibrosarcoma..
ETV6_NTRK3t(12;15)(p13;q25) / / 19561229breast cancer FISH - Tiling path array comparative genomic hybridisation (aCGH) analysis and fluorescence in situ hybridisation (FISH) using in-house-generated probes for ETV6, NTRK3 and the fusion genes, centromeric probes for chromosomes 12 and 15, and a commercially available split-apart ETV6/NTRK3 probe. /// "Tiling path array comparative genomic hybridisation (aCGH) analysis and fluorescence in situ hybridisation (FISH) using in-house-generated probes for ETV6, NTRK3 and the fusion genes, centromeric probes for chromosomes 12 and 15, and a commercially available split-apart ETV6/NTRK3 probe. " /// "To the best of our knowledge, this is the first time a carcinoma has been shown to harbour a duplication of the ETV6-NTRK3 translocation." /// "To the best of our knowledge, this is the first time a carcinoma has been shown to harbour a duplication of the ETV6-NTRK3 translocation. " /// Genomic profile of a secretory breast cancer with an ETV6-NTRK3 duplication..
ETV6_NTRK3t(12;15) (p13;q25) / / 26496413salivary gland cancer - - The presence of t(12;15) (p13;q25) translocation which results in the ETV6-NTRK3 gene fusion or positive immunochemical studies for STAT5, mammoglobin and S100 protein, are necessary to confirm the diagnosis of MASC. /// "The presence of t(12;15) (p13;q25) translocation which results in the ETV6-NTRK3 gene fusion or positive immunochemical studies for STAT5, mammoglobin and S100 protein, are necessary to confirm the diagnosis of MASC. " /// The inhibition of ETV6-NTRK3 gene fusion could be used as treatment in the future..
ETV6_NTRK3- 14668342breast carcinoma;sarcoma - - The ETV6-NTRK3 (EN) gene fusion occurs in human pediatric spindle cell sarcomas and secretory breast carcinoma, and encodes the oligomerization domain of the ETV6 transcription factor fused to the protein-tyrosine kinase domain of NTRK3. /// "The ETV6-NTRK3 (EN) gene fusion occurs in human pediatric spindle cell sarcomas and secretory breast carcinoma, and encodes the oligomerization domain of the ETV6 transcription factor fused to the protein-tyrosine kinase domain of NTRK3. " /// A highly conserved NTRK3 C-terminal sequence in the ETV6-NTRK3 oncoprotein binds the phosphotyrosine binding domain of insulin receptor substrate-1: an essential interaction for transformation..
ETV6_NTRK3t(12;15)(p13;q25) / / 18068631breast cancer;breast carcinoma - - To better understand the cellular origin of breast cancer, we developed a mouse model that recapitulates expression of the ETV6-NTRK3 (EN) fusion oncoprotein, the product of the t(12;15)(p13;q25) translocation characteristic of human secretory breast carcinoma. /// " To better understand the cellular origin of breast cancer, we developed a mouse model that recapitulates expression of the ETV6-NTRK3 (EN) fusion oncoprotein, the product of the t(12;15)(p13;q25) translocation characteristic of human secretory breast carcinoma. "
ETV6_NTRK3- 25456394acinic cell carcinoma;cystadenocarcinoma - - Mammary analogue secretory carcinoma (MASC) is a recently recognized salivary gland tumor harboring an ETV6-NTRK3 translocation similar to secretory carcinoma of the breast. /// The last of these methods was used to detect the ETV6-NTRK3 translocation. /// Characterization of mammary analogue secretory carcinoma of the salivary gland: discrimination from its mimics by the presence of the ETV6-NTRK3 translocation and novel surrogate markers.. /// Mammary analogue secretory carcinoma (MASC) is a recently recognized salivary gland tumor harboring an ETV6-NTRK3 translocation similar to secretory carcinoma of the breast. /// "Because differential diagnosis among zymogen granule-poor AciCC, MASC, and LGCCC tumors is challenging, we recommend using molecular genetic tests for ETV6-NTRK3 for accurate diagnosis. "
ETV6_NTRK3t(12;15)(p13;q25) / / 10702799fibrosarcoma - - Moreover, ETV6-NTRK3 has PTK activity and is autophosphorylated on tyrosine residues.
ETV6_NTRK3- 15659957synovial sarcoma;ewing sarcoma;chronic myeloid leukemia;myeloid leukemia;leukemia;sarcoma - - Functional knowledge of ETV6-NTRK3 has advanced so that strategies for screening small molecule inhibitors can proceed. /// Functional knowledge of ETV6-NTRK3 has advanced so that strategies for screening small molecule inhibitors can proceed.
ETV6_NTRK3- 17409427- - - However, in Src-deficient cells, the ETV6-NTRK3 failed to activate the PI3K-Atk pathway, but not the Ras-Erk1/2 pathway. /// "The ETV6-NTRK3 (EN) chimeric tyrosine kinase, a potent oncoprotein expressed in tumors derived from multiple cell lineages, functions as a constitutively active protein-tyrosine kinase."
ETV6_NTRK3- 15143160- - - ETV6-NTRK3 (EN), comprised of the ETV6 SAM domain fused to the NTRK3 PTK, is unique among ETV6 chimeric oncoproteins, as it is expressed in cancers of multiple lineages. /// "ETV6-NTRK3 (EN), comprised of the ETV6 SAM domain fused to the NTRK3 PTK, is unique among ETV6 chimeric oncoproteins, as it is expressed in cancers of multiple lineages. " /// Mutations in the SAM domain of the ETV6-NTRK3 chimeric tyrosine kinase block polymerization and transformation activity..
ETV6_NTRK3- 16258068- - - The ETV6-NTRK3 (EN) chimeric tyrosine kinase, a potent oncoprotein expressed in tumors derived from multiple cell lineages, functions as a constitutively active protein tyrosine kinase. /// The ETV6-NTRK3 chimeric tyrosine kinase suppresses TGF-beta signaling by inactivating the TGF-beta type II receptor.. /// "The ETV6-NTRK3 (EN) chimeric tyrosine kinase, a potent oncoprotein expressed in tumors derived from multiple cell lineages, functions as a constitutively active protein tyrosine kinase. "
ETV6_NTRK3- 25674280acinic cell carcinoma;adenocarcinoma - - Here we report a case of MASC with high-grade transformation and cervical lymph node metastases confirmed with ETV6-NTRK3 translocation arising in the hard palate of a 41 year-old adult. /// Here we report a case of MASC with high-grade transformation and cervical lymph node metastases confirmed with ETV6-NTRK3 translocation arising in the hard palate of a 41 year-old adult. /// This is the first case with high grade histology that arise from minor salivary gland and it emphasizes the importance of molecular screening of salivary gland tumor with high-grade histology for ETV6-NTRK3 translocation. /// "This tumor shares histologic features, immunohistochemical profile, and a highly specific genetic translocation, ETV6-NTRK3, with secretory carcinoma of breast. "

