BIRC3--MALT1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

BIRC3 MALT1

COSMIC

The fusion gene pair BIRC3--MALT1 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair BIRC3--MALT1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
BIRC3_MALT1-/0/ -/0/ Exonic hg18 - - - - TICdb

ChimerPUB

Top
The fusion gene pair BIRC3--MALT1 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
BIRC3_MALT1t(11;18)(q21;q21) / 10760689MALT lymphoma;B cell lymphoma;lymphoma;lymphoproliferative disorder - - pylori) infection has not yet been comprehensively analyzed, especially in relation to the recently identified c-IAP2-MALT1 / MLT gene alteration resulting from the t(11;18)(q21;q21) chromosomal translocation found in MALT lymphoma. /// Polypoid lesions in MALT-C were associated with c-IAP2-MALT1 / MLT gene alteration resulting from t(11;18)(q21;q21).
BIRC3_MALT1t(11;18)(q21;q21) / t(1;14)(p22;q32) / t(14;18)(q32;q21) / 15711920MALT lymphoma;lymphoma - - At least three distinct chromosomal translocations, t(11;18)(q21;q21), t(1;14)(p22;q32) and t(14;18)(q32;q21) involving the API2 (also known as c-IAP2)-MALT1 fusion protein, BCL10, and MALT1, respectively, have been implicated in the molecular pathogenesis of mucosa associated lymphoid tissue (MALT) lymphoma. /// "Our findings showed that several variants of the API2-MALT1 fusion protein can occur in patients with t(11;18)(q21;q21), and that API2-MALT1 can potently enfance activation of nuclear factor (NF)-kappaB signaling, which may be relevant to the pathogenesis of MALT lymphomas. " /// Anti-apoptotic action of API2-MALT1 fusion protein involved in t(11;18)(q21;q21) MALT lymphoma.. /// "Taken together, these findings prompt us to hypothesize that the anti-apoptotic action of API2-MALT1 may be mediated partly by the direct interaction with apoptotic regulators as well as partly by upregulation of apoptotic inhibitor genes. " /// "This stability of API2-MALT1 may thus result in inappropriate nuclear factor (NF)-kappaB activation, thereby contributing to the pathogenesis of MALT lymphoma. " /// "We recently provided direct evidence that API2-MALT1 indeed exerts anti-apoptotic action, in part, through its direct interaction with apoptotic regulators including Smac. " /// "We also found that MALT1 is rapidly degraded via the ubiquitin-proteasome pathway, as is the case with API2, but upon the synthesis of fusion, API2-MALT1 becomes stable against this pathway. " /// "It can be assumed that API2-MALT1 can bypass this normal BCL10/MALT1 cellular signaling pathway linked to NF-kappaB activation, thereby inducing antigen receptor-independent proliferation of lymphocytes. "
BIRC3_MALT1t(11;18)(q21;q21) / 16395399MALT lymphoma;lymphoma - - add to our understanding of the molecular consequences of this translocation, showing that its fusion product, cIAP2-MALT1, may concomitantly contribute to lymphomagenesis both as a tumor suppressor gene and as an oncogene..
BIRC3_MALT1 t(11;18)(q21;q21) / 15894263MALT lymphoma;lymphoma - - Here we show that self-oligomerization of the c-IAP2/MALT1 protein causes deregulated ubiquitin ligase activity of MALT1/paracaspase. /// "The c-IAP2/MALT1 fusion protein activates the NF-kappaB pathway, which is considered critical to malignant B cell transformation and lymphoma progression. "

ChimerSEQ

Top
The fusion gene pair BIRC3--MALT1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
BIRC3_MALT1chr11/102201973/ chr18/56363598/ 11q22.2 18q21.32 Exonic hg19 - Inter-chr NA AF123094 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair BIRC3--MALT1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF123094BIRC3--MALT1 BIRC311 102192565 102201973 + 7 1447 99.9 MALT118 56363598 56415263 + 1447 3734 100

FARE-CAFE

Top
The fusion gene pair BIRC3--MALT1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
BIRC3-MALT1 A)Malignant Lymphoma,B)MALTB-Cell Lymphomas A)Long-rangePCR,DNA sequencing,Southern blot,PCR,B)Long-rangePCR,DNA sequencing t(11;18)(q21;q21) PubMed:17339192

