BCR--FGFR1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

BCR FGFR1

COSMIC

The fusion gene pair BCR--FGFR1 information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair BCR--FGFR1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
BCR_FGFR1-/0/ -/0/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_FGFR1-/3065/ -/32/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_FGFR1-/-/ -/-/ - hg18 chronic myelogenous leukemia - 11739186 Kinase; Oncogene; OMIM
BCR_FGFR1-/-/ -/-/ - hg18 chronic myeloid leukemia - 11739186 Kinase; Oncogene; OMIM

ChimerPUB

Top
The fusion gene pair BCR--FGFR1 information is not available in CHIMERPUB (CHIMERDB 3.0) database.

ChimerSEQ

Top
The fusion gene pair BCR--FGFR1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
BCR_FGFR1chr22/23603730/ chr8/38275777/ 22q11.23 8p11.23 Exonic hg19 - Inter-chr NA AJ298916 Kinase; Oncogene; ChiTaRs
BCR_FGFR1chr22/23606792/ chr8/38276980/ 22q11.23 8p11.23 Exonic hg19 - Inter-chr NA AJ298918 Kinase; Oncogene; ChiTaRs
BCR_FGFR1chr22/23603730/ chr8/38275780/ 22q11.23 8p11.23 Exonic hg19 - Inter-chr acute myeloid leukemia;chronic myeloid leukemia;acute lymphoblastic leukemia;lymphoblastic lymphoma AB742170 Kinase; Oncogene; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair BCR--FGFR1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AJ298916BCR--FGFR1 BCR22 23524261 23603730 + 1 642 100 FGFR18 38275777 38275904 - 625 754 96.8
Human AB742170BCR--FGFR1 BCR22 23595983 23603730 + 7 485 100 FGFR18 38275780 38275904 - 468 594 96.7
Human AJ298918BCR--FGFR1 BCR22 23606747 23606792 + 1 46 100 FGFR18 38276980 38277025 - 47 92 100

FARE-CAFE

Top
The fusion gene pair BCR--FGFR1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
BCR-FGFR1 Chronic Myeloid Leukemia RT-PCR,FISH t(8;22)(p11;q11) PubMed: 11739186

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
BCR-FGFR1 BCR-FGFR1-Isoform1 BCR 23603730 0 1 FGFR1 38275846 0 1 GAGTTCTATGATGGGCTCTTCCCCCGCGTGCAGCAGTGGAGCCACCAGCAGCGGGTGGGCGACCTCTTCCAGAAGCTGGTGTCTGCTGACTCCAGTGCATCCATGAACTCTGGGGTTCTTCTGG _ AJ298916
BCR-FGFR1 BCR-FGFR1-Isoform2 BCR 23606792 0 1 FGFR1 38276980 0 0 CCTGTTGGAGAGGCAGGACCTGCTGCTTTAGAGGAGTGCAGCTGAATCAGCACCACCTCTCTCTCTGGGCCTCTAATGCCCTGCCCTCTCCA _ AJ298918

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
BCR-FGFR1 BCR-FGFR1-Isoform1 1) Bcr-Abl_Oligo
2) RhoGEF
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
1) I-set
1) C2-set , FGF , Ig_3 , Pkinase , V-set , C2-set_2 , I-set , LRR_8 , SBP_bac_1 , fn3 , CSF-1 , IL34 , NGF , SCF , Carb_anhydrase , Ig_2 , PDGF , Telethonin
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
FGFR1 1) I-set
2) Pkinase_Tyr
1) C2-set , FGF , Ig_3 , Pkinase , V-set , C2-set_2 , I-set , LRR_8 , SBP_bac_1 , fn3 , CSF-1 , IL34 , NGF , SCF , Carb_anhydrase , Ig_2 , PDGF , Telethonin
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) PH
2) C2
3) RhoGAP
1) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
2) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
3) Ras , RhoGAP
BCR-FGFR1 BCR-FGFR1-Isoform2 1) Bcr-Abl_Oligo
2) RhoGEF
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
1) I-set
1) C2-set , FGF , Ig_3 , Pkinase , V-set , C2-set_2 , I-set , LRR_8 , SBP_bac_1 , fn3 , CSF-1 , IL34 , NGF , SCF , Carb_anhydrase , Ig_2 , PDGF , Telethonin
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
FGFR1 1) I-set
2) Pkinase_Tyr
1) C2-set , FGF , Ig_3 , Pkinase , V-set , C2-set_2 , I-set , LRR_8 , SBP_bac_1 , fn3 , CSF-1 , IL34 , NGF , SCF , Carb_anhydrase , Ig_2 , PDGF , Telethonin
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) PH
2) C2
3) RhoGAP
1) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
2) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
3) Ras , RhoGAP