ChimerSEQ

Top
The fusion gene pair ETV6--NTRK3 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
ETV6_NTRK3chr12/12022903/+ chr15/88483984/- 12p13.2 15q25.3 Exonic hg19 In-Frame Inter-chr BRCA TCGA-AO-A03U-01B Kinase; FusionScan
ETV6_NTRK3chr12/12022903/+ chr15/88483984/- 12p13.2 15q25.3 Exonic hg19 In-Frame Inter-chr COAD TCGA-CK-5913-01A Kinase; FusionScan
ETV6_NTRK3chr12/12022902/+ chr15/88483983/- 12p13.2 15q25.3 Exonic hg19 In-Frame Inter-chr BRCA TCGA-AO-A03U-01B Kinase; TopHat-Fusion
ETV6_NTRK3chr12/12022903/ chr15/88420143/ 12p13.2 15q25.3 Exonic hg19 - Inter-chr NA AF125808 Kinase; ChiTaRs
ETV6_NTRK3chr12/12022903/+ chr15/88483984/- 12p13.2 15q25.3 Exonic hg19 In-frame Inter-chr BRCA TCGA-AO-A03U-01B Kinase; PRADA
ETV6_NTRK3chr12/12022903/+ chr15/88483984/- 12p13.2 15q25.3 Exonic hg19 In-frame Inter-chr SKCM TCGA-EB-A51B-01A Kinase; PRADA
ETV6_NTRK3chr12/12006495/+ chr15/88576276/- 12p13.2 15q25.3 Exonic hg19 In-frame Inter-chr THCA TCGA-CE-A27D-01A Kinase; PRADA
ETV6_NTRK3chr12/12006495/+ chr15/88576276/- 12p13.2 15q25.3 Exonic hg19 In-frame Inter-chr THCA TCGA-DJ-A3UV-01A Kinase; PRADA
ETV6_NTRK3chr12/12006495/+ chr15/88576276/- 12p13.2 15q25.3 Exonic hg19 In-frame Inter-chr THCA TCGA-DJ-A4V0-01A Kinase; PRADA
ETV6_NTRK3chr12/12006495/+ chr15/88576276/- 12p13.2 15q25.3 Exonic hg19 In-frame Inter-chr THCA TCGA-E8-A438-01A Kinase; PRADA
ETV6_NTRK3chr12/12006495/+ chr15/88576276/- 12p13.2 15q25.3 Exonic hg19 In-frame Inter-chr THCA TCGA-EL-A3ZN-01A Kinase; PRADA
ETV6_NTRK3chr12/12006495/+ chr15/88576276/- 12p13.2 15q25.3 Exonic hg19 In-frame Inter-chr THCA TCGA-FE-A3PD-01A Kinase; PRADA
ETV6_NTRK3chr12/12022903/ chr15/88419991/ 12p13.2 15q25.3 Exonic hg19 - Inter-chr acute myeloid leukemia;mesoblastic nephroma AF041811 Kinase; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair ETV6--NTRK3 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF125808ETV6--NTRK3 ETV612 12022840 12022903 + 1 64 100 NTRK315 88420143 88483987 - 62 980 100
Human AF041811ETV6--NTRK3 ETV612 12022570 12022903 + 1 334 100 NTRK315 88419991 88483987 - 332 1402 100

FARE-CAFE

Top
The fusion gene pair ETV6--NTRK3 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
ETV6-NTRK3 Congenital fibrosarcoma,Secretory breast carcinoma,Infantile fibrosarcoma FISH t(12;15)(p13;q25) PubMed: 9462753

