CBFB--MYH11

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

CBFB MYH11

COSMIC

The fusion gene pair CBFB--MYH11 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair CBFB--MYH11 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
CBFB_MYH11-/-/ -/-/ - hg18 acute myelomonocytic leukemia - - - Mitelman
CBFB_MYH11-/-/ -/-/ - hg18 acute monoblastic leukemia - - - Mitelman
CBFB_MYH11-/-/ -/-/ - hg18 acute myeloblastic leukemia - - - Mitelman
CBFB_MYH11-/-/ -/-/ - hg18 acute myeloid leukemia - - - Mitelman
CBFB_MYH11-/-/ -/-/ - hg18 chronic myeloid leukemia - - - Mitelman
CBFB_MYH11-/-/ -/-/ - hg18 myelodysplastic syndrome - - - Mitelman
CBFB_MYH11-/-/ -/-/ - hg18 refractory anemia - - - Mitelman
CBFB_MYH11-/0/ -/0/ Exonic hg18 - - - - TICdb
CBFB_MYH11-/10083/ -/0/ Exonic hg18 - - - - TICdb
CBFB_MYH11-/14625/ -/0/ Exonic hg18 - - - - TICdb

ChimerPUB

Top
The fusion gene pair CBFB--MYH11 information is not available in CHIMERPUB (CHIMERDB 3.0) database.

ChimerSEQ

Top
The fusion gene pair CBFB--MYH11 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
CBFB_MYH11chr16/67116211/+ chr16/15814908/- 16q22.1 16p13.11 Exonic hg19 In-Frame Intra-chr LAML TCGA-AB-2888-03B - FusionScan
CBFB_MYH11chr16/67116211/+ chr16/15814908/- 16q22.1 16p13.11 Exonic hg19 In-Frame Intra-chr LAML TCGA-AB-2954-03A - FusionScan
CBFB_MYH11chr16/67116211/+ chr16/15814908/- 16q22.1 16p13.11 Exonic hg19 In-Frame Intra-chr LAML TCGA-AB-2889-03A - FusionScan
CBFB_MYH11chr16/67116211/+ chr16/15820911/- 16q22.1 16p13.11 Exonic hg19 In-Frame Intra-chr LAML TCGA-AB-2828-03A - FusionScan
CBFB_MYH11chr16/67116211/+ chr16/15814908/- 16q22.1 16p13.11 Exonic hg19 In-Frame Intra-chr LAML TCGA-AB-2846-03A - FusionScan
CBFB_MYH11chr16/67116211/+ chr16/15814908/- 16q22.1 16p13.11 Exonic hg19 In-Frame Intra-chr LAML TCGA-AB-2870-03A - FusionScan
CBFB_MYH11chr16/67116211/+ chr16/15814908/- 16q22.1 16p13.11 Exonic hg19 In-Frame Intra-chr LAML TCGA-AB-2881-03A - FusionScan
CBFB_MYH11chr16/67116211/+ chr16/15814908/- 16q22.1 16p13.11 Exonic hg19 In-Frame Intra-chr LAML TCGA-AB-2942-03A - FusionScan

ChiTaRS 2.1

Top
The fusion gene pair CBFB--MYH11 information is not available in CHITARS database.

FARE-CAFE

Top
The fusion gene pair CBFB--MYH11 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
CBFB-MYH11 Acute myeloid leukemia Southern blot,RT-PCR (16)(p13q22) PubMed:18024381

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
CBFB-MYH11 CBFB-MYH11-Isoform1 CBFB 67116211 0 1 MYH11 15815384 0 1 GTCTCATCGGGAGGAAATGGAGccctgtccctggctcgggcc 18024381 _
CBFB-MYH11 CBFB-MYH11-Isoform2 CBFB 67116231 0 1 MYH11 15818614 0 1 ACGCGAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGGAGCTGCTTCAAGAAGAAACCCGGCAGAAGCTCAACGTGTCTA _ AF249896
CBFB-MYH11 CBFB-MYH11-Isoform3 CBFB 67116211 0 1 MYH11 15818744 0 0 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGAATGAAGTTGAGAGCGTCACAGGGATGCTTAACGAGGCCGAGGGGAAGGCCATTAAGCTGGCCAAGGACGTGGCGTCCCTCAGTTCCCAGCTCCAGGACACCCAGGAGTT _ AF249897
CBFB-MYH11 CBFB-MYH11-Isoform4 CBFB 67116213 0 1 MYH11 15814849 0 1 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGGTCCATGAGCTGGAGAAGTCCAAGCGGGCCCTGGAGACCCAGATGGAGGAGATGAAGACG _ AF249898
CBFB-MYH11 CBFB-MYH11-Isoform4 CBFB 67116211 0 1 MYH11 15820885 0 1 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGTTCAAGAGGGCCAAGGCGAACCTAGACAAGAATAAG _ AF251768
CBFB-MYH11 CBFB-MYH11-Isoform5 CBFB 67130867 0 1 MYH11 15815449 0 1 GACTCCGTCTCAAAAAAAAAAAAAAAAAAtACATCTGAGTCGTACATGGTTGTTAGCCGAGGAGAAAAACATCTCTTCCAAATACGCGGATG _ AF390860
CBFB-MYH11 CBFB-MYH11-Isoform6 CBFB 67126325 0 1 MYH11 15814715 0 1 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGACTTAGCAATAGGGAGAACTAGCAGTGACTAAGGAGGCTGACATTAATGCCAATTGCCAAGGCGAACCTAGACAAGAATaAGCAGAATGAGGAGAAGAG _ X87833

