BCR--ABL1

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

BCR ABL1

COSMIC

The fusion gene pair BCR--ABL1 information is available in COSMIC database.

Link
BCR--ABL1

ChimerKB

Top
The fusion gene pair BCR--ABL1 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
BCR_ABL1-/3458/ -/461/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/2030/ -/461/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/4073/ -/461/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/3533/ -/635/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/2030/ -/635/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/3458/ -/635/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/2866/ -/461-16/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/3458+89/ -/461-4395/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/2672/ -/461/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/3631/ -/461/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/2127/ -/388/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/4073+82/ -/461-416/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/2317/ -/461-?/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/2212/ -/461/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/2866/ -/461-?/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/4073+1044/ -/461-?/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/3458+30/ -/635-517/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/4073/ -/1/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/2866/ -/461/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/3410/ -/461-?/ Exonic hg19 - - - Kinase; Oncogene; Cosmic_recurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 20447687 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 19260121 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 24109527 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10233416 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 10233416 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 19497989 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 9858233 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 9519786 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 8822944 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 7934165 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 7934165 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 15776864 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 9544977 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25621010 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 24837466 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 17656262 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 17530620 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 20702476 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 8340287 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 22783572 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 14755375 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 9519792 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 12130477 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 17016044 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 11552990 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 17412419 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 8839830 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10583263 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 2825022 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 2193202 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 2232886 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 8412311 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 8289491 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 2013978 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 2747291 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 1742479 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 12100156 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 17021137 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 11801312 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 11801312 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 2407300 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 22029197 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 20682399 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 21072049 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 21641037 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 22382182 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 22937329 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 24752059 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25500442 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 21354517 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 18426313 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 21637474 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 15284852 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 7918054 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 9108430 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 11167748 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 11167748 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 12067277 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 11753631 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 11255282 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10828875 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 9665206 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 18268888 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 8759898 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 20739774 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10468864 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 23269583 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 23759653 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 20882436 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 21156255 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 22184525 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 21674858 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 22708039 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 22901309 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 23761821 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 19048492 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 19067742 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 19531657 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 19837272 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 19714331 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 20110001 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25006280 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 24959016 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 23054652 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25097530 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 9389724 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25197554 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 14635208 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 23299156 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 16888785 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 2820585 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 2224129 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 17145570 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 15843824 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 12145699 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 20224640 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 7606740 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10886215 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 16875942 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 15995044 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25807654 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 1932752 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 16475128 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 12031929 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 10602422 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10602422 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10549273 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10526530 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 9166872 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 12161380 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 17452251 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 15949566 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 9760154 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 9096706 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 17415872 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 10567681 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10567681 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 2223646 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 8547143 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 7950925 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 7950925 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 11378554 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 8684009 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 16109618 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 12011769 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 12688366 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10998848 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 22760091 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 11392325 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 11122114 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 10520010 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 7658716 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 19039205 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 19589926 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 18276770 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25913326 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 15327531 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 26059983 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 19488866 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 23859904 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 25861237 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 12651265 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 12116073 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 23317202 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 22994759 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 19579075 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 26264145 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 23511488 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 22572394 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 9172811 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 7873385 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 21869488 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 17230064 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 25692130 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25692130 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 18455790 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 18633615 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 22226019 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 26266519 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 26308885 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 haematopoietic neoplasm - 25547655 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg19 lymphoid neoplasm - 21931113 Kinase; Oncogene; Cosmic_nonrecurrent
BCR_ABL1-/-/ -/-/ - hg18 chronic myeloid leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 acute erythroleukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 lymphoblastic leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 acute megakaryoblastic leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 acute myeloblastic leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 acute myeloid leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 acute myelomonocytic leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 acute promyelocytic leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 acute undifferentiated leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 biphenotypic leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 Burkitt lymphoma/leukemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 diffuse large cell lymphoma - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 multiple myeloma - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 myelodysplastic syndrome - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 nonneoplastic myeloid disorder/lesion - - Kinase; Oncogene; Mitelman
BCR_ABL1-/-/ -/-/ - hg18 refractory anemia - - Kinase; Oncogene; Mitelman
BCR_ABL1-/0/ -/0/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_ABL1-/15/ -/18524/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_ABL1-/244/ -/16587/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_ABL1-/282/ -/15980/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_ABL1-/468/ -/108009/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_ABL1-/633/ -/25226/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_ABL1-/661/ -/68053/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_ABL1-/995/ -/115791/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_ABL1-/1096/ -/72271/ Exonic hg18 - - - Kinase; Oncogene; TICdb
BCR_ABL1-/-/ -/-/ - hg18 chronic myelogenous leukemia - 6584200 Kinase; Oncogene; OMIM
BCR_ABL1-/-/ -/-/ - hg18 acute lymphocytic leukemia - 3513189 Kinase; Oncogene; OMIM
BCR_ABL1-/-/ -/-/ - hg18 chronic myelogenous leukemia - 7665185 Kinase; Oncogene; OMIM
BCR_ABL1-/-/ -/-/ - hg18 acute lymphocytic leukemia - 7665185 Kinase; Oncogene; OMIM

ChimerPUB

Top
The fusion gene pair BCR--ABL1 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
BCR_ABL1t(9;22)(q34;q11) / 15716990- FISH - Deletions from the derivative chromosome 9, der(9), of the translocation, t(9;22)(q34;q11), at the site of the ABL/BCR fusion gene, have been demonstrated by fluorescence in situ hybridisation (FISH), in both Philadelphia chromosome (Ph)-positive chronic myeloid leukaemia (CML) and acute lymphoblastic leukaemia (ALL). /// This study presents the findings of dual fusion FISH used to detect such deletions in a series of 27 BCR/ ABL-positive childhood ALL patients.
BCR_ABL1t(9;22)(q34;q11) / 20809971- FISH - Chronic myeloid leukaemia (CML) is characterized by the expression of the BCR/ABL1 fusion gene, a constitutively activated tyrosine kinase that commonly results from the formation of the Philadelphia (Ph) chromosome after a t(9;22)(q34;q11) or variant rearrangement. /// Genomic amplification of BCR/ABL1 and a region downstream of ABL1 in chronic myeloid leukaemia: a FISH mapping study of CML patients and cell lines.. /// "The duplication of the Ph chromosome is a recurring abnormality acquired during disease progression, whereas intrachromosomal amplification of BCR/ABL1 is a rare phenomenon and has been associated with imatinib therapy resistance. " /// "One of the patients had 5 BCR/ABL1 positive clones with variable level of 9q34 amplifications on a variety of structures, from an isoderivative 22 to tandem duplications. " /// "Archival bone marrow chromosome suspensions from 19 CML patients known to carry more than 1 copy of BCR/ABL1 and 10 CML cell lines were analyzed by fluorescent in situ hybridization with a panel of probes from 9q34.1-qter to investigate whether they carried two identical copies of the Ph chromosome or, instead, one or both Ph contained cryptic imbalances of some regions. " /// These data confirm that the intrachromosomal genomic amplification of BCR/ABL1 that occurs in some CML patients during disease progression also involves amplification of 9q34 gene-rich sequences downstream of ABL1 breakpoint. /// "2 patients were found to carry marker structures harbouring high copy number gains of BCR/ABL1 fusion along with a variable part of 9q34 region downstream of ABL1 breakpoint, similarly to the markers present in the imatinib resistant cell line K562. "
BCR_ABL1t(9;22)(q34;q11) / t(12;13)(p12;q13) / 12823349- FISH - Most chronic myeloid leukaemia (CML) patients are genetically characterized by the t(9;22)(q34;q11), generating the BCR/ABL1 fusion gene.
BCR_ABL1t(9;22) / 20924716acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia;neuroblastoma FISH;PCR - Cytogenetic analysis with iFISH showed t(9;22) (q34;q11.2), with minor-BCR/ABL1 fusion gene in the majority of nuclei, while a subclone with duplication of the Philadelphia chromosome was observed. /// "BCR/ABL1 fusion gene, duplication of Philadelphia chromosome and persistence of MRD constitute inferior prognostic factors, while hyperdiploidy, trisomy of chromosome 21 and FLT3-AL mutations are related to better prognosis. "
BCR_ABL1t(9;22) / t(9;22) / 23032829leukemia FISH - Chronic myelogenous leukemia (CML) is characterised by the t(9;22)(q34;q11.2) which results in the formation of the BCR/ABL1 fusion gene. /// "The study group consisted of all patients diagnosed or suspected to have CML who had interphase FISH analysis at presentation on peripheral blood/bone marrow using a commercially available BCR/ABL1 dual colour, dual fusion probe. " /// Fluorescence in situ hybridization patterns of BCR/ABL1 fusion in chronic myelogenous leukemia at diagnosis.. /// FISH analysis at presentation is used to determine the number of cells with BCR/ABL1 fusion and establish whether the patterns are typical or atypical. /// There were 1076 diagnostic samples which were positive for BCR/ABL1 fusion.
BCR_ABL1inv(9)(p22q34) / t(9;22) / 21156255acute myeloid leukemia;chronic myeloid leukemia;myeloid leukemia;leukemia FISH - All four patients had two malignant clones: one with only t(9;22)(q34;q11.2) and another with der(9)t(9;22)(q34;q11.2)inv(9)(p22q34) that resulted in the separation of the ABL1/BCR fusion gene. /// "Reverse transcriptase-polymerase chain reaction revealed a b3a2 type of BCR/ABL1 fusion transcript in all of them, proving their disease to be Ph-positive leukemia. "
BCR_ABL1t(9;22) / 26186983chronic myeloid leukemia;myeloid leukemia;leukemia FISH - In this study, we describe the cytogenetic and molecular features of five CML patients with cryptic BCR-ABL1 fusion genes using karyotype, fluorescence in situ hybridization (FISH), and whole genome single nucleotide polymorphism array techniques. /// "In approximately 1% of CML cases, the Philadelphia chromosome associated with the BCR-ABL1 fusion gene is not present, and the BCR-ABL1 fusion gene is generated by cryptic insertion or sequential translocations. " /// This study demonstrates for the first time the acquisition of additional BCR-ABL1 fusion genes through mitotic recombination in CML with cryptic BCR-ABL1. /// "In two cases of CML-BP, duplication of the BCR-ABL1 fusion gene occurred as a result of mitotic recombination between homologous chromosomes. " /// "By BCR-ABL1 metaphase FISH analysis, we found that fusion signals were localized on chromosomes 9 (3 cases), 22 (1 case), and both 9 and 22 (1 case). " /// "Cytogenetic, fluorescence in situ hybridization, and genomic array characterization of chronic myeloid leukemia with cryptic BCR-ABL1 fusions.. "
BCR_ABL1t(9;22) / t(9;22)(q34;q11) / t(9;22) / 20500819chronic myeloid leukemia;myeloid leukemia;leukemia FISH - As a result of the translocation, the 3' portion of the ABL1 oncogene is transposed from 9q34 to the 5' portion of the BCR gene on chromosome 22 to form the BCR/ABL1 fusion gene.
BCR_ABL1t(9;22) / t(9;22) / 11836164chronic myeloid leukemia FISH - The BCR/ABL1 fusion gene is usually found on der(22). /// In all cases the BCR/ABL1 fusion gene was located on the Ph chromosome whereas the reciprocal ABL1/BCR gene was detected only in patient #2. /// The BCR/ABL1 D-FISH probe was applied to localize the BCR/ABL1 fusion gene as well as the 5'ABL1 and the 3'BCR.
BCR_ABL1t(9;22)(q34;q11) / 18638369- FISH - The Ph results in the formation of the BCR/ABL1 fusion gene, which is a constitutively activated tyrosine kinase. /// "BCR/ABL1 formation resulted from a direct insertion (one step mechanism) in 6 patients and CML-T1, while in 3 patients the fusion gene originated from a sequence of rearrangements (multiple steps). " /// Here we present FISH mapping data of BCR and ABL1 flanking regions and associated chromosomal rearrangements in 9 Ph negative BCR/ABL1 positive CML patients plus the cell line CML-T1. /// "Around 1% of CML patients appear to have a Ph negative karyotype but carry a cryptic BCR/ABL1 fusion that can be located by fluorescence in situ hybridisation (FISH) at chromosome 22q11, 9q34 or a third chromosome. " /// "BCR/ABL1 was located at 9q34 in 3 patients, 22q11 in 5 patients and CML-T1 and 22p11 in 1 patient. " /// FISH mapping of Philadelphia negative BCR/ABL1 positive CML.. /// Future studies should be performed to confirm the presence of true breakpoint hot spots and assess their implications in Ph negative BCR/ABL1 positive CML..