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
ETV6-NTRK3 ETV6-NTRK3-Isoform1 ETV6 _ _ 1 NTRK3 _ 0 _ ttgggagaatagcagAtgtgcagcacatta 20410810 _
ETV6-NTRK3 ETV6-NTRK3-Isoform2 ETV6 _ _ 1 NTRK3 _ 0 _ gaatagcagAtgtgcagcacatt 21401966 _
ETV6-NTRK3 ETV6-NTRK3-Isoform3 ETV6 _ _ 1 NTRK3 88483967 0 1 CCATTGGGAGAATAGCAGATGTGCAGCACATTAAGA 9811336 _
ETV6-NTRK3 ETV6-NTRK3-Isoform4 ETV6 12006471 1 1 NTRK3 88483959 0 1 ATACTGCATCAGAACCATGAAGAAgATGTGCAGCACATTAAGAGGAGAGAC 9949179 _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
ETV6-NTRK3 ETV6-NTRK3-Isoform1 - - - -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
NTRK3 1) LRRNT
2) LRR_8
3) I-set
1) LRR_1 , VWA , LRRNT , LRR_5 , LRR_8
2) Cys_knot , Flagellin_N , Internalin_N , LRR_5 , Laminin_N , VWA , DUF3439 , Hormone_6 , LRRNT , LRR_6 , Lys , E1_DerP2_DerF2 , I-set , LRR_1 , LRR_7 , Trypsin , Flagellin_C , Ig_2 , V-set , LRR_8 , LRR_4
3) C2-set , FGF , SCF , I-set , LRR_8 , NGF , Carb_anhydrase , Ig_2 , PDGF , Telethonin , CSF-1 , IL34 , SBP_bac_1 , C2-set_2 , Ig_3 , Pkinase , fn3 , V-set
1) SAM_PNT
2) Ets
3) LRRNT
4) LRR_8
5) I-set
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
3) LRR_1 , VWA , LRRNT , LRR_5 , LRR_8
4) Cys_knot , Flagellin_N , Internalin_N , LRR_5 , Laminin_N , VWA , DUF3439 , Hormone_6 , LRRNT , LRR_6 , Lys , E1_DerP2_DerF2 , I-set , LRR_1 , LRR_7 , Trypsin , Flagellin_C , Ig_2 , V-set , LRR_8 , LRR_4
5) C2-set , FGF , SCF , I-set , LRR_8 , NGF , Carb_anhydrase , Ig_2 , PDGF , Telethonin , CSF-1 , IL34 , SBP_bac_1 , C2-set_2 , Ig_3 , Pkinase , fn3 , V-set
ETV6-NTRK3 ETV6-NTRK3-Isoform2 - - - -ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
NTRK3 1) LRRNT
2) LRR_8
3) I-set
1) LRR_1 , VWA , LRRNT , LRR_5 , LRR_8
2) Cys_knot , Flagellin_N , Internalin_N , LRR_5 , Laminin_N , VWA , DUF3439 , Hormone_6 , LRRNT , LRR_6 , Lys , E1_DerP2_DerF2 , I-set , LRR_1 , LRR_7 , Trypsin , Flagellin_C , Ig_2 , V-set , LRR_8 , LRR_4
3) C2-set , FGF , SCF , I-set , LRR_8 , NGF , Carb_anhydrase , Ig_2 , PDGF , Telethonin , CSF-1 , IL34 , SBP_bac_1 , C2-set_2 , Ig_3 , Pkinase , fn3 , V-set
1) SAM_PNT
2) Ets
3) LRRNT
4) LRR_8
5) I-set
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
3) LRR_1 , VWA , LRRNT , LRR_5 , LRR_8