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
CBFB-MYH11 CBFB-MYH11-Isoform1 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
CBFB 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
MYH11 1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
- -
CBFB-MYH11 CBFB-MYH11-Isoform2 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
CBFB 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
MYH11 1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
- -
CBFB-MYH11 CBFB-MYH11-Isoform3 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
CBFB 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
MYH11 1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
- -
CBFB-MYH11 CBFB-MYH11-Isoform4 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
CBFB 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
MYH11 1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
- -
CBFB-MYH11 CBFB-MYH11-Isoform4 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
CBFB 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
MYH11 1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
- -
CBFB-MYH11 CBFB-MYH11-Isoform5 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
CBFB 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
MYH11 1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
- -
CBFB-MYH11 CBFB-MYH11-Isoform6 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
CBFB 1) CBF_beta
1) CBF_beta , Runt , Ets , Cullin , Vif
MYH11 1) Myosin_N
2) Myosin_head
3) Myosin_tail_1
1) Myosin_head , EF-hand_7
2) Myosin_head , EF-hand_7 , EF-hand_6 , Myosin_N , Actin , IQ , Tropomyosin
- -

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
CBFB-MYH11 _ hsa-miR-145-5phsa-miR-155-5phsa-miR-125b-5phsa-let-7b-5phsa-miR-30a-5phsa-miR-130b-3phsa-miR-615-3phsa-miR-92a-3p _

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
CBFB-MYH11 NM_001755.2 1) MITF_HUMAN
2) STAT1_HUMAN
3) RBL2_HUMAN
4) E2F4_HUMAN
5) RUNX1_HUMAN
6) ESTROGEN RECEPTOR ALPHA_HUMAN
7) ETS1_HUMAN
8) EGR1_HUMAN
9) FOS_HUMAN
10) GATA2_HUMAN
11) GATA3_HUMAN
12) E2F1_HUMAN
13) CTCF_HUMAN
14) BRG1_HUMAN
15) HNF4A_HUMAN
16) TFAP2C_HUMAN
17) CEBPA_HUMAN
18) ESR1_HUMAN
19) SETDB1_HUMAN
20) SPI1_HUMAN
21) TRIM24_HUMAN
1) FOXA1_HUMAN
2) NR1H3_HUMAN
1) 21258399
2) 19122651
3) 20385362
4) 21247883
5) 20019798
6) 20547749
7) 20019798
8) 20690147
9) 20139302
10) 21808000
11) 21878914
12) 21310950
13) 21795385
14) 19505939
15) 21646355
16) 21572391
17) 20219941
18) 21566084
19) 21430779
20) 21241896
21) 21164480

TicDB

Top
The fusion gene pair CBFB--MYH11 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
CBFB MYH11 18024381 GTCTCATCGGGAGGAAATGGAGccctgtccctggctcgggcc
CBFB MYH11 AF202996 ACGCGAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGGAGCTGCTTCAAGAAGAAACCCGGCAGAAGCTCAACGTGTCTA
CBFB MYH11 AF249897 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGAATGAAGTTGAGAGCGTCACAGGGATGCTTAACGAGGCCGAGGGGAAGGCCATTAAGCTGGCCAAGGACGTGGCGTCCCTCAGTTCCCAGCTCCAGGACACCCAGGAGTT
CBFB MYH11 AF249898 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGGTCCATGAGCTGGAGAAGTCCAAGCGGGCCCTGGAGACCCAGATGGAGGAGATGAAGACG
CBFB MYH11 AF251768 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGTTCAAGAGGGCCAAGGCGAACCTAGACAAGAATAAG
CBFB MYH11 AF390860 GACTCCGTCTCAAAAAAAAAAAAAAAAAAtACATCTGAGTCGTACATGGTTGTTAGCCGAGGAGAAAAACATCTCTTCCAAATACGCGGATG
CBFB MYH11 X87833 GAATTTGAAGATAGAGACAGGTCTCATCGGGAGGAAATGGAGACTTAGCAATAGGGAGAACTAGCAGTGACTAAGGAGGCTGACATTAATGCCAATTGCCAAGGCGAACCTAGACAAGAATaAGCAGAATGAGGAGAAGAG

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair CBFB--MYH11 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
LAML AB-2815-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier4 In-frame 3058 NA
LAML AB-2828-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15820911/-1 tier1 In-frame 3059 NA
LAML AB-2846-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier1 In-frame 3060 NA
LAML AB-2870-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier1 In-frame 3061 NA
LAML AB-2881-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier1 In-frame 3062 NA
LAML AB-2888-03B CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier1 In-frame 3063 NA
LAML AB-2889-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier1 In-frame 3064 NA
LAML AB-2892-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier1 In-frame 3065 NA
LAML AB-2914-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier1 In-frame 3066 NA
LAML AB-2942-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier1 In-frame 3067 NA
LAML AB-2954-03A CBFB__MYH11 4.00E-05 16:67116211/1 16:15814908/-1 tier1 In-frame 3068 NA

FusionCancer

Top
The fusion gene pair CBFB--MYH11 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair CBFB--MYH11 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene CBFB--MYH11 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene CBFB--MYH11 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene CBFB--MYH11 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene CBFB--MYH11 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene CBFB--MYH11 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair CBFB--MYH11 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene CBFB--MYH11 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene CBFB--MYH11 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene CBFB is a known oncogene according to ONGENE database.
The tail gene MYH11 is not a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene CBFB is cancer associated according to Bushman Cancer Gene database.


The tail gene MYH11 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene CBFB is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene MYH11 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene CBFB--MYH11 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene CBFB--MYH11 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair CBFB--MYH11 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene CBFB--MYH11 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene CBFB--MYH11 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair CBFB--MYH11 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair CBFB--MYH11 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair CBFB--MYH11 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene CBFB--MYH11 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair CBFB--MYH11 information is not available in ChromothripsisDB database.