BCR_ABL1t(9;22) / t(9;22) / 21431633chronic myeloid leukemia;myeloid leukemia;leukemia FISH - This rearrangement generates the BCR-ABL1 fusion gene that characterizes leukemic cells in all CML cases. /// "Because new frontline therapies such as imatinib specifically target the abnormal protein product of the BCR-ABL1 fusion gene to eliminate BCR-ABL1 positive cells, there is a new reliance on the cytogenetic evaluation of bone marrow cells at diagnosis, then at regular posttreatment intervals. " /// "In about 90% of cases, the BCR-ABL1 rearrangement is manifest cytogenetically by the Philadelphia (Ph) chromosome, a derivative of the reciprocal translocation t(9;22)(q34;q11.2). "
BCR_ABL1- 9648560acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - We report cytogenetic, fluorescence in situ hybridization (FISH), and molecular analysis in a case of Ph-negative chronic myelogenous leukemia patient with ABL/BCR fusion gene on chromosome 9 and a disparate FISH signal pattern using two commercially available bcr/abl probes (Vysis, Inc. /// The ABL/BCR fusion gene on chromosome 9 in Ph-negative chronic myelogenous leukemia: a case for vigilance in fluorescence in situ hybridization interpretation.. /// "Subsequently, a FISH study with the Oncor major (M)-bcr/abl translocation probe confirmed the ABL/BCR fusion signal on chromosome 9 in addition to an ABL signal and a BCR signal located on chromosomes 9 and 22, respectively. " /// "However, examination of metaphases revealed the ABL/BCR fusion signal on one of the chromosomes 9, an ABL signal on the other chromosome 9, and two BCR signals of different sizes on each of the chromosomes 22. "
BCR_ABL1t(7;17)(p15;q23) / t(7;17)(q32-34;q23) / 12649177chronic myeloid leukemia;myeloid leukemia;leukemia FISH - The pathogenetic role of the P210 BCR/ABL1 fusion gene in the chronic phase of chronic myeloid leukemia (CML) has been well established.In contrast, the genetic mechanisms underlying the disease progression into the accelerated phase (AP) and the final blast crisis (BC) remain poorly understood.
BCR_ABL1t(9;16;22) / 14623460leukemia FISH - it involved the insertion of the 3' ABL into BCR on an apparently normal chromosome 22, resulting in the BCR-ABL fusion gene.
BCR_ABL1- 26045902acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - Karyotyping was used to detect Philadelphia chromosome (Ph), and fluorescence in situ hybridization (FISH) and reverse transcription-polymerase chain reaction (RT-PCR) were used to detect BCR-ABL1 fusion gene. /// "Overall, 26/43 (60.5%) B-ALL patients were positive for BCR-ABL1 fusion gene expression, and all Ph positive cases (17/43. " /// "CD66c was expressed at significantly higher levels in BCR-ABL1 positive than negative patients (24/26, 92.3% vs. " /// BCR-ABL1 and CD66c exhibit high concordance in minimal residual disease detection of adult B-acute lymphoblastic leukemia.. /// 39.5%) expressed BCR-ABL1 and CD66c. /// "When BCR-ABL1 was set as the gold standard for the presence or absence of MRD after treatment, both CD66c alone and the MRD panel including CD66c demonstrated high diagnostic performance for the detection of MRD, with values of area under the receptor operation curve (ROC) of 0.881 vs. " /// Patients with both CD66c expression and BCR-ABL1 were further assessed for MRD during treatment.
BCR_ABL1t(9;14)(q34;q32) / 20073070T ALL FISH - These are the NUP214-ABL1 fusion gene, on amplified episomes, the unique case of EML1-ABL1 fusion due to a cryptic t(9;14)(q34;q32) and the seldom reported BCR-ABL1 and ETV6-ABL1 chimeric genes.
BCR_ABL1del(22q) / 9666799leukemia FISH - FISH analysis of the del(22q) carrying cases with BCR- and ABL-specific DNA probes additionally exhibited a BCR-ABL fusion in 5.2 to 9% of cells in unstimulated blood.
BCR_ABL1- 12783977- FISH - The submicroscopic deletion of the ABL-BCR fusion gene on the derivative chromosome 9 in these cases was subsequently characterised by metaphase FISH on relocated G banded metaphases.
BCR_ABL1t(12;21)(p13;q22) / t(9;22)(q34;q11) / 24816234acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - Primary established genetic abnormalities in B-cell precursor acute lymphoblastic leukemia include high hyperdiploidy (51-65 chromosomes), the translocations t(12;21)(p13;q22)/ETV6-RUNX1 fusion and t(9;22)(q34;q11)/BCR-ABL1 fusion, MLL rearrangements and intrachromosomal amplification of chromosome 21.
BCR_ABL1t(9;22) / 11801308acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - A case of Philadelphia (Ph)-positive acute lymphoblastic leukemia (ALL) with multiple subclones including duplication of the BCR-ABL1 fusion gene and of the Abelson oncogene (ABL1) is reported. /// "In one subclone the normal 9 was lost and replaced by an acrocentric marker, which contained an additional copy of the BCR-ABL1 fusion gene. " /// "Reverse transcriptase polymerase chain reaction detected the fusion transcripts p210 (e13a2 junction) and p190 (e1a2 junction), whereas fluorescence in situ hybridization showed the major BCR-ABL1 junction in both Ph chromosomes, strongly suggesting that the presence of the p210 and p190 proteins in this case was due to mechanisms of alternative or mis-splicing at the transcriptional level. "
BCR_ABL1t(12;21) / p13.3;q22 / t(9;22) / 26514535acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - The highest observed numerical chromosomal alteration was high hyperdiploidy (12.9%) with abnormal karyotypes while abnormal 12p (7.5%) was the highest observed structural abnormality followed by t(12;21)(p13.3;q22) resulting in ETV6/RUNX1 fusion (5.4%) and t(9;22)(q34.1;q11.2) resulting in BCR/ABL1 fusion (4.3%).
BCR_ABL1- 11904740acute myeloid leukemia;acute lymphoblastic leukemia;chronic myeloid leukemia FISH - The BCR/ABL1 fusion gene is mainly caused by the t(9. /// "We performed fluorescent in situ hybridization (FISH) with the recently developed BCR/ABL1 D-FISH probe (QBIOgene, Illkirch, F) on cultured bone marrow and peripheral blood cells of 71 patients with CML, ALL, AML, and myeloproliferative disorder (MPD). " /// "We conclude that D-FISH reliably detects standard Ph chromosomes as well as its variant translocations and accurately quantifies BCR/ABL1 rearrangements prior and during cancer treatment as well as in the phase of remission, in daily routine tumor cytogenetic diagnostics.. " /// High reliability and sensitivity of the BCR/ABL1 D-FISH test for the detection of BCR/ABL rearrangements.. /// "Therefore, molecular cytogenetic methods turned out to be useful tools for the detection of BCR/ABL1 rearrangements. " /// The BCR/ABL1 rearrangement is an important tumor classification marker and a useful prognostic factor allowing an adequate therapy management. /// "Based on the analyses of >200 nuclei per patient, D-FISH correlated closely with CC and allowed an accurate quantification of BCR/ABL1 rearrangements even in a low percentage of aberrant cells. " /// "Furthermore, BCR/ABL1 rearrangements may be hidden due to cryptic rearrangements or complex aberrations. " /// "Furthermore, the D-FISH probe detected three cryptic and one complex BCR/ABL1 rearrangement, which were not visible by CC. "
BCR_ABL1- 12730117chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Poor outcome cannot be attributed to loss of the reciprocal ABL-BCR fusion gene expression alone, and is likely to reflect loss of one or more critical genes within the deleted region.
BCR_ABL1inv(16) / t(9;22) / del(7)(q22q32) / inv(16) / t(9;22;19) / t(9;22;19) / 20513535acute myeloid leukemia;myeloid leukemia;leukemia FISH - Acute myeloid leukemia with inv(16) with CBFB-MYH11, 3'CBFB deletion, variant t(9;22) with BCR-ABL1, and del(7)(q22q32) in a pediatric patient: case report and literature review..
BCR_ABL1t(9;22) / p24;q11.2 / 16001431chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Chronic myeloid leukemia (CML) is characterized by the presence of a t(9;22)(q34;q11.2), which leads to the well-known BCR-ABL1 fusion protein.
BCR_ABL1- 24779036chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Involvement of primary mesenchymal precursors and hematopoietic bone marrow cells from chronic myeloid leukemia patients by BCR-ABL1 fusion gene.. /// "Here, we have investigated by interphase fluorescence in situ hybridization (iFISH) the distribution of BCR-ABL1 fusion gene in FACS-sorted bone marrow (BM) populations of mesenchymal precursor cells (MPC) and other hematopoietic cell populations from 18 newly diagnosed CML patients. " /// "In summary, here we confirm the presence at diagnosis of the BCR-ABL1 fusion gene inMPC, CD341 precursors, and other different BM hematopoietic myeloid cell lineages from CML patients,including also in a significant fraction of cases, a smaller percentage of T, B, and NK lymphocytes.Interestingly, involvement of MPC was restricted to the ancestral BCR-ABL11 subclone.. " /// "However, it remains to be determined whether BCR-ABL1 gene rearrangement occurs in a HPC or at an earlier stem cell and whether the degree of involvement of hematopoiesis by the BCR-ABL1 fusion gene relates to the response to therapy. "
BCR_ABL1t(9;22)(q34;q11) / t(9;22) / 12759926hematologic malignancy FISH - Chronic myeloid leukemia (CML) is a biphasic hematopoietic malignancy associated with a single cytogenetic aberration, the Philadelphia translocation t(9;22)(q34;q11), resulting in the BCR-ABL1 fusion oncogene. /// Amplifications of BCR-ABL1 were also detected and quantified in four CML cell lines by use of MAPH probes specific for ABL1 exon 11 and BCR exon 1.
BCR_ABL1- 19589926myeloid leukemia;acute lymphoblastic leukemia FISH - The BCR-ABL1 fusion gene defines the subgroup of acute lymphoblastic leukemia (ALL) with the worst clinical prognosis.
BCR_ABL1- 19544476myeloproliferative disorder;chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Chronic myeloid leukemia (CML) is a myeloproliferative disorder characterized by a triphasic clinical course, the morphologic expansion of a terminally differentiated myeloid cell and the presence of the BCR-ABL1 fusion gene, the hallmark of CML. /// "Conventional cytogenetic, fluorescence in situ hybridization, and molecular testing for the BCR-ABL1 fusion gene are key investigations for the diagnosis and monitoring of CML. " /// "The fusion gene is usually, but not always, associated with a Philadelphia chromosome, the result of a reciprocal exchange of genetic material between chromosome 22 and chromosome 9, which leads to the production of the activated BCR-ABL1 gene and oncoprotein. " /// Technical aspects and clinical applications of measuring BCR-ABL1 transcripts number in chronic myeloid leukemia..
BCR_ABL1- 26146560- FISH;PCR - Mutations of the BCR-ABL1 fusion gene represent a well established cause of resistance to tyrosine kinase inhibitors.
BCR_ABL1- 20417871chronic myeloid leukemia;myeloid leukemia;leukemia FISH - It is speculated that the amplification of the BCR/ABL1 fusion gene by duplication of Ph and tetraploidy led to the progression of CML with the e19a2 transcript.. /// "Nine months after starting imatinib, fluorescence in situ hybridization (FISH) with the BCR/ABL-ES fusion probe revealed 96% and 3% of bone marrow cells with one and two BCR/ABL1 fusion signals, respectively. " /// FISH analysis confirmed the presence of cells with two to five BCR/ABL1 fusion signals.
BCR_ABL1t(9;22)(q34;q11) / t(12;21)(p13;q22) / t(11q23) / t(9;22) / t(12;21) / 19875970acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR - Chromosomal abnormalities, such as t(9;22)(q34;q11) (ABL/BCR), t(12;21)(p13;q22) (TEL/AML1), and t(11q23) (MLL) are independent prognostic indicators in childhood acute lymphoblastic leukemia resulting in risk adapted therapy.
BCR_ABL1- 18417213chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Using targeted sequential fluorescence in situ hybridization (T-FISH) technique, we detected two copies of BCR-ABL1 fusion gene in the leukemic blasts while the neutrophils carried a single copy of BCR-ABL1 fusion gene, thereby proving the origin of the megakaryoblastic leukemia from a previously undiagnosed CML clone. /// "We describe such a patient with no prior hematologic disease who presented with acute megakaryoblastic leukemia and extramedullary involvement, in whom the leukemic cells carried the BCR-ABL1 translocation as part of a complex karyotype. "
BCR_ABL1t(9;22)(q34;q11) / t(4;11)(q21;q23) / t(12;21)(p13;q22) / 20701601- FISH - The abnormalities with the most significant impact for treatment and management of BCP-ALL are t(9;22)(q34;q11)/BCR-ABL1, t(4;11)(q21;q23)/MLL-AFF1 and near-haploidy/low hypodiploidy for high risk stratification and, to a lesser extent, t(12;21)(p13;q22)/ETV6-RUNX1 and high hyperdiploidy for good risk management.
BCR_ABL1t(4;22) / 15034867myeloproliferative disorder;chronic myeloid leukemia;myeloid leukemia;leukemia;B cell lymphoma;lymphoma FISH;PCR - Initial cytogenetic evaluation by interphase FISH for BCR-ABL, to rule out a translocation 9;22, showed a variant signal pattern consistent with rearrangement of BCR at 22q11.2, but not ABL at 9q34.
BCR_ABL1- 26819793leukemia FISH - Fluorescence in situ hybridization (FISH) of vitreous fluid detected BCR-ABL1 gene rearrangement.
BCR_ABL1del(20q) / del(20)(q11.2) / 23130347acute myeloid leukemia;myeloid leukemia;leukemia FISH - Using FISH, other rearrangements such as BCR/ABL1, RUNX1/RUNX1T1, PML/RARA, CBFB/MYH11, and MLL were found to be negative.