4) Cys_knot , Flagellin_N , Internalin_N , LRR_5 , Laminin_N , VWA , DUF3439 , Hormone_6 , LRRNT , LRR_6 , Lys , E1_DerP2_DerF2 , I-set , LRR_1 , LRR_7 , Trypsin , Flagellin_C , Ig_2 , V-set , LRR_8 , LRR_4
5) C2-set , FGF , SCF , I-set , LRR_8 , NGF , Carb_anhydrase , Ig_2 , PDGF , Telethonin , CSF-1 , IL34 , SBP_bac_1 , C2-set_2 , Ig_3 , Pkinase , fn3 , V-set
ETV6-NTRK3 ETV6-NTRK3-Isoform3 - - 1) LRRNT
2) LRR_8
3) I-set
1) LRR_1 , VWA , LRRNT , LRR_5 , LRR_8
2) Cys_knot , Flagellin_N , Internalin_N , LRR_5 , Laminin_N , VWA , DUF3439 , Hormone_6 , LRRNT , LRR_6 , Lys , E1_DerP2_DerF2 , I-set , LRR_1 , LRR_7 , Trypsin , Flagellin_C , Ig_2 , V-set , LRR_8 , LRR_4
3) C2-set , FGF , SCF , I-set , LRR_8 , NGF , Carb_anhydrase , Ig_2 , PDGF , Telethonin , CSF-1 , IL34 , SBP_bac_1 , C2-set_2 , Ig_3 , Pkinase , fn3 , V-set
ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
NTRK3 1) LRRNT
2) LRR_8
3) I-set
1) LRR_1 , VWA , LRRNT , LRR_5 , LRR_8
2) Cys_knot , Flagellin_N , Internalin_N , LRR_5 , Laminin_N , VWA , DUF3439 , Hormone_6 , LRRNT , LRR_6 , Lys , E1_DerP2_DerF2 , I-set , LRR_1 , LRR_7 , Trypsin , Flagellin_C , Ig_2 , V-set , LRR_8 , LRR_4
3) C2-set , FGF , SCF , I-set , LRR_8 , NGF , Carb_anhydrase , Ig_2 , PDGF , Telethonin , CSF-1 , IL34 , SBP_bac_1 , C2-set_2 , Ig_3 , Pkinase , fn3 , V-set
1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
ETV6-NTRK3 ETV6-NTRK3-Isoform4 1) SAM_PNT
1) SAM_PNT , Phage_lysozyme
1) LRRNT
2) LRR_8
3) I-set
1) LRR_1 , VWA , LRRNT , LRR_5 , LRR_8
2) Cys_knot , Flagellin_N , Internalin_N , LRR_5 , Laminin_N , VWA , DUF3439 , Hormone_6 , LRRNT , LRR_6 , Lys , E1_DerP2_DerF2 , I-set , LRR_1 , LRR_7 , Trypsin , Flagellin_C , Ig_2 , V-set , LRR_8 , LRR_4
3) C2-set , FGF , SCF , I-set , LRR_8 , NGF , Carb_anhydrase , Ig_2 , PDGF , Telethonin , CSF-1 , IL34 , SBP_bac_1 , C2-set_2 , Ig_3 , Pkinase , fn3 , V-set
ETV6 1) SAM_PNT
2) Ets
1) SAM_PNT , Phage_lysozyme
2) SRF-TF , Ank_2 , PAX , Ets
NTRK3 1) LRRNT
2) LRR_8
3) I-set
1) LRR_1 , VWA , LRRNT , LRR_5 , LRR_8
2) Cys_knot , Flagellin_N , Internalin_N , LRR_5 , Laminin_N , VWA , DUF3439 , Hormone_6 , LRRNT , LRR_6 , Lys , E1_DerP2_DerF2 , I-set , LRR_1 , LRR_7 , Trypsin , Flagellin_C , Ig_2 , V-set , LRR_8 , LRR_4
3) C2-set , FGF , SCF , I-set , LRR_8 , NGF , Carb_anhydrase , Ig_2 , PDGF , Telethonin , CSF-1 , IL34 , SBP_bac_1 , C2-set_2 , Ig_3 , Pkinase , fn3 , V-set
1) Ets
1) SRF-TF , Ank_2 , PAX , Ets