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
BCR-FGFR1 hsa-miR-424-5phsa-miR-16-5phsa-miR-133bhsa-miR-124-3phsa-miR-296-3phsa-miR-181b-5p hsa-miR-744-5phsa-miR-10a-5phsa-miR-197-3p Report assay,Western Blot,Microarray,qPCR,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
BCR-FGFR1 NM_004327.3 1) MITF_HUMAN
2) STAT1_HUMAN
3) RBL2_HUMAN
4) ZNF263_HUMAN
5) E2F4_HUMAN
6) RUNX1_HUMAN
7) ESTROGEN RECEPTOR ALPHA_HUMAN
8) ETS1_HUMAN
9) EGR1_HUMAN
10) FOS_HUMAN
11) GATA2_HUMAN
12) GATA3_HUMAN
13) SOX2_HUMAN
14) E2F1_HUMAN
15) TAL1_HUMAN
16) CTCF_HUMAN
17) BRG1_HUMAN
18) HNF4A_HUMAN
19) TFAP2C_HUMAN
20) FOXA1_HUMAN
21) CEBPA_HUMAN
22) STAT6_HUMAN
23) ESR1_HUMAN
24) ESR2_HUMAN
25) MEIS1_HUMAN A
26) FOXP1_HUMAN A
27) NR1H3_HUMAN A
28) SPI1_HUMAN
- 1) 21258399
2) 19122651
3) 20385362
4) 19887448
5) 21247883
6) 20019798
7) 20547749
8) 20019798
9) 20690147
10) 20139302
11) 21808000
12) 21878914
13) 21211035
14) 21310950
15) 21795385
16) 19505939
17) 21646355
18) 21572391
19) 21572391
20) 20219941
21) 21828071
22) 20348243
23) 21235772
24) 21241896 A
25) 21924763 A
26) 22292898 A
27) 21241896

TicDB

Top
The fusion gene pair BCR--FGFR1 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
BCR FGFR1 AJ298916 GAGTTCTATGATGGGCTCTTCCCCCGCGTGCAGCAGTGGAGCCACCAGCAGCGGGTGGGCGACCTCTTCCAGAAGCTGGTGTCTGCTGACTCCAGTGCATCCATGAACTCTGGGGTTCTTCTGG
BCR FGFR1 AJ298918 CCTGTTGGAGAGGCAGGACCTGCTGCTTTAGAGGAGTGCAGCTGAATCAGCACCACCTCTCTCTCTGGGCCTCTAATGCCCTGCCCTCTCCA

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair BCR--FGFR1 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair BCR--FGFR1 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair BCR--FGFR1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene BCR--FGFR1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene BCR--FGFR1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene BCR--FGFR1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene BCR--FGFR1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene BCR--FGFR1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair BCR--FGFR1 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene BCR--FGFR1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene BCR--FGFR1 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene BCR is a known oncogene according to ONGENE database.


The tail gene FGFR1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene BCR is cancer associated according to Bushman Cancer Gene database.


The tail gene FGFR1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene BCR is proto-oncogene or tumor suppresor gene according to Uniprot database.
The tail gene FGFR1 is not a proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene BCR--FGFR1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene BCR--FGFR1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair BCR--FGFR1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene BCR--FGFR1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene BCR--FGFR1 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair BCR--FGFR1 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair BCR--FGFR1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair BCR--FGFR1 information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene BCR--FGFR1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair BCR--FGFR1 information is not available in ChromothripsisDB database.