BCR_ABL1- 16284673- FISH - The incidence of both typical and atypical BCR/ ABL gene rearrangements was determined in 110 patients suspected of CML using dual fusion fluorescence in situ hybridisation (DF-FISH) probes.
BCR_ABL1t(9;22) / 26030620chronic myeloid leukemia FISH - At six-month follow-up, a repeat karyotype was again normal, though FISH analysis was positive for BCR/ABL1 fusion. /// "We present a case of a cryptic BCR/ABL1 fusion, which was not originally detected by standard karyotyping. "
BCR_ABL1t(9;22) / t(15;17) / t(15;17) / 11750052chronic myeloid leukemia;acute promyelocytic leukemia;myeloid leukemia;leukemia FISH - The efficiency of technique in molecular diagnosis was also proved in one of the CML patients who progressed to myeloid blastic phase where interphase FISH could identify an extra BCR-ABL fusion on both chromosomes 9 indicating insertion of BCR into ABL and its duplication..
BCR_ABL1t(9;22) / 22137489hematologic malignancy FISH - Of special note, fluorescence in situ hybridization (FISH) analysis for this constitutional translocation (9;22)(q34;q11.2) using standard probes for BCR and ABL1 resulted in an abnormal pattern that was potentially misinterpretable as a BCR-ABL1 fusion.
BCR_ABL1- 21549623acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - We performed a comprehensive study using FISH, G-banding and IHC to identify PAX5 deletion and expression in 102 CD19+ clinical B-ALL cases (79 children and 33 adults) and investigated its relationship with common cytogenetic changes including BCR-ABL1, ETV6-RUNX1 and MLL rearrangements, and CDKN2A deletion. /// The incidence of PAX5 deletion was higher than those of BCR-ABL1 (8.9%) or MLL rearrangements (5.1%) in children and than that of MLL rearrangement (3.1%) in adults.
BCR_ABL1t(11;19) / t(9;22)(q34;q11) / 15066325chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Fluorescence in situ hybridization (FISH) analysis showed that fusion signals of the ABL/BCR probes were found in 95% of blastic cells.
BCR_ABL1t(1;9)(q11;q34) / 19667417chronic myeloid leukemia;multiple myeloma FISH - In addition, the BCR/ABL fluorescent in situ hybridization (FISH) pattern of the interphase cells was interpreted as: "nuc ish(ABL, BCR) x 2[292/300]," consistent with the normal signal patterns found in 97% of the nuclei examined.
BCR_ABL1- 26449660acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - To characterize the subset of ALL with normal karyotype or failed CBA, we performed fluorescence in situ hybridization (FISH) or PCR for BCR-ABL1 and MLL rearrangements as well as array comparative genomic hybridization (aCGH) in 186 adult patients.
BCR_ABL1- 19583844- FISH - BCR-ABL1 dual colour, dual fusion FISH (D-FISH) was performed on diagnostic samples of 22 CML patients. /// "Application of tri-colour, dual fusion fluorescence in situ hybridization (FISH) system for the characterization of BCR-ABL1 fusion in chronic myelogenous leukaemia (CML) and residual disease monitoring.. " /// We studied the application of the BCR-ABL1 + 9q34 tri-colour dual fusion fluorescence in situ hybridization (FISH) system in the characterization of fusion signal pattern and the monitoring of residual disease in chronic myelogenous leukaemia (CML). /// group 4 (n = 2) with 1G1O1F indicating reciprocal ABL1-BCR deletion. /// The added aqua-labelled ASS1 probe was useful in differentiating random signal overlap from genuine BCR-ABL1 fusion in the interphase cells (group 4).
BCR_ABL1t(9;22) / t(9;22) / 22421568chronic myeloid leukemia;myeloid leukemia;leukemia FISH - It is the BCR/ABL protein that drives the neoplasm and the ABL/BCR is not necessary for the disease.
BCR_ABL1- 20417861hematologic malignancy FISH - To identify new genetic aberrations underlying these diseases, we used denaturing high performance liquid chromatography and fluorescence in situ hybridization (FISH) to analyze 17 genes from two receptor-TK families (III and IV) and from three cytoplasmic-TK families (Syk, Abl, and Jak) on samples from 44 BCR/ABL1-negative and JAK2(V617F)-negative CMPN patients with different clinical phenotypes. /// A new potential oncogenic mutation in the FERM domain of JAK2 in BCR/ABL1-negative and V617F-negative chronic myeloproliferative neoplasms revealed by a comprehensive screening of 17 tyrosine kinase coding genes.. /// BCR/ABL1-negative chronic myeloproliferative neoplasms (CMPNs) are a heterogeneous group of clonal hematological malignancies.
BCR_ABL1- 21120205hematologic malignancy;hematologic malignancy FISH - Interphase FISH was performed using the following probes: BCR/ABL1, AML1/ETO, PML/RARA, CBFB, MLL, EGR1, CEP8, and D7S486 for AML. /// "BCR/ABL1, MLL, CDKN2A (p16), ETV6, and 6q21/c-myc for ALL. "
BCR_ABL1- 21654069chronic myeloid leukemia;myeloid leukemia;leukemia FISH - ABL/BCR gene variant with two-step mechanism: Unusual localization and rare/novel chromosomal rearrangements in CML patients..
BCR_ABL1t(1;21)(p36;q22) / 1p36.32 / 1p36.12 / 18767145myeloproliferative disorder;chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Chronic myeloid leukemia (CML) is a myeloproliferative disorder characterized by the presence in leukemic stem cells of the Philadelphia chromosome (Ph) and the formation of the BCR-ABL1 fusion.
BCR_ABL1- 23190578acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - Eight common translocations and rearrangements, including ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, ETV6, TCF3, MLL, IGH@, and PAX5, were tested for using dual-color DNA probes. /// Two patients with BCR-ABL1 (6.3%) and one with TCF3-PBX1 (3.1%) translocations were also observed. /// "Cytogenetics analysis showed a single case each of BCR-ABL1 fusion, MLL, and IGH@ rearrangements (3.1% each). "
BCR_ABL1- 10748292- FISH - The expected pattern for this probe is one green ABL signal (1G) on the normal 9, one red BCR signal (1R) on the normal 22, and two fusion signals, BCR/ABL and ABL/BCR (2F), on a derivative 22 and a derivative 9, respectively.
BCR_ABL1- 19837272chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Real-time-polymerase chain reaction studies on peripheral blood showed b3a2(p210) and e1a2(p190) BCR/ABL1 fusion transcripts. /// We report a case of chronic myeloid leukemia in chronic stage with 48 chromosomes and four BCR/ABL1 fusion signals on two out of three chromosomes 9 and two signals on the two Philadelphia chromosomes. /// "Cytogenetic, fluorescence in situ hybridization, and molecular characterization of chronic myeloid leukemia in chronic phase with four BCR/ABL1 fusion signals: a case report.. "
BCR_ABL1- 12522555ewing sarcoma;sarcoma FISH - Comparing results obtained for the EWSR1/FLI1 and ABL1/BCR genes in samples of patients suffering from Ewing sarcoma or chronic myelogenous leukaemia, it can be concluded that the mean positions of the fusion genes are determined by the final structure of the chimeric chromosomes and do not depend on the location of the translocation event..
BCR_ABL1- 15723338myeloproliferative disorder FISH;PCR;RT-PCR - Of the 14 patients who showed an ABL gene deletion by ES-FISH, 5 had an ABL deletion only, 5 had both a BCR and an ABL deletion, but 4 proved to have a classic BCR/ABL rearrangement without a submicroscopic deletion, as determined by D-FISH.
BCR_ABL1- 26636412chronic myeloid leukemia;myeloid leukemia;leukemia FISH;PCR - However, FISH with BCR-ABL1 dual fusion probes gave a positive signal in 152/200 analyzed nuclei, with the fusion signal detected on the long arm of a cytogenetically normal chromosome 9. /// "However, after 6 months of imatinib therapy, she had to be considered as warning (Ph+ 26.5%, BCR-ABL1 >1%) according to the European LeukemiaNet 2013 recommendations. "
BCR_ABL1- 24598655acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR - BCR/ABL1 level was detected by RQ-PCR and FISH assays.
BCR_ABL1- 21381013chronic myeloid leukemia;myeloid leukemia;leukemia FISH;PCR - The current study was conducted to compare simultaneously obtained bone marrow (BM) cytogenetics (CTG), peripheral blood (PB) and BM fluorescence in situ hybridization (FISH), and quantitative real-time polymerase chain reaction (Q-PCR) for BCR-ABL1 in monitoring response to treatment with tyrosine kinase inhibitors and homoharringtonine (HHT) in patients with chronic myeloid leukemia (CML). /// "PB and BM FISH (n = 112 samples) and/or Q-PCR (n = 132 samples) for BCR-ABL1 were simultaneously obtained in 70 patients with Philadelphia chromosome-positive (Ph+) CML in chronic (68%), accelerated (16%), and blast phase (16%) before the initiation of therapy and during the course of treatment with imatinib (IM) (n = 40 patients), dasatinib (n = 20 patients), nilotinib (n = 4 patients), bosutinib (n = 18 patients), or HHT (n = 4 patients) for patients with newly diagnosed (n = 13 patients), IM-sensitive (n = 34 patients), IM-resistant (n = 30 patients), or IM-intolerant (n = 9 patients) disease. "
BCR_ABL1- 11106816lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - Variant intra philadelphia translocation with rearrangement of BCR-ABL and ABL-BCR within the same chromosome in a patient with cALL..
BCR_ABL1- 23098889precursor B cell leukemia FISH - We review the literature where only 2 similar cases with normal karyotype Pre-B ALL and associated FISH BCR/ABL1 numerical abnormalities were found.
BCR_ABL1- 22090723acute myeloid leukemia;chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Chromosomal analysis from GTG-banded metaphases revealed Ph positivity, and fluorescence in situ hybridization (FISH) with BCR/ABL dual color, dual fusion probe showed single fusion on the der(22) chromosome and ABL/BCR fusion was deleted on the der(9) chromosome. /// Deletion of ABL/BCR on der(9) associated with severe basophilia.. /// The deletion (ABL/BCR) on der(9) may be associated with basophilia which may be also indicative of the transformation of CML to acute myeloid leukemia..
BCR_ABL1- 26829724acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - With the eight-probe FISH (using probes for MYC, P16, E2A, CHIC2/D10Z1/D17Z1, TEL/AMLl, MLL, BCR/ABL1, and IGH) and R-banding karyotype analysis, 237 cases of ALL were analyzed. /// "Cytogenetic changes were detected in 135 (56.96%) of all cases, which have involved MYC, P16, E2A, CHIC2/D10Z1/D17Z1, TEL/AMLl, MLL, BCR/ABL1, and IGH polyploidies. "
BCR_ABL1t(9;22) / t(11;19) / t(9;22)(q34;q11) / t(11;19) / t(9;22) / 26030291chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Clinical course was aggressive, and the patient failed to respond to both imatinib and dasatinib despite the absence of resistance-associated mutations in the BCR/ABL1 gene. /// MLL Rearrangment and EVI1 Deletion in BCR/ABL1 Positive Chronic Myeloid Leukemia..
BCR_ABL1- 26637731chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Fluorescence in situ hybridization (FISH) to identify BCR-ABL1 in interphase nuclei and mutational analysis of the BCR-ABL1 kinase domain (KD) are used in certain clinical circumstances. /// " Monitoring treatment responses in chronic myeloid leukemia (CML) is based on complete blood counts (CBCs) to determine hematologic response, karyotyping of bone marrow metaphase cells to delineate cytogenetic response and quantitative reverse transcription polymerase chain reaction (qPCR) to quantify expression of BCR-ABL1 mRNA (molecular response. " /// "Today many laboratories report BCR-ABL1 qPCR results on the international scale (IS), a system based on the conversion of laboratory-specific numerical values to conform to a universal scale. "
BCR_ABL1- 20682391acute myeloid leukemia;myeloid leukemia;myelodysplastic syndrome;leukemia FISH - Cytogenetic and molecular characterization of double inversion 3 associated with a cryptic BCR-ABL1 rearrangement and additional genetic changes..
BCR_ABL1- 9216726chronic myeloid leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - The absence of ABL-BCR gene expression in this and other patients described in the literature with this subtype of Ph-negative CML, does not seem to have an impact on the clinical course of the disease..
BCR_ABL1- 23806810acute myeloid leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - Two patients demonstrated two molecular rearrangements simultaneously, with BCR-ABL1 implicated in both, in addition to RUNX1-MECOM in one patient and PML-RARA in another.
BCR_ABL1- 16434314leukemia FISH - Nevertheless, we detected a ABL/BCR (1b-b4) transcript in the two patients. /// "In CML patients with der(9) deletion, reportedly no ABL/BCR transcript is detected. "
BCR_ABL1t(9;22) / 14697634leukemia FISH - The results show that TD-FISH effectively discriminates between cells with overlapping BCR and ABL signals from cells with true BCR/ABL fusion and improves the ability to quantify minimal residual disease from >23% to >1% of 500 interphase nuclei..
BCR_ABL1- 24053143- FISH - While FISH with commercial BCR-ABL1 probes failed to detect any ABL1 changes, the ETV6 break-apart probe conclusively identified the ETV6-ABL1 fusion thus determining the probe's role as the primary diagnostic FISH test for this chimeric oncogene.