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
ETV6-NTRK3 hsa-miR-765hsa-miR-485-3phsa-miR-128-3phsa-miR-9-5phsa-miR-125b-5phsa-miR-125a-5phsa-miR-617hsa-miR-345-5phsa-miR-384hsa-miR-330-3phsa-miR-198hsa-miR-625-5phsa-miR-509-3phsa-miR-151a-3phsa-miR-185-5phsa-miR-768-5phsa-miR-615-3p hsa-miR-129-5phsa-miR-296-3phsa-miR-99b-5phsa-miR-92a-3p Report assay,Western Blot,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
ETV6-NTRK3 NM_001987.4 1) TRIM28_HUMAN
2) MITF_HUMAN
3) STAT1_HUMAN
4) RBL2_HUMAN
5) P53_HUMAN
6) RUNX1_HUMAN
7) PRDM14_HUMAN
8) ETS1_HUMAN
9) EGR1_HUMAN
10) GATA2_HUMAN
11) GATA3_HUMAN
12) SOX2_HUMAN
13) TAL1_HUMAN
14) CTCF_HUMAN
15) BRG1_HUMAN
16) HNF4A_HUMAN
17) FOXA1_HUMAN
18) CEBPA_HUMAN
19) CTCF_HUMAN
20) ESR1_HUMAN
21) SETDB1_HUMAN
22) SPI1_HUMAN
23) TRIM24_HUMAN
1) ESTROGEN RECEPTOR ALPHA_HUMAN
2) FOS_HUMAN
3) E2F1_HUMAN
4) TFAP2C_HUMAN
5) NR1H3_HUMAN
1) 17542650
2) 21258399
3) 19122651
4) 20385362
5) 21394211
6) 20019798
7) 20953172
8) 20019798
9) 20690147
10) 21808000
11) 21878914
12) 21211035
13) 21795385
14) 21795385
15) 19505939
16) 21646355
17) 21572391
18) 20219941
19) 20219941
20) 21235772
21) 21430779
22) 21241896
23) 21164480

TicDB

Top
The fusion gene pair ETV6--NTRK3 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
ETV6 NTRK3 20410810 ttgggagaatagcagAtgtgcagcacatta
ETV6 NTRK3 21401966 gaatagcagAtgtgcagcacatt
ETV6 NTRK3 9811336 CCATTGGGAGAATAGCAGATGTGCAGCACATTAAGA
ETV6 NTRK3 9949179 ATACTGCATCAGAACCATGAAGAAgATGTGCAGCACATTAAGAGGAGAGAC

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair ETV6--NTRK3 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
BRCA AO-A03U-01B ETV6__NTRK3 5.5 12:12022903/1 15:88483984/-1 tier1 In-frame 5868 NA
THCA CE-A27D-01A ETV6__NTRK3 5.5 12:12006495/1 15:88576276/-1 tier1 In-frame 5869 NA
COAD CK-5913-01A ETV6__NTRK3 5.5 12:12022903/1 15:88483984/-1 tier1 In-frame 5870 NA
COAD CK-5916-01A ETV6__NTRK3 5.5 12:12022903/1 15:88483984/-1 tier1 In-frame 5871 NA
THCA DJ-A3UV-01A ETV6__NTRK3 5.5 12:12006495/1 15:88576276/-1 tier1 In-frame 5872 NA
THCA DJ-A4V0-01A ETV6__NTRK3 5.5 12:12006495/1 15:88576276/-1 tier1 In-frame 5873 NA
THCA E8-A438-01A ETV6__NTRK3 5.5 12:12006495/1 15:88576276/-1 tier1 In-frame 5874 NA
SKCM EB-A51B-01A ETV6__NTRK3 5.5 12:12022903/1 15:88483984/-1 tier1 In-frame 5875 NA
THCA EL-A3ZN-01A ETV6__NTRK3 5.5 12:12006495/1 15:88576276/-1 tier1 In-frame 5876 NA
THCA FE-A3PD-01A ETV6__NTRK3 5.5 12:12006495/1 15:88576276/-1 tier1 In-frame 5877 non-validated

FusionCancer

Top
The fusion gene pair ETV6--NTRK3 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair ETV6--NTRK3 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene ETV6--NTRK3 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene ETV6--NTRK3 is found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016)

Bodymap2

Top
Fusion gene ETV6--NTRK3 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene ETV6--NTRK3 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene ETV6--NTRK3 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair ETV6--NTRK3 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene ETV6--NTRK3 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene ETV6--NTRK3 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene ETV6 is a known oncogene according to ONGENE database.


The tail gene NTRK3 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene ETV6 is cancer associated according to Bushman Cancer Gene database.


The tail gene NTRK3 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene ETV6 is proto-oncogene or tumor suppresor gene according to Uniprot database.
The tail gene NTRK3 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene ETV6--NTRK3 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene ETV6--NTRK3 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair ETV6--NTRK3 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene ETV6--NTRK3 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene ETV6--NTRK3 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair ETV6--NTRK3 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair ETV6--NTRK3 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair ETV6--NTRK3 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
ETV6--NTRK3The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7
ETV6--NTRK3The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7
ETV6--NTRK3Recurrent intragenic rearrangements of EGFR and BRAF in soft tissue tumors of infantshttps://www.nature.com/articles/s41467-018-04650-6

Cortex_Dataset

Top
Fusion gene ETV6--NTRK3 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair ETV6--NTRK3 information is not available in ChromothripsisDB database.