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
BIRC3-MALT1 BIRC3-MALT1-Isoform1 BIRC3 _ _ 1 MALT1 _ 1 _ gaaaaagaatcaaAtgaattaaataatctt 17339192 _
BIRC3-MALT1 BIRC3-MALT1-Isoform2 BIRC3 _ _ 1 MALT1 _ 1 _ gaaaaagaatcaaGaagtgttgatggcgtc 17339192 _
BIRC3-MALT1 BIRC3-MALT1-Isoform3 BIRC3 102201973 0 1 MALT1 56363598 1 0 CCTAGCAACTGGAGAGAATTATAGACTAGTCAATGATCTTGTGTTAGACTTACTCAATGCAGAAGATGAAATAAGGGAAGAGGAGAGAGAAAGAGCAACTGAGGAAAAAGAATCAAGAATAAAGATTACTGTAAACCCAGAGTCAAAGGCAGTCTTGGCTGGACAGTTTGTGAAACTGTGTTGCCGGGCAACTGGACATCCTTTTGTTCA _ AF123094
BIRC3-MALT1 BIRC3-MALT1-Isoform4 BIRC3 102205130 0 1 MALT1 56353495 1 0 _ _ _
BIRC3-MALT1 BIRC3-MALT1-Isoform5 BIRC3 102203066 0 1 MALT1 56368114 1 0 _ _ _
BIRC3-MALT1 BIRC3-MALT1-Isoform6 BIRC3 102205397 0 1 MALT1 56373369 1 0 _ _ _
BIRC3-MALT1 BIRC3-MALT1-Isoform7 BIRC3 102205909 0 1 MALT1 56380634 1 0 _ _ _
BIRC3-MALT1 BIRC3-MALT1-Isoform8 BIRC3 102202400 0 1 MALT1 56382949 1 0 _ _ _
BIRC3-MALT1 BIRC3-MALT1-Isoform9 BIRC3 102206344 0 1 MALT1 56377925 1 0 _ _ _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
BIRC3-MALT1 BIRC3-MALT1-Isoform1 - - - -BIRC3 1) BIR
2) CARD
3) zf-C3HC4_3
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
MALT1 1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
1) BIR
2) CARD
3) zf-C3HC4_3
4) Ig_2
5) Peptidase_C14
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
4) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
5) BIR
BIRC3-MALT1 BIRC3-MALT1-Isoform2 - - - -BIRC3 1) BIR
2) CARD
3) zf-C3HC4_3
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
MALT1 1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
1) BIR
2) CARD
3) zf-C3HC4_3
4) Ig_2
5) Peptidase_C14
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
4) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
5) BIR
BIRC3-MALT1 BIRC3-MALT1-Isoform3 1) BIR
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
BIRC3 1) BIR
2) CARD
3) zf-C3HC4_3
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
MALT1 1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
1) CARD
2) zf-C3HC4_3
1) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
2) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
BIRC3-MALT1 BIRC3-MALT1-Isoform4 1) BIR
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
BIRC3 1) BIR
2) CARD
3) zf-C3HC4_3
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
MALT1 1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
1) CARD
2) zf-C3HC4_3
1) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
2) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
BIRC3-MALT1 BIRC3-MALT1-Isoform5 1) BIR
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
BIRC3 1) BIR
2) CARD
3) zf-C3HC4_3
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
MALT1 1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
1) CARD
2) zf-C3HC4_3
1) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
2) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
BIRC3-MALT1 BIRC3-MALT1-Isoform6 1) BIR
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
BIRC3 1) BIR
2) CARD
3) zf-C3HC4_3
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
MALT1 1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
1) CARD
2) zf-C3HC4_3
1) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
2) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
BIRC3-MALT1 BIRC3-MALT1-Isoform7 1) BIR
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
1) Peptidase_C14
1) BIR
BIRC3 1) BIR
2) CARD
3) zf-C3HC4_3
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
MALT1 1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
1) CARD
2) zf-C3HC4_3
3) Ig_2
1) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
2) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
3) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
BIRC3-MALT1 BIRC3-MALT1-Isoform8 1) BIR
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
1) Peptidase_C14
1) BIR
BIRC3 1) BIR
2) CARD
3) zf-C3HC4_3
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
MALT1 1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
1) CARD
2) zf-C3HC4_3
3) Ig_2
1) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
2) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
3) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
BIRC3-MALT1 BIRC3-MALT1-Isoform9 1) BIR
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
1) Peptidase_C14
1) BIR
BIRC3 1) BIR
2) CARD
3) zf-C3HC4_3
1) BIR , PP2C , Peptidase_C14 , Smac_DIABLO , zf-C3HC4_3
2) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
3) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
MALT1 1) Ig_2
2) Peptidase_C14
1) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3
2) BIR
1) CARD
2) zf-C3HC4_3
3) Ig_2
1) ubiquitin , CARD , NB-ARC , Bcl-2 , SBP_bac_1 , zf-C3HC4_3
2) zf-C3HC4_3 , BIR , CARD , Cbl_N , Cbl_N2 , Cbl_N3 , UQ_con , ubiquitin
3) SCF , hEGF , C1-set , DUF1954 , IL1 , Ig_Tie2_1 , NGF , C2-set_2 , G2F , IL34 , LRR_8 , PDGF , S_100 , ig , CSF-1 , I-set , Ig_2 , Laminin_G_1 , PSI , V-set , Carb_anhydrase , ICAM_N , Ig_3 , MHC_I , Pentaxin , fn3

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
BIRC3-MALT1 hsa-miR-21-5p hsa-miR-34a-5phsa-miR-375hsa-miR-98-5p Microarray

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
BIRC3-MALT1 NM_001165.4 1) STAT1_HUMAN
2) RBL2_HUMAN
3) E2F4_HUMAN
4) ETS1_HUMAN
5) TAL1_HUMAN
6) CTCF_HUMAN
7) BRG1_HUMAN
8) FOXA1_HUMAN
9) CEBPA_HUMAN
10) STAT6_HUMAN
11) ESR1_HUMAN
12) SPI1_HUMAN
1) RB1_HUMAN
2) GATA2_HUMAN
3) TFAP2C_HUMAN
4) NR1H3_HUMAN
1) 19122651
2) 20385362
3) 21247883
4) 20019798
5) 21795385
6) 21795385
7) 19505939
8) 21572391
9) 20219941
10) 21828071
11) 21566084
12) 21241896

TicDB

Top
The fusion gene pair BIRC3--MALT1 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
BIRC3 MALT1 17339192 gaaaaagaatcaaAtgaattaaataatctt
BIRC3 MALT1 17339192 gaaaaagaatcaaGaagtgttgatggcgtc
BIRC3 MALT1 AF123094 CCTAGCAACTGGAGAGAATTATAGACTAGTCAATGATCTTGTGTTAGACTTACTCAATGCAGAAGATGAAATAAGGGAAGAGGAGAGAGAAAGAGCAACTGAGGAAAAAGAATCAAGAATAAAGATTACTGTAAACCCAGAGTCAAAGGCAGTCTTGGCTGGACAGTTTGTGAAACTGTGTTGCCGGGCAACTGGACATCCTTTTGTTCA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair BIRC3--MALT1 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair BIRC3--MALT1 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair BIRC3--MALT1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene BIRC3--MALT1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene BIRC3--MALT1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene BIRC3--MALT1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene BIRC3--MALT1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene BIRC3--MALT1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair BIRC3--MALT1 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene BIRC3--MALT1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene BIRC3--MALT1 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene BIRC3 is a known oncogene according to ONGENE database.


The tail gene MALT1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene BIRC3 is cancer associated according to Bushman Cancer Gene database.


The tail gene MALT1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene BIRC3 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.
The tail gene MALT1 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene BIRC3--MALT1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene BIRC3--MALT1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair BIRC3--MALT1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene BIRC3--MALT1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene BIRC3--MALT1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair BIRC3--MALT1 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair BIRC3--MALT1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair BIRC3--MALT1 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene BIRC3--MALT1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair BIRC3--MALT1 information is not available in ChromothripsisDB database.