BCR_ABL1- 9087564- FISH - We established two different criteria for BCR-ABL positivity: by criterion A cells were scored as positive when BCR and ABL signals were overlapping or touching and by criterion B cells were positive if they satisfied criterion A or if the signals were separated by up to one signal diameter.
BCR_ABL1- 23996872acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH - We describe a rare presentation of acute lymphoblastic leukemia in a young adult male who at the beginning of the disease lacked the Philadelphia chromosome in bone marrow and blood cells and fluorescence in situ hybridization was negative for the presence of a clone with the BCR-ABL1 rearrangement. /// "Late-appearing Philadelphia chromosome, adolescent ALL, BCR-ABL1, dasarinib.. "
BCR_ABL1- 23210573acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR - JAK2 and IKZF1 mutations were commonly detected in patients with BCR-ABL1 ALL, and HOX overexpression was highly correlated with MLL fusions and SET-NUP214. /// "BCR-ABL1, FUS-ERG, MLL-AF4, ETV6-RUNX1, E2A-PBX1, dupMLL, MLL-AF10, MLL-ENL, SET-NUP214 and SIL-TAL1 were detected in 36 (14.06%), 14 (5.47%), 14 (5.47%), four (1.56%), four (1.56%), five (1.95%), four (1.56%), two (0.78%), two (0.78%) and five patients (1.95%), respectively. "
BCR_ABL1- 12036887chronic myeloid leukemia;myeloid leukemia;leukemia FISH - However, loss of ABL-BCR expression also occurred without an overt deletion, suggesting the existence of other mechanisms by which ABL-BCR transcription can be abolished. /// "First, we demonstrate that all derivative chromosome 9 deletions detected by fluorescence in situ hybridization were associated with an absence of ABL-BCR expression. " /// "Derivative chromosome 9 deletions in chronic myeloid leukemia: poor prognosis is not associated with loss of ABL-BCR expression, elevated BCR-ABL levels, or karyotypic instability.. " /// "Furthermore, analysis of survival in 160 patients demonstrated that loss of ABL-BCR expression, in contrast to deletion status, was not an indicator of poor prognosis. "
BCR_ABL1- 8697423chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Detection of the breakpoint cluster region-ABL fusion in chronic myeloid leukemia with variant Philadelphia chromosome translocations by in situ hybridization..
BCR_ABL1- 26149409chronic myeloid leukemia;myeloid leukemia;leukemia FISH;PCR - BCR-ABL1 e6a2 transcript in chronic myeloid leukemia: biological features and molecular monitoring by droplet digital PCR.. /// The BCR-ABL1 fusion on the Philadelphia (Ph) chromosome is a hallmark of chronic myeloid leukemia (CML). /// "More than 95 % of BCR-ABL1 transcripts in CML are either e13a2 or e14a2 (major breakpoint cluster region or M-bcr), whereas rare BCR-ABL1 transcripts are occasionally observed, accounting for less than 1 % of CML cases. "
BCR_ABL1- 15654903chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Clinical correlates of submicroscopic deletions involving the ABL-BCR translocation region in chronic myeloid leukemia..
BCR_ABL1- 26111048chronic myeloid leukemia;myeloid leukemia;leukemia FISH;PCR - Flow Cytometric Immunobead Assay for Detection of BCR-ABL1 Fusion Proteins in Chronic Myleoid Leukemia: Comparison with FISH and PCR Techniques.. /// "Currently, measurement of BCR-ABL1 mRNA transcript levels by real-time quantitative PCR (RQ-PCR) defines critical response endpoints. " /// The resulting BCR-ABL1 oncogene leads to increased proliferation and survival of leukemic cells. /// "Here we describe a flow-cytometry assay that detects the presence of BCR-ABL1 fusion proteins in CML lysates to determine the applicability, reliability, and specificity of this method for both diagnosis and monitoring of CML patients for initial response to therapy. " /// An antibody-based technique for BCR-ABL1 protein recognition could be an attractive alternative to RQ-PCR.
BCR_ABL1- 7786793- FISH;PCR;RT-PCR - Fluorescence in situ hybridization was labelled cosmid probes for BCR and ABL showed the presence of BCR-ABL juxtaposition on a normal chromosome 22 in leukaemia cell metaphases.
BCR_ABL1- 8127150- FISH;PCR - By PCR all had evidence of BCR-ABL transcripts, but none had evidence of the reciprocal ABL-BCR gene product that is seen in 70% of the Ph-positive CML patients. /// We used fluorescence in situ hybridization (FISH) to metaphase chromosomes with BCR and ABL cosmid probes in conjunction with the polymerase chain reaction (PCR) to study the mechanism by which the ABL proto-oncogene is inserted into a morphologically normal chromosome 22 in patients with Ph-negative chronic myeloid leukaemia characterized by the BCR-ABL chimeric gene.
BCR_ABL1- 23171811acute myeloid leukemia;acute lymphoblastic leukemia;myeloid leukemia; FISH;PCR;RT-PCR - The ETV6/ABL1 fusion was also confirmed by fluorescence in situ hybridization using a mixture of BCR/ABL1 and ETV6/RUNX1 probes. /// The presence of the type A fusion transcript strongly implies ALL manifestation in ETV6/ABL1-positive hematologic malignancies as minor BCR breakpoint in BCR/ABL1-positive ALL..
BCR_ABL1- 16502580chronic myeloid leukemia;myeloid leukemia;leukemia FISH - Using these second-generation probes, it was discovered that a significant proportion of CML cases has a sub-microscopic deletion at the site of the ABL-BCR fusion.
BCR_ABL1- 10688835- FISH - FISH analysis with BCR- and ABL-specific probes in LAMA84R cells revealed the presence of a marker chromosome containing approximately 13 to 14 copies of the BCR/ABL gene.
BCR_ABL1- 26580488- FISH - We used five BCR/ABL1-positive samples, 20 BCR/ABL1-negative samples and two samples with ambiguous results to verify the cutoff calibrated by these two models.
BCR_ABL1- 9694728leukemia FISH - FISH analysis with BCR and ABL probes showed that some of the human cells engrafting after injection of CP cells lacked a BCR-ABL gene and were presumably normal.
BCR_ABL1- 9707920- FISH - The presence of the molecular complex ABL-BCR was also demonstrated in CML.
BCR_ABL1- 10640140chronic myeloid leukemia;myeloid leukemia;leukemia FISH - A multicenter investigation with D-FISH BCR/ABL1 probes..
BCR_ABL1- 23355941chronic myeloid leukemia;myeloid leukemia;leukemia FISH - BCR-ABL dependent mechanisms are most frequently associated with point mutations in tyrosine kinase domain (TKD) of BCR-ABL1 and also with BCR-ABL gene amplification.
BCR_ABL1t(9;22) / 20633771acute lymphoblastic leukemia;chronic myeloid leukemia;myeloid leukemia;lymphoblastic leukemia;leuk PCR;RT-PCR - The BCR-ABL1 fusion gene results from a reciprocal translocation rearrangement, t(9;22)(q34;q11.2), and is a hallmark of chronic myeloid leukemia (CML). /// A unique BCR-ABL1 transcript with the insertion of intronic sequence from BCR and ABL1 genes in a patient with Philadelphia-positive chronic myeloid leukemia: a case study.. /// "This atypical BCR-ABL1 transcript was detected along with a classic e13a2 transcript, using reverse transcription polymerase chain reaction (RT-PCR). " /// "To our knowledge, this is the first report of BCR-ABL1 transcript with breakpoint occurring within both BCR and ABL1 introns and fusion of intronic sequences from both BCR and ABL1 genes.. "
BCR_ABL1t(9;22)(q34;q22) / 21944569acute lymphoblastic leukemia;chronic myeloid leukemia;myeloid leukemia;lymphoblastic leukemia;leuk PCR - The chromosomal translocation t(9;22)(q34;q22), with expression of the BCR-ABL1 fusion gene is the cytogenetic and molecular hallmark of chronic myeloid leukemia (CML) and a subset of acute lymphoblastic leukemia (ALL). /// "Basically two types of BCR-ABL1 chimeric mRNA transcripts have been observed: (1) e13a2/e14a2 transcripts in CML and ALL, resulting from chromosomal breaks in the major breakpoint cluster region (M-bcr) of the BCR gene and (2) e1a2 transcripts in ALL resulting from breaks in the minor breakpoint cluster region (m-bcr) of the BCR gene. "
BCR_ABL1t(9;22) / t(9;22)(q34;q11) / 23642027chronic myeloid leukemia;myeloid leukemia;leukemia - - The t(9;22)(q34;q11) generating the BCR/ABL1 fusion gene represents the cytogenetic hallmark of chronic myeloid leukemia (CML).
BCR_ABL1t(14;18) / t(11;14) / 22450142leukemia - - The authors review the literature concerning monoclonal B-cell lymphocytosis, and the occurrence of chromosomal translocations t(14;18) and t(11;14), NPM-ALK fusion gene, JAK2 V617F mutation, BCR-ABL1 fusion gene, ETV6-RUNX1(TEL-AML1), MLL-AF4 and PML-RARA fusion gene in healthy individuals.
BCR_ABL1t(9;22)(q34;q11) / 8204871acute lymphoid leukemia;chronic myeloid leukemia - - Chronic myeloid leukemias and 5% to 20% of acute lymphoid leukemias are characterized by the Philadelphia chromosome, a reciprocal chromosomal translocation, t(9;22)(q34;q11), generating BCR-ABL and ABL-BCR fusion genes.
BCR_ABL1t(9;22)(q34;q11) / 23521501- - - The BCR/ABL1 fusion gene, usually carried by the Philadelphia chromosome (Ph) resulting from t(9;22)(q34;q11) or variants, is pathognomonic for chronic myeloid leukaemia (CML). /// The latter two losses have been shown to be part of 'hot spot' genome imbalances associated with BCR/ABL1 positive pre-B lymphoid phenotype in CML and Ph(+)ALL. /// We applied Significance Analysis of Microarrays (SAM) to data from the 'hot spot' regions to the Ph(+)AML and a further 40 BCR/ABL1(+) samples looking for differentiating features. /// Does BCR/ABL1 positive acute myeloid leukaemia exist?.
BCR_ABL1t(9;22) / 27040932leukemoid reaction - - Patients with chronic myelogenous leukemia (CML) present typically with an elevated white blood cell count (WBC) and cytogenetic or molecular genetic evidence of t(9;22)/BCR-ABL1 fusion gene. /// "In all patients, t(9;22)(q34;q11.2) was detected by conventional cytogenetics, and BCR-ABL1 fusion was shown, supporting the diagnosis of preleukemic CML (pre-CML). "
BCR_ABL1t(9;22)(q34;q11) / 20082691chronic myeloid leukemia;myeloid leukemia;leukemia - - The hallmark genetic abnormality of CML is a chimeric BCR/ABL1 fusion gene resulting from the Philadelphia chromosome rearrangement t(9;22)(q34;q11). /// "Clinical and laboratory studies indicate that the BCR/ABL1 fusion protein is essential for initiation, maintenance and progression of CML, yet the event(s) driving the transformation from chronic phase to blast phase are poorly understood. "
BCR_ABL1t(9;22) / t(9;22) / 18613965- PCR;RT-PCR - In this paper we identified a patient with a complex 4-way t(3;9;17;22) which, in addition to BCR/ABL1 gene fusion, also resulted in EVI1 rearrangement and overexpression. /// Expression levels of EVI1 and BCR/ABL1 were investigated using real-time quantitative RT-PCR.
BCR_ABL1t(9;22)(q34;q11) / 17696194leukemia - - The expression of the chimeric BCR/ABL1 fusion gene resulting from t(9;22)(q34;q11) in chronic myelogenous leukemia (CML) is necessary for malignant transformation, but not sufficient to maintain disease progression.
BCR_ABL1t(9;22)(q34;q11) / 24724051acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - The t(9;22)(q34;q11) or Philadelphia chromosome creates a BCR-ABL1 fusion gene encoding for a chimeric BCR-ABL1 protein. /// "In parallel, the mechanistic understanding of Ph(+) ALL expanded exponentially through careful mapping of pathways downstream of BCR-ABL1, the discovery of mutations in master regulators of B-cell development such as IKZF1 (Ikaros), PAX5, and early B-cell factor (EBF), the recognition of the complex clonal architecture of Ph(+) ALL, and the delineation of genomic, epigenetic, and signaling abnormalities contributing to relapse and resistance. "
BCR_ABL1p13;q21 / 21962896leukemia PCR - We demonstrate the feasibility of this approach by identifying fusion genes TAF15-ZNF384 (brought about by a (12;17)(p13;q21) translocation) and BCR-ABL1 (produced by a (9:22)(q34;q11.2) translocation) in five leukemia samples.
BCR_ABL1t(9;22) / 11979553chronic myeloid leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - In 2/16 patients, FISH could not exclude an intact ABL1-BCR fusion gene. /// "Thus, most CML patients without ABL1-BCR transcript could be characterized cytogenetically to belong to two major subgroups: a silent ABL1-BCR gene was attributed to a deletion in der(9)t(9;22) in 56% of the investigated patients or to variants of a standard t(9;22) (approximately 31%). " /// "Conversely, none of the 50 patients with an ABL1-BCR transcript exhibited a variant t(9;22) in GTG-banding analysis. " /// " The objective of this study was to characterize the ABL1-BCR fusion gene in 76 BCR-ABL1-positive chronic myeloid leukemia (CML) patients regarding expression as well as genomic status, to assess the frequency of ABL1-BCR gene deletion in these patients, which has been reported to be an adverse prognostic factor in Philadelphia chromosome-positive CML. " /// ABL1-BCR gene status was analyzed by FISH in 16 CML patients with no ABL1-BCR transcript. /// "Thus, genomic aberrations such as deletions or complex genomic rearrangements are the basic and most frequent cause for ABL1-BCR RNA negativity in CML. " /// The heterogeneity of the underlying molecular mechanisms may explain divergent clinical implications described for patients with an ABL1-BCR deletion and those with no ABL1-BCR transcript.. /// Patients were analyzed for ABL1-BCR 1b-b3 and/or 1b-b4 transcription by RT-PCR analysis. /// FISH revealed a partial or total deletion of the ABL1-BCR gene in 9/16 and localized the 5' portion of ABL1 and the 3' portion of BCR at separated loci in 5/16 patients.
BCR_ABL1- 23637631leukemia;breast cancer;lung cancer;melanoma;sarcoma;colon cancer;pancreatic cancer - - Gene fusions, like BCR/ABL1 in chronic myelogenous leukemia, have long been recognized in hematologic and mesenchymal malignancies.
BCR_ABL1t(8;9;22) / 21325259acute lymphoblastic leukemia;chronic myeloid leukemia;myeloid leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - Based on bone marrow morphology, chromosome fluorescent in situ hybridization (FISH), reverse transcriptase-polymerase chain reaction (RT-PCR), and flow cytometrry, this patient was diagnosed with B lymphoblastic leukemia/lymphoma associated with both t(8;9;22) (q21;q34;q11.2) and BCR/ABL1 rearrangement (e1a2 type).
BCR_ABL1- 22847163leukemia;polycythemia vera - - Chronic myeloproliferative neoplasms (MPN) are clonal disorders of hematopoietic stem cells, which fall into distinct categories based on a number of characteristics including the presence of the BCR-ABL1 gene fusion (chronic myelogenous leukemia) or the JAK2(V617F) mutation (polycythemia vera, primary myelofibrosis, and essential thrombocythemia). /// Concomitant BCR-ABL1 translocation and JAK2(V617F) mutation in three patients with myeloproliferative neoplasms.. /// The implications for diagnosis and treatment of patients with concomitant BCR-ABL1 and JAK2(V617F) are discussed as well as how the BCR-ABL1 and JAK2(V617F)-positive clones may be related to one another.. /// "The coexistence of a JAK2(V617F) mutation and BCR-ABL1 is rare, and to our knowledge, less than 25 cases have been reported in the literature. " /// "Our case series examines the clinical, histopathologic, and genetic features of 3 patients with myeloproliferative neoplasms characterized by concomitant BCR-ABL1 and JAK2(V617F). "
BCR_ABL1- 26910070- - - Imatinib mesylate (IM), a competitive inhibitor of BCR/ABL1 tyrosine kinase activity, is the current standard therapy for chronic myeloid leukaemia (CML) which is caused by the BCR/ABL1 gene fusion encoding a constitutively active tyrosine kinase. /// "Usually, IM resistance is due to the presence of BCR-ABL1 mutations but in many cases resistance is far from being completely understood or from being satisfactorily addressed from a therapeutic standpoint. "
BCR_ABL1- 21960589acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - These data show that in childhood Ph(+) ALL, BCR-ABL1 gene fusion can be a prenatal and possibly initiating genetic event. /// "The twin pair concordant for ALL shared identical BCR-ABL1 genomic sequence indicative of monoclonal, in utero origin. " /// Low level BCR-ABL1(+) cells were present in the healthy co-twin but lacked the IKZF1 deletion present in the other twin's leukemic cells. /// " The timing and developmental sequence of events for BCR-ABL1(+) acute lymphoblastic leukemia (ALL), usually associated with IKAROS (IKZF1) deletions, are unknown. " /// "We assessed the status of BCR-ABL1 and IKZF1 genes in 2 pairs of monozygotic twins, one pair concordant, the other discordant for Philadelphia chromosome positive (Ph(+)) ALL. " /// "In the twin pair discordant for ALL, neonatal blood spots from both twins harbored the same clonotypic BCR-ABL1 sequence. " /// Developmental origins and impact of BCR-ABL1 fusion and IKZF1 deletions in monozygotic twins with Ph+ acute lymphoblastic leukemia..
BCR_ABL1t(9;22) / 24666486chronic myeloid leukemia;myeloid leukemia;leukemia FISH;PCR;RT-PCR - Rare and atypical BCR- ABL fusion gene subtypes could be missed by conventional RQ-PCR..
BCR_ABL1- 19592507- - - Not only did a paired-end approach provide a greater dynamic range in comparison with single read based approaches, but it clearly distinguished the high-level "driving" gene fusions, such as BCR-ABL1 and TMPRSS2-ERG, from potential lower level "passenger" gene fusions.
BCR_ABL1t(9;22)(q34;q11) / 1756491leukemia - - Joining of the BCR and ABL genes is an essential feature of the group of human leukemias characterized by the Philadelphia chromosome and there is recent evidence that the human BCR-ABL fusion gene induces leukemia in experimental animals.
BCR_ABL1- 2487142chronic myeloid leukemia;myeloid leukemia;leukemia - - These data support the notion that the unusual genetic recombinations that give rise to BCR/ABL fusion genes in CML involve specific DNA sequences of BCR (and possibly ABL) and additional, recombinogenic sequences, at least some of which are present in loci known to be nonrandomly involved in complex Ph1 translocations..
BCR_ABL1t(9;22)(q34;q11) / t(9;22) / t(10;11)(p13;q14) / 16518848acute myeloid leukemia PCR;RT-PCR - Acute monocytic leukemia with coexpression of minor BCR-ABL1 and PICALM-MLLT10 fusion genes along with overexpression of HOXA9.. /// P190 BCR-ABL1 is found in the remaining two thirds of t(9;22)-positive adult B-ALL cases but only exceptionally in CML. /// RT-PCR enabled identification of PICALM-MLLT10 and BCR-ABL1 e1-a2 fusion transcripts. /// This case fits with and extends a recently proposed multistage AML model in which constitutive activation of tyrosine kinases by mutations (BCR-ABL1) are associated with deregulation of transcription factors central to myeloid differentiation (HOXA9 secondary to PICALM-MLLT10).. /// The main BCR-ABL1 breakpoints result in P190 BCR-ABL1 or P210 BCR-ABL1 fusion proteins.
BCR_ABL1t(9;22;17)(q34;q11;q21) / 26991870acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - An e13a3 BCR-ABL1 fusion transcript in variant t(9;22;17)(q34;q11;q21)-positive adult acute lymphoblastic leukemia..
BCR_ABL1- 8908171myeloproliferative disorder PCR - We have performed the molecular analysis for the detection of the BCR-ABL and ABL-BCR fusion genes in 50 patients with myeloproliferative disorders. /// Six CML patients (46%) showed ABL-BCR amplifications of the Ib-BCR type.
BCR_ABL17p12.1 / 20013897acute myeloid leukemia;acute lymphoblastic leukemia;chronic myeloid leukemia - - 13/27 (48%) patients with the instability had the BCR/ABL1 fusion gene or other oncogene-activating translocation or structural aberrations. /// "These findings suggest that, in ALL leukemogenesis, loss of CDKN2A and other target genes in the instability region is frequently associated with BCR/ABL1 and IKZF1 dysfunction. "
BCR_ABL1t(9;22)(q34;q11) / 11672777leukemia - - Because this translocation is a reciprocal event, it could give rise to a second fusion gene, ABL-BCR, on the derivative 9q+. /// The absence of differences between the patients with and without 3' BCR deletion supports the hypothesis that the hybrid gene ABL-BCR does not have an important role in leukemogenesis in CML cases..
BCR_ABL1t(9;22) / t(1;19) / t(4;11) / t(12;21) / t(12;21) / t(4;11) / 20930648acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia PCR;RT-PCR - Patients with t(12;21)/ETV6-RUNX1 fusion, hyperdiploidy, and t(1;19)/TCF-PBX1 fusion had the most favorable outcomes, whereas those with the t(9;22)/BCR-ABL1 fusion or t(4;11) and other MLL gene rearrangement had poor prognosis (P<0.001 for EFS and OS). /// "In this cohort of Taiwanese children, the relative frequencies of the 4 translocations of B-lineage ALL were 8% with ALL-type t(9;22)/BCR-ABL1, 4% with (1;19)/TCF-PBX1, 2% with t(4;11)/MLL-AF4, and 17.6% with t(12;21)/ETV6-RUNX1. " /// "Multiplex RT-PCR and nested-PCR assays were used to detect ALL-type BCR-ABL1 transcripts of the t(9;22), TCF-PBX1 transcripts of t(1;19), the MLL-AF4 transcripts of t(4;11), and 2 variants of ETV6-RUNX1 of the cryptic t(12;21) in 148 leukemic samples upon diagnosis. " /// "BCR-ABL1, MLL gene rearrangement, and very high-risk group were independent prognostic factors after Cox regression analysis. "
BCR_ABL1t(9;22) / 3422829leukemia - - The Philadelphia chromosome (Ph1) of chronic myelogenous leukemia (CML) contains sequences from chromosome 9, including the ABL protooncogene, that have been translocated to the breakpoint cluster region (bcr) of chromosome 22, giving rise to a bcr-ABL fusion gene, whose product has been implicated in the genesis of CML.
BCR_ABL1t(3;9)(p12;q34) / t(5;9)(q23;q34) / t(3;9) / t(5;9) / 21391972- - - The identification of ALL with rare ABL1 fusion partners is important because the leukaemia may respond to tyrosine kinase inhibitors in the same way as ALL patients with a classical BCR-ABL1 fusion gene..
BCR_ABL1t(9;22) / inv(16) / t(8;21) / 21275954- - - Subclones with the t(9;22)/BCR-ABL1 rearrangement occur in AML and seem to cooperate with distinct genetic alterations.. /// These cases allow some interesting conclusions: The BCR-ABL1 rearrangement apparently can cooperate with the NPM1 mutation similar to other class-I-mutations. /// Four patients had m-BCR (e1a2) BCR-ABL1 transcripts. /// "In rare cases of myeloid malignancies, the BCR-ABL1 fusion was reported to cooperate as class-I-mutation with class-II-mutations, but most cases had to be classified as blast phase of chronic myeloid leukaemia (CML). "
BCR_ABL1t(9;22) / 22248505acute myeloid leukemia;acute lymphoblastic leukemia;chronic myeloid leukemia PCR;RT-PCR - Standard RT-PCR was used to detect expression of the BCR-ABL1 fusion gene. /// Minimal residual disease was monitored by RQ-PCR for the BCR-ABL1/ABL ratio.
BCR_ABL1- 25941032chronic myeloid leukemia;myeloid leukemia;leukemia PCR - Rare patients suffering from myeloid neoplasms share clinical and cytological features indistinguishable from chronic myeloid leukemia (CML) but lack the BCR-ABL1 fusion gene.
BCR_ABL1t(9;22)(q34;q11) / 11550282- - - The Philadelphia translocation, t(9;22)(q34;q11), is the microscopically visible product of recombination between two genes, ABL1 on chromosome 9 and BCR on chromosome 22, and gives rise to a functional hybrid BCR-ABL1 gene with demonstrated leukemogenic properties. /// "For the present study, we carried out a detailed analysis of genomic BCR and ABL1 sequences to identify, classify, and locate interspersed repeat sequences and to relate their distribution to precisely mapped BCR-ABL1 recombination sites. " /// These findings counter the suggestion that occurrence of Alu at BCR-ABL1 recombination sites is likely by chance because of the high density of Alu in these two genes.
BCR_ABL1t(9;22) (q34;q11) / 8417787chronic myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - The ABL-BCR fusion gene is expressed in chronic myeloid leukemia.. /// By reverse transcription/polymerase chain reaction amplification (RT/PCR) we have detected ABL-BCR mRNA in cells from 31 of 44 BCR-ABL positive CML patients and 3 of 5 CML cell lines. /// "In 2 patients, the BCR exon b3 was not present in either the BCR-ABL or the corresponding ABL-BCR transcript, whereas in 5 patients exon b3 was present in both transcripts. " /// "The ABL-BCR transcripts encoded one or, more rarely, both of the two potential junctions, designated ABL-b3 and ABL-b4, which differed in size by 75 bp. " /// "If an ABL-BCR gene product is produced in CML cells, it may be relevant as a mechanism for deregulating the GTPase activating protein (GAP) function of BCR.. " /// ABL-BCR expression consisted of ABL(Ib)-BCR mRNA in 26 patients and of both ABL(Ib)-BCR and ABL(Ia)-BCR mRNA species in 6 patients. /// "Direct sequencing of PCR fragments representing the full-length coding sequence of ABL-BCR cDNAs type Ib-b3, Ia-b3, Ib-b4, and Ia-b4 showed an open reading frame predicted to encode fusion proteins of 370 to 414 amino-acids. " /// " Although the BCR-ABL hybrid gene on chromosome 22q-plays a pivotal role in the pathogenesis of chronic myeloid leukemia (CML), little is known of the reciprocal chimeric gene, ABL-BCR, formed on chromosome 9q+. "
BCR_ABL1t(9;22)(q34;q11) / 26297264chronic myeloid leukemia;myeloid leukemia;leukemia - - The resulting BCR-ABL1 fusion gene, encoding a tyrosine kinase with deregulated activity, has a central role in the pathogenesis of CML. /// "Hence, the critical role of BCR-ABL1 mutation screening for optimal therapeutic management, with the current gold standard technique, conventional sequencing, likely to be replaced soon by ultra-deep sequencing. " /// "Mutations in the BCR-ABL1 kinase domain might arise, however, that confer resistance to 1 or more of the currently available TKIs. " /// "Mutations in genes other than BCR-ABL1 include ASXL1, TET2, RUNX1, DNMT3A, EZH2, and TP53 in chronic phase patients and RUNX1, ASXL1, IKZF1, WT1, TET2, NPM1, IDH1, IDH2, NRAS, KRAS, CBL, TP53, CDKN2A, RB1, and GATA-2 mutations in advanced phase patients. " /// Mutations in the BCR-ABL1 Kinase Domain and Elsewhere in Chronic Myeloid Leukemia..
BCR_ABL1t(9;22) / t(9;22) / 25741382chronic myeloid leukemia;myeloid leukemia;leukemia - - The explanation involved an initial t(9;22) translocation with breakpoints distant from the BCR and ABL1 genes followed by genomic deletions that produced the BCR-ABL1 hybrid gene.
BCR_ABL1t(9;22) / 7p21.1 / 23036696chronic myeloid leukemia;myeloid leukemia;leukemia - - Chronic myeloid leukemia (CML) is characterized by the BCR-ABL1 fusion gene.
BCR_ABL1t(5;9;22)(q13;q34;q11) / 17415872chronic myeloid leukemia;myeloid leukemia;leukemia - - The molecular variant of the fusion gene BCR/ ABL or the rare involvement of chromosome 5 could possibly explain the mild course of the disease..
BCR_ABL1t(6;12)(q12;p13) / 23126027- - - Because overlapping features, morphological findings in bone marrow, BCR-ABL1 fusion gene, V617F JAK2 mutation and cytogenetic abnormalities were analyzed in ten patients diagnosed with MPN,U.
BCR_ABL1- 21435002acute lymphoblastic leukemia;chronic myeloid leukemia;myeloid leukemia;lymphoblastic leukemia;leukemia - - Chromosomal rearrangements involving the ABL1 gene, leading to a BCR-ABL1 fusion gene, have been mainly associated with chronic myeloid leukemia and B-cell acute lymphoblastic leukemia (ALL). /// "Fusion genes that have a break in intron 1 or 2 (BCR-ABL1, ETV6-ABL1, ZMIZ1-ABL1, EML1-ABL1, and NUP214-ABL1) have transforming activity, although NUP214-ABL1 requires amplification to be efficient. "
BCR_ABL1t(9;22) / 8490164acute lymphoblastic leukemia;chronic myeloid leukemia;myeloid leukemia;lymphoblastic leukemia;leukemia - - Expression of the ABL-BCR fusion gene in Philadelphia-positive acute lymphoblastic leukemia.. /// " We have previously shown that the chimeric gene ABL-BCR, formed on the derivative chromosome 9q+ as a result of the t(9;22) translocation, is transcriptionally active in 65% of chronic myeloid leukemia patients. " /// "in two cases, ABL-BCR transcripts with the Ia-e2 junction type were also present. " /// All seven patients with P190 had ABL-BCR transcripts containing a junction between ABL exon Ib and BCR exon 2 (Ib-e2). /// "Of the two P210 ALL patients, one had a Ib-b4 ABL-BCR transcript and the other showed no detectable ABL-BCR expression. " /// "We have now used the same technique, reverse transcription/polymerase chain reaction amplification of ABL-BCR transcripts, to study nine patients with Philadelphia (Ph) chromosome-positive acute lymphoblastic leukemia (ALL). " /// "Although the BCR-ABL gene is probably fundamental in the pathogenesis of the Ph+ leukemias, differential expression of the ABL-BCR gene could contribute to the biologic heterogeneity of the disease.. "
BCR_ABL1- 27212157acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - A high level of MRD was associated with high WBC counts, increased age, BCR-ABL1 fusion gene, MLL rearrangements and adverse karyotypes.
BCR_ABL1- 22992233acute myeloid leukemia;chronic myeloid leukemia;myeloid leukemia;leukemia - - Since the discovery of the BCR-ABL1 fusion gene in chronic myeloid leukemia, many more fusion genes resulting from chromosomal rearrangements have been identified and characterized.
BCR_ABL1t(5;9)(q13;q34) / t(9;22)(q34;q11) / 18525159chronic myeloid leukemia;myeloid leukemia;leukemia - - A Case of ABL-BCR Negative, Philadelphia Positive CML with t(5;9)(q13;q34).. /// Here we report a rare case of a Philadelphia positive CML patient carrying t(5;9)(q13;q34) and deletion of ABL/BCR on der(9) as a separate event..
BCR_ABL1t(9;22)(q34;q11) / t(9;22) / 9376660- - - The reciprocal ABL-BCR gene found in the derivative 9q+ chromosome of the t(9;22) is transcriptionally active in nearly two-thirds of CML patients but has not been shown so far to have a functional role in CML. /// "Exceptional CML cases have been described with BCR breakpoints outside the three defined cluster regions, or with unusual breakpoints in ABL resulting in BCR-ABL transcripts with b2a3 or b3a3 junctions, or with aberrant fusion transcripts containing variable lengths of intronic sequence inserts. "
BCR_ABL1inv(16) / t(9;22) / inv(16) / t(8;10)(p23;q25) / t(8;10) / t(10;16)(p13;q22) / inv(16)(p13q22) / t(10;16) / t(9;22)(q34;q11) / 23054652acute myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - p210 BCR/ABL1 as a secondary change in a patient with acute myelomonocytic leukemia (M4Eo) with inv(16).. /// "To our knowledge, this is the first reported case of de novo AML in which has p210(BCR/ABL1) occurred as a secondary change of inv(16).. " /// CBFB/MYH11 (A type) and BCR/ABL1 (b3a2) fusion transcripts were both detected by real-time quantitative RT-PCR. /// Fluorescence in situ hybridization detected both the CBFB and the BCR/ABL1 rearrangements.
BCR_ABL1del(22)(q11.2) / 19998064chronic myeloid leukemia;myeloid leukemia;leukemia - - Persistence of derivative chromosome 22 after achieving a major molecular response in chronic myeloid leukemia with a cryptic BCR-ABL1 fusion gene.. /// "A detailed chromosome/molecular studies, including serial karyotyping analysis, finally resulted in the karyotyping at the disease onset to be 47,XX,+del(22)(q11.2), with two genetic evens, namely a cryptic BCR-ABL1 transcript on chromosome 9 and derivative chromosome 22 unrelated to BCR-ABL1. " /// We herein report the findings of a 47-year-old Japanese female with chronic myeloid leukemia (CML) with a cryptic BCR-ABL1 transcript on chromosome 9 and a derivative chromosome 22 unrelated to BCR-ABL1.
BCR_ABL1t(1;19) / t(12;21) / t(8;21) / t(8;14) / t(9;22) / t(10;11) / t(15;17) / inv(16) / 15843827hematologic malignancy - - Using cDNA microarrays, we determined the gene expression profiles of 40 cell lines as well as of primary leukemias harboring 11q23/MLL rearrangements, t(1;19)[TCF3/PBX1], t(12;21)[ETV6/RUNX1], t(8;21)[RUNX1/CBFA2T1], t(8;14)[IGH@/MYC], t(8;14)[TRA@/MYC], t(9;22)[BCR/ABL1], t(10;11)[PICALM/MLLT10], t(15;17)[PML/RARA], or inv(16)[CBFB/MYH11].
BCR_ABL1- 20955401non Hodgkin lymphoma;hypereosinophilic syndrome;lymphoma - - Molecular features of 10 pHES patients were analysed at presentation and during their clinical course, including analysis of BCR-ABL1 and FIP1L1/PDGFRA fusion genes, quantitation of WT1 gene copy number and clonality of T-cell receptor (TCR) and immunoglobulin heavy chain (IGH).
BCR_ABL1t(9;22) / 24407376chronic myeloid leukemia;myeloid leukemia;leukemia - - The BCR-ABL1 oncoprotein is the cause of chronic myeloid leukemia and occurs as a consequence of the translocation t(9;22), a well-defined genetic event that results in the formation of the Philadelphia chromosome. /// Genetic events other than BCR-ABL1..
BCR_ABL1p35;q24 / 25899399chronic myeloid leukemia;myeloid leukemia;leukemia - - A novel e8a2 BCR-ABL1 fusion with insertion of MAST2 exon 2 in a four-way translocation t (1;17;9;22) (p35;q24;q44;q11) in a patient with chronic myeloid leukemia..
BCR_ABL1t(9;22;13) / 15160927enchondromatosis;Ollier disease - - Cytogenetic and molecular investigations showed a complex Philadelphia translocation t(9;22;13) (q34;q11.2;q12), with predominance of ela2 BCR/ABL splicing and deletion of reciprocal der(9) ABL/BCR locus, all suggesting poor prognosis.
BCR_ABL1t(9;22) / 23475624acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Philadelphia chromosome-positive acute lymphoblastic leukemia (Ph+ ALL) is characterized by expression of oncogenic fusion product BCR-ABL1, resulting from reciprocal translocation between chromosomes 9 and 22 [t(9;22)(q34;q11.2)].
BCR_ABL1t(9;22) / 23906450acute lymphoblastic leukemia;T ALL;lymphoblastic leukemia;leukemia - - (3) Cox proportion hazard regression model analysis indicated that age of 14-18 years old and BCR- ABL translocation or t(9;22) were independent risk prognostic factor for 5-year EFS.
BCR_ABL1t(9;22) / 25814077myeloproliferative disorder - - This disease is characterised by a reciprocal t(9;22) chromosomal translocation, resulting in the formation of the Philadelphia (Ph) chromosome containing the BCR-ABL1 gene. /// "As such, diagnosis and monitoring of disease involves detection of BCR-ABL1. " /// The cell biology of CML is also centred on BCR-ABL1. /// "The presence of BCR-ABL1 can explain virtually all the cellular features of the leukaemia (enhanced cell growth, inhibition of apoptosis, altered cell adhesion, growth factor independence, impaired genomic surveillance and differentiation). " /// "It is the BCR-ABL1 protein, in particular its constitutively active tyrosine kinase activity, that forges the pathogenesis of CML. "
BCR_ABL1t(9;22) / 12755554leukemia;gastrointestinal stromal tumor - - The Philadelphia chromosome translocation (t(9;22)) results in the molecular juxtaposition of two genes, BCR and ABL, to form an aberrant BCR-ABL gene on chromosome 22.
BCR_ABL1- 21884299acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - The abnormal Ph chromosome, which arises from a translocation creating the BCR-ABL1 fusion gene, is most commonly associated with chronic myelogenous leukemia (CML) and precursor B cell acute lymphoblastic leukemia (B-ALL).
BCR_ABL1- 10576511- PCR;RT-PCR - Except for the lack of expression of normal BCR in m-bcr cell lines and of ABL1a-BCR expression in all cell lines, no consistent correlation of expression or lack of expression of BCR and ABL or of ABL-BCR reciprocal fusion genes could be found with cell lineages and translocation types. /// An ABL-BCR transcript of the 1a splice variant was not detected in any of the cell lines.
BCR_ABL1t(9;22)(q34;q11) / t(9;22) / 22029197chronic myeloid leukemia;myeloid leukemia;leukemia - - The landmark of chronic myeloid leukemia (CML) is the reciprocal translocation t(9;22)(q34;q11), generating the BCR-ABL1 hybrid gene. /// Variant e19a2 BCR-ABL1 fusion transcript in typical chronic myeloid leukemia..
BCR_ABL1t(9;18;22) / p11.3;q11.2 / 22018274- - - Here, we report an unclassifiable MPN case, BCR/ABL1-negative, showing a three-way t(9;18;22)(p23;p11.3;q11.2) translocation, which generates a 5'BCR/3'JAK2 gene by fusing BCR at intron 1 to JAK2 at intron 14 on the derivative chromosome 22.
BCR_ABL1t(9,22)(q34;q11) / / 19470474acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Mutation of genes encoding tyrosine kinases is uncommon in ALL, with the exception of Philadelphia chromosome-positive ALL, where the t(9,22)(q34;q11) translocation encodes the constitutively active BCR-ABL1 tyrosine kinase. /// "The JAK-mutated cases had a gene expression signature similar to BCR-ABL1 pediatric ALL, and they had a poor outcome. "
BCR_ABL1t(9;22)(q34;q11) / 23666688acute myeloid leukemia;acute lymphoblastic leukemia;myeloid leukemia; PCR - The reciprocal translocation between chromosomes 9 and 22 [t(9;22)(q34;q11), Philadelphia chromosome] creates a BCR-ABL1 fusion protein that occurs in approximately 95% of cases of chronic myelogenous leukemia (CML), 15% of cases of adult acute lymphoblastic leukemia, and 5% of adult cases of acute myeloid leukemia. /// "PCR-based methods to identify and quantitate the tumor-specific BCR-ABL1 RNA have been shown to be an ultrasensitive diagnostic, prognostic, and monitoring tool for Philadelphia-positive leukemias. " /// The most common mechanism of resistance in these patients is the development of mutations in the BCR-ABL1 kinase domain (KD) that abrogate binding of imatinib. /// The BCR-ABL1 protein is a constitutively activated tyrosine kinase that induces and maintains the neoplastic phenotype in these leukemias. /// We describe here a method for sequencing the BCR-ABL1 kinase domain in peripheral blood or bone marrow of CML patients.. /// Detection of BCR-ABL1 kinase domain mutations causing imatinib resistance in chronic myelogenous leukemia.. /// "However, a significant minority of patients being treated with imatinib develop resistance to the drug as evidenced by rising BCR-ABL1 levels. " /// "Thus, DNA sequencing of the BCR-ABL1 kinase domain in resistant patients helps identify those who may benefit from a change in TKI agents, or those who should be considered for other therapeutic measures, such as stem cell transplantation. "
BCR_ABL1- 27111338chronic myeloid leukemia;myeloid leukemia;leukemia;polycythemia vera PCR;RT-PCR - V617F mutation in JAK2 was identified by allele-specific PCR method, RT-PCR was used for the detection of BCR/ABL1 fusion gene, and mutations and variations in coding exons and their flanking sequences of LNK gene were examined by PCR-sequencing. /// "Missense mutations of A300V, V402M, and R415H in LNK were found in 8 patients including ET (4 cases, all combined with JAK2-V617F mutation), PV (2 cases, one combined with JAK2-V617F mutation), PMF (one case, combined with JAK2-V617F mutation) and CML (one case, combined with BCR/ABL1 fusion gene). "
BCR_ABL1- 23810242chronic myeloid leukemia;myeloid leukemia;leukemia;hematologic malignancy PCR;RT-PCR - The pathognomonic genetic alteration in chronic myeloid leukemia is the formation of the BCR-ABL1 fusion gene, which produces a constitutively active tyrosine kinase that drives leukemic transformation. /// BCR-ABL1 RT-qPCR for monitoring the molecular response to tyrosine kinase inhibitors in chronic myeloid leukemia.. /// "Real-time quantitative RT-PCR (RT-qPCR, also RQ-PCR) of BCR-ABL1 RNA is a necessary laboratory technique for monitoring the efficacy of tyrosine kinase inhibitor therapy and quantitatively assessing minimal residual disease. " /// The molecular response measured by BCR-ABL1 RT-qPCR assists in identifying suboptimal responses and can help inform the decision to switch to alternative therapies that may be more efficacious (or to pursue more stringent monitoring).
BCR_ABL1- 24460325myeloproliferative disorder;chronic myeloid leukemia;myeloid leukemia;leukemia PCR - Chronic myeloid leukemia (CML) is a myeloproliferative disorder of hematopoietic stem cell scarrying the Philadelphia (Ph) chromosome and an oncogenic BCR-ABL1 fusion gene. /// The tyrosine kinase inhibitor (TKI) of BCR-ABL1 kinase is a treatment of choice for control of CML.
BCR_ABL1- 26306065essential thrombocythemia;polycythemia vera;primary myelofibrosis PCR;RT-PCR - RT-PCR testing was negative for BCR-ABL1 fusion gene in all the patients.
BCR_ABL1t(9;22)(q34;q11) / 16341034idiopathic myelofibrosis - - The archetype of this class of hematological diseases is chronic myeloid leukemia (CML), characterized by the presence of the Philadelphia (Ph) chromosome, the result of t(9;22)(q34;q11), and the associated BCR-ABL1 oncogene.
BCR_ABL1- 21457188chronic myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - Nest reverse transcription polymerase chain reaction (RT-PCR) and real-time quantitative PCR of BCR/ABL1 fusion gene remained positive were performed to determine the purging effects of ZnPcH?-PDT on the mixture of CML cell line K562 cells and normal bone marrow mononuclear cells (MNC) and on the CML cells from the bone marrow of patients with CML who had achieved complete hematology remission but whose BCR/ABL1 fusion genes remained positive. /// PDT could eliminate K562 cells from K562-normal MNC mixture and the residual BCR/ABL1 positive CML cells from the bone marrow of patients with CML.
BCR_ABL1- 25880391- PCR - The evolution of mutations in the BCR-ABL1 fusion gene transcript renders CML patients resistant to tyrosine kinase inhibitor (TKI) based therapy. /// "To detect mutations in the BCR-ABL1 transcript we developed an assay based on the Pacific Biosciences (PacBio) sequencing technology, which allows for single-molecule long-read sequencing of BCR-ABL1 fusion transcript molecules. " /// "cDNA was generated from total RNA and a 1,6?kb fragment encompassing the BCR-ABL1 transcript was amplified using long range PCR. " /// "Moreover, several transcript isoforms of the BCR-ABL1 transcript were identified in two of the CML patients. " /// Clonal distribution of BCR-ABL1 mutations and splice isoforms by single-molecule long-read RNA sequencing.. /// In summary the PacBio sequencing assay can be applied to detect BCR-ABL1 resistance mutations in both diagnostic and follow-up CML patient samples using a simple protocol applicable to routine diagnosis. /// Thus screening for BCR-ABL1 mutations is recommended particularly in patients experiencing poor response to treatment. /// "Notably, the assay was determined to be sufficiently sensitive even in patients harboring a low abundance of BCR-ABL1 levels. " /// Herein we describe a novel approach for the detection and surveillance of BCR-ABL1 mutations in CML patients. /// "Over 10,000 full-length BCR-ABL1 sequences were obtained for all samples studied. "
BCR_ABL1t(9;22)(q34;q11) / t(9;22) / 24491668chronic myeloid leukemia;myeloid leukemia;leukemia;hematologic malignancy - - At the end of the 20th?century, the contribution of molecular biology techniques was crucial by the discovery of the BCR-ABL1 hybrid oncogene derived from the t(9;22), responsible for the translation of an aberrant protein tyrosine kinase. /// This BCR-ABL1 kinase deregulates signaling pathways that control normal cell cycle and survival in primitive hematopoietic cells and is thus responsible for malignant cell accumulation observed in CML.
BCR_ABL1- 19587702acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - PAX5 complete loss seems to be a secondary event and is significantly associated with BCR-ABL1 or TCF3-PBX1 fusion genes and a lower white blood cell count.. /// PAX5 mutations occur frequently in adult B-cell progenitor acute lymphoblastic leukemia and PAX5 haploinsufficiency is associated with BCR-ABL1 and TCF3-PBX1 fusion genes: a GRAALL study..
BCR_ABL1t(9;22) / t(1;19) / t(4;11) / 24781017acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - None of the 106 patients with the t(9;22)/BCR-ABL1, t(1;19)/TCF3-PBX1 or t(4;11)/MLL-AFF1 had relapsed after 2 years from completion of therapy.
BCR_ABL1inv(3) / t(9;22) / t(9;22) / inv(3) / 25027637acute myeloid leukemia;myeloid leukemia;leukemia - - In chronic myelogenous leukemia, BCR-ABL1 positive detection of cytogenetic abnormalities in addition to the t(9;22) is thought to portend a poor prognosis.
BCR_ABL1t(9;22) / 24349524acute lymphoblastic leukemia;chronic myeloid leukemia;myeloid leukemia;lymphoblastic leukemia;leukemia - - Chronic myeloid leukemia (CML) is a cytogenetic disorder resulting from formation of the Philadelphia chromosome (Ph), that is, the t(9;22) chromosomal translocation and the formation of the BCR-ABL1 fusion protein. /// Inhibition of PI3K/mTOR overcomes nilotinib resistance in BCR-ABL1 positive leukemia cells through translational down-regulation of MDM2.. /// "Since there was no mutation in the tyrosine kinase domain of BCR-ABL1 in cell line SUP-B15, the cells were not generally unresponsive to TKI, as evidenced by dephosphorylation of the BCR-ABL1 downstream targets, Crk-like protein (CrkL) and Grb-associated binder-2 (GAB2). " /// These findings highlight MDM2 as a potential therapeutic target to increase TKI-mediated apoptosis and imply that the combination of PI3K/mTOR inhibitor and TKI might form a novel strategy to combat TKI-resistant BCR-ABL1 positive leukemia.
BCR_ABL1t(9;22)(q34;q11) / 23666687acute myeloid leukemia;acute lymphoblastic leukemia;myeloid leukemia; PCR - The reciprocal Philadelphia translocation between chromosomes 9 and 22 [t(9;22)(q34;q11)] creates a BCR-ABL1 fusion protein that occurs in approximately 95% of cases of chronic myelogenous leukemia (CML), 15% of cases of adult acute lymphoblastic leukemia, and 5% of adult cases of acute myeloid leukemia. /// Quantitative BCR-ABL1 RQ-PCR fusion transcript monitoring in chronic myelogenous leukemia.. /// "A consensus goal for TKI treatment is to achieve a major molecular response (MMR), defined as a 3-log (1,000-fold) reduction in BCR-ABL1 transcripts. " /// We describe here a method for quantitating BCR-ABL1 transcripts in peripheral blood or bone marrow of CML patients using real-time quantitative reverse transcription PCR (RQ-PCR).. /// "Thus, quantitative measurement of BCR-ABL1 transcripts in blood and bone marrow both aids in the initial diagnosis of CML and is essential for routine post-therapy minimal residual disease monitoring. " /// The BCR-ABL1 protein is a constitutively activated tyrosine kinase that induces and maintains the neoplastic phenotype in these leukemias. /// PCR-based methods to identify and quantitate the tumor-specific BCR-ABL1 RNA have been shown to be an ultrasensitive diagnostic/prognostic tool for Philadelphia-positive leukemias. /// "Conversely, increasing post-therapy BCR-ABL1 RNA levels convey a significantly increased risk of disease progression. "
BCR_ABL1t(9;22) / 16079118chronic myeloid leukemia;myeloid leukemia;leukemia - - e6a2 BCR/ABL1 fusion with cryptic der(9)t(9;22) deletions in a patient with chronic myeloid leukemia.. /// This is the first report of e6a2 and e1a2 BCR/ABL1 positive chronic myeloid leukemia (CML) with cryptic deletions of the 5'ABL1 and 3'BCR in separate clones which differ in genomic regions of the deleted der(9).
BCR_ABL1t(9;22) / 26185320chronic lymphoblastic leukemia;lymphoblastic leukemia - - In two patients, B-LBL blasts harbored t(9;22)(q34;q11.2)/BCR-ABL1.
BCR_ABL1t(9;22) / t(9;22) / 22118744chronic myeloid leukemia;myeloid leukemia;leukemia - - Chronic myeloid leukemia (CML), characterized by the t(9;22) and BCR/ABL1 fusion, is a disease model for studying the mechanisms of genetic abnormalities in leukemogenesis. /// "However, genomic instabilities that lead to the formation of the BCR/ ABL1 fusion are not fully understood. " /// It is important to understand how various genes that are involved in regulating the signaling pathway and epigenetic deregulation cooperate with the BCR/ABL1 fusion in the initiation and progression of CML..
BCR_ABL1t(9;22) / t(9;22) / 25919613chronic myeloid leukemia;myeloid leukemia;leukemia - - The t(9;22) is a reciprocal translocation which encodes not only for the der22 (Philadelphia chromosome) related BCR/ABL, but also for der9 related ABL/BCR fusion proteins, which can be detected in 65% of patients with chronic myeloid leukemia (CML) and 100% of patients with Ph+ acute lymphatic leukemia (ALL). /// The functional interplay between the t(9;22)-associated fusion proteins BCR/ABL and ABL/BCR in Philadelphia chromosome-positive acute lymphatic leukemia.. /// Taken together our here presented data reveal an important role of p96(ABL/BCR) for the pathogenesis of Ph(+) ALL.. /// Targeting p96(ABL/BCR) by RNAi inhibited growth of Ph(+) ALL cell lines and Ph(+) ALL patient-derived long-term cultures (PD-LTCs). /// ABL/BCRs are oncogenes able to influence the lineage commitment of hematopoietic progenitors. /// "The co-expression of p96(ABL/BCR) enhanced the kinase activity and as a consequence, the transformation potential of p185(BCR/ABL). " /// Co-expression of p96(ABL/BCR) abolished the capacity of p185(BCR/ABL) to induce a CML-like disease and led to the induction of ALL. /// Aim of this study was to further disclose the role of p96(ABL/BCR) for the pathogenesis of Ph(+) ALL.
BCR_ABL1t(9;22)(q34;q11) / 24623619acute lymphoblastic leukemia;T ALL;lymphoblastic leukemia;leukemia - - Patients with CNS3 more often had T-ALL (P?
BCR_ABL1t(8;21) / t(8;21) / del(4q) / t(9;22) / 21504717leukemia - - We conclude that there are rare patients with CML who either present in blast crisis with coexistence of t(9;22) and t(8;21) with or without +8, or progress to blast crisis with acquiring RUNX1-RUNX1T1 in the BCR-ABL1 clone which may or may not be therapy related and represent a later event in a multistep pathogenesis.. /// Treatment with tyrosine kinase inhibitors did not reduce the BCR-ABL1 fusion positive clone.
BCR_ABL1- 25686603renal cancer - - The BCR-ABL1 fusion gene is a driver oncogene in chronic myeloid leukaemia and 30-50% of cases of adult acute lymphoblastic leukaemia. /// "Axitinib potently inhibited BCR-ABL1(T315I), at both biochemical and cellular levels, by binding to the active form of ABL1(T315I) in a mutation-selective binding mode. " /// Axitinib effectively inhibits BCR-ABL1(T315I) with a distinct binding conformation.. /// "The BCR-ABL1 kinase domain gatekeeper mutation Thr315Ile (T315I) confers resistance to all approved ABL1 inhibitors except ponatinib, which has toxicity limitations. "
BCR_ABL1- 24262285leukemia - - Univariate analysis revealed that significant factors associated with not attaining a major molecular response (MMR) were the presence of the minor BCR-ABL1 fusion gene, a low daily dose of TKI, and the emergence of BCR-ABL1 kinase domain mutations conferring resistance to imatinib. /// Molecular analysis of the BCR-ABL1 kinase domain in chronic-phase chronic myelogenous leukemia treated with tyrosine kinase inhibitors in practice: study by the Nagasaki CML Study Group.. /// "Taken together, our results suggest that the search for BCR-ABL1 mutations should be initiated if patients have not achieved MMR following 12 months of TKI treatment. " /// Factors associated with the loss of sustained MMR were a low daily dose of TKI and the emergence of alternatively spliced BCR-ABL1 mRNA with a 35-nucleotide insertion. /// An appropriate trigger for BCR-ABL1 mutation analysis has not yet been established in unselected cohorts of chronic-phase chronic myelogenous leukemia patients.
BCR_ABL1- 23640097chronic myeloid leukemia;myeloid leukemia;leukemia;colorectal cancer;bladder cancer - - This result suggests that BCR/ABL1 fusion gene and KRAS mutations were mutually exclusive. /// The KRAS mutations are absent in BCR/ABL1 positive CML.
BCR_ABL1- 24555839myelodysplastic syndrome;leukemia;hematologic malignancy - - These findings along with absence of a BCR-ABL1 fusion gene and a hemoglobin F level of 3.4% were consistent with the diagnosis of JMML, which was confirmed by subsequent positive granulocyte macrophage-colony stimulating factor hypersensitivity and NRAS mutation studies.
BCR_ABL1- 23037633leukemia - - Disappearance of both the BCR/ABL1 fusion gene and the JAK2V617F mutation with dasatinib therapy in a patient with imatinib-resistant chronic myelogenous leukemia..
BCR_ABL1- 25256906- - - Erythrophagocytosis by blasts in acute myeloid leukaemia harbouring the BCR-ABL1 fusion gene..
BCR_ABL1- 26458312myeloproliferative disorder;chronic myeloid leukemia;myeloid leukemia;leukemia PCR - Chronic myeloid leukemia (CML) is a?myeloproliferative disorder of hematopoietic stem cells carrying Philadelphia (Ph) chromosome and the oncogenic BCR-ABL1 fusion gene.
BCR_ABL1- 21298759leukemia - - Chronic myelogenous leukemia (CML) is caused by the BCR-ABL1 fusion gene that encodes for a constitutively-active tyrosine kinase. /// "Adults and children with CML are typically treated with imatinib mesylate, a BCR-ABL1 tyrosine kinase inhibitor (TKI), or a second-generation TKI. "
BCR_ABL1- 26854094acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia PCR;RT-PCR - This chromosome forms the BCR/ABL1 fusion gene. /// "We observed a rare case of adult Ph-positive (Ph(+)) ALL, in which the BCR/ABL1 fusion transcript was not detected using the ABL1 exon a2 region primer. " /// Adult acute lymphoblastic leukemia with a rare b3a3 type BCR/ABL1 fusion transcript.. /// "If the BCR/ABL1 fusion transcript is undetected with the ABL1 exon a2 region primer in Ph(+) ALL cases, an RT-PCR analysis that can detect the b3a3 type BCR/ABL1 fusion transcript should be considered to improve diagnosis. "
BCR_ABL1- 27175247chronic myeloid leukemia;myeloid leukemia;leukemia - - Although chronic myeloid leukemia (CML) is now defined on the basis of the presence of the BCR-ABL1 fusion gene, which may or may not be the initial genetic event that triggers the inappropriate expansion of the myeloid cell mass, CML, similar to other leukemias, is in fact clinically heterogeneous.
BCR_ABL1- 19605820leukemia - - CML is a myeloproliferative neoplasm arising at the level of a pluripotent stem cell and consistently associated with the BCR-ABL1 fusion gene.
BCR_ABL1- 26773444- - - The presence of the BCR/ABL1 fusion gene in childhood acute lymphoblastic leukaemia (ALL) is a rare finding and has been an adverse prognostic factor associated with a high risk of therapeutic failure. /// The current key components of treatment are intensive polychemotherapy and a BCR/ABL1 kinase domain inhibitor.
BCR_ABL1- 25361367compartment syndrome - - Further testing included the BCR-ABL1 fusion gene located on the Philadelphia chromosome, leading to a diagnosis of chronic myeloid leukemia.
BCR_ABL1- 20607847chronic myeloid leukemia;myeloid leukemia;leukemia - - In patients with chronic myeloid leukemia (CML), resistance against imatinib is associated with mutations in the kinase domain (KD) of the BCR-ABL1 fusion gene and/or with additional chromosomal abnormalities (ACAs) secondary to the Philadelphia chromosome.
BCR_ABL1- 25637689polycythemia vera - - In a group of 27 Mexican mestizo patients with MPNs, we studied seven molecular markers: the BCR/ABL1 fusion gene, the JAK2 V617F mutation, the JAK2 exon 12 mutations, the MPL W515L mutation, the MPL W515K mutation, and the calreticulin (CALR) exon 9 deletion or insertion. /// Patients with the BCR/ABL1 fusion gene were excluded.
BCR_ABL1- 25085003Barrett's esophagus - - We show its ability to increase the inactivation of a stably inserted reporter gene in a chicken cell line that lacks any other AID/APOBEC proteins, and to increase the number of imatinib-resistant clones in a human cellular model for chronic myeloid leukemia through induction of mutations in the BCR-ABL1 fusion gene.
BCR_ABL1- 26309809chronic myeloid leukemia;myeloid leukemia;leukemia - - We reported previously that CML cells expressing the BCR/ABL1 fusion gene, accumulated a high level of reactive oxygen species (ROS) due to deregulated mitochondrial electron transport chain, which in turn led to genomic instability, resulting in imatinib resistance. /// Reactive Oxygen Species and Mitochondrial DNA Damage and Repair in BCR-ABL1 Cells Resistant to Imatinib.. /// "ROS level in cells with primary resistance, which resulted from the T315I mutation in BCR/ABL1, was higher than in cells with acquired resistance. "
BCR_ABL1- 22924699- - - DNA hypermethylation promotes the low expression of pro-apoptotic BCL2L11 associated with BCR-ABL1 fusion gene of chronic myeloid leukaemia..
BCR_ABL1- 25453399lymphoblastic leukemia;leukemia - - Concurrent B-ALL with MPN is uncommon except in the presence of abnormalities of the PDGFRA, PDGFRB, or FGFR1 genes or the BCR-ABL1 fusion gene.
BCR_ABL1- 19860186chronic myeloid leukemia;myeloid leukemia;leukemia - - Nonetheless, many fields of pathogenesis for CML have not been elucidated, such as the mechanisms of blastic crisis, the causes of genetic instability including the inactivation of tumor suppressor genes, and oncogenic signaling pathways downstreams of the BCR-ABL1 fusion gene product. /// " Chronic myeloid leukemia (CML) is a paradigm for neoplasias that are defined by a unique genetic aberration, the BCR-ABL1 fusion gene. "
BCR_ABL1- 22285507acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Our results showed that the BCR-ABL1 fusion gene and the mdr1 gene were 6.1 times and 1.7 times, respectively, as high as that of parental SUP-B15 cell line. /// "Altogether, over-expression of BCR-ABL1 and mdr1 gene were involved in the resistance mechanisms, and up-regulation of the cell signaling pathways of PI3K/AKT/mTOR, RAS/RAF in SUP-B15/RI cell line may be correlated with them. "
BCR_ABL1- 25427017chronic myeloid leukemia;myeloid leukemia;leukemia - - Chronic myeloid leukemia (CML) is a myeloproliferative neoplasm related to the presence of the BCR-ABL1 fusion gene, linked to t (9;22) (q34;q11).
BCR_ABL1- 19843380erythrocytosis - - In a group of 36 Mexican mestizo patients with MPN, we studied five molecular markers: The BCR/ABL1 fusion gene, the JAK2 V617F mutation, the JAK2 exon 12 mutations, the MPL W515L mutation and the MPL W515K mutation. /// Patients with the BCR/ABL1 fusion gene were excluded.
BCR_ABL1- 22506320chronic myeloid leukemia;myeloid leukemia;leukemia - - Chronic myeloid leukemia (CML) originates from a hematopoietic stem cell carrying the Philadelphia (Ph) chromosome and oncogenic BCR-ABL1 fusion gene.
BCR_ABL1- 27132280chronic myeloid leukemia;myeloid leukemia;leukemia - - In 1973, Janet Rowley, unraveled the cytogenetic anatomy of the Philadelphia chromosome, which subsequently led to the identification of the BCR-ABL1 fusion gene and its principal pathogenetic role in the development of chronic myeloid leukemia.
BCR_ABL1- 21883966- - - Disease-specific genetic markers, such as the BCR-ABL1 fusion gene in chronic myeloid leukaemia, enable sensitive molecular genetic methods to be applied for the detection and quantification of low-level residual disease, allowing early identification of relapse.
BCR_ABL1- 25332542myeloproliferative disorder;myelodysplastic syndrome;leukemia - - Chronic neutrophilic leukemia (CNL) is a rare chronic myeloproliferative disorder characterized by splenomegaly, sustained neutrophilic leukocytosis, raised serum vitamin B12 level and absence of the Philadelphia chromosome and BCR/ABL1 fusion gene.
BCR_ABL1- 24697132- - - Increasing frequency of diagnostic BCR-ABL1 fusion gene testing: causes and concerns..
BCR_ABL1- 16645213acute myeloid leukemia;myeloid leukemia;leukemia - - NPM1 gene mutations are the most frequent genetic lesion in the 60% of adult acute myeloid leukemias (AMLs) with normal karyotype and no evidence of typical fusion genes (BCR/ABL1, PML/RARA, AML1/ETO, CBFB/MYH11, DEK/CAN).
BCR_ABL1- 20558931acute kidney injury - - Chronic myelogenous leukemia (CML) is a myeloproliferative disease that originates in abnormal pluripotent bone marrow stem cells and it is consistently associated with the Philadelphia chromosome and/or BCR/ ABL fusion gene.
BCR_ABL1- 10526530chronic myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - In situ hybridization studies with BCR- and ABL-specific probes showed location of the BCR/ABL fusion gene on chromosome 9, band q34, instead of at chromosome 22q11, and that it resulted from an insertion of the 5' side of BCR within the ABL gene on chromosome 9.
BCR_ABL1- 26179066- - - Chronic Myeloid Leukaemia (CML) is caused by the BCR/ABL1 fusion gene. /// "After the oncogenic translocation, the BCR/ABL1 gene is under the transcriptional control of BCR promoter but the molecular mechanisms involved in the regulation of oncogene expression are mostly unknown. " /// BCR and BCR/ABL1 expression levels were analysed in CML cell lines after over-expression or silencing of MYC transcription factor. /// "Here we describe a regulatory pathway modulating BCR and BCR/ABL1 expression, showing that the BCR promoter is under the transcriptional control of the MYC/MAX heterodimer. " /// "In the present study we demonstrate that MYC and its partner MAX bind to the BCR promoter, leading to up-regulation of BCR and BCR/ABL1 at both transcriptional and protein levels. " /// BCR/ABL1 and BCR are under the transcriptional control of the MYC oncogene.. /// "Since MYC is frequently over-expressed in BC, this phenomenon could play a critical role in BCR/ABL1 up-regulation and blast aggressiveness acquired during CML evolution.. " /// "Accordingly, silencing of MYC expression in various BCR/ABL1 positive cell lines causes significant downregulation of BCR and BCR/ABL1, which consequently leads to decreased proliferation and induction of cell death. " /// Both the presence and the levels of BCR/ABL1 expression seem to be critical for CML progression from chronic phase (CP) to blast crisis (BC).
BCR_ABL1t(9;22)(q34;q11) / 20666852acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia PCR;RT-PCR - The t(9;22)(q34;q11) or BCR/ABL1 rearrangement was detected by cytogenetic analysis or RT/PCR. /// "Of these 94 cases, 17 (18%) cases displayed BCR/ABL1 gene rearrangements and 38 (40%) cases were CD66c positive. " /// " In B-cell acute lymphoblastic leukemia (B-ALL), testing at diagnosis for BCR/ABL1 gene rearrangements is mandatory for prognostic stratification and treatment decisions. " /// "Its expression was correlated with BCR/ABL1 rearrangements (P = 0.0001): sensitivity 82%, specificity 69%, positive predictive value 37% and negative predictive value 95%. " /// It would seem better to interpret the absence of CD66c expression with a lack of BCR/ABL1 rearrangement. /// "CD66c expression is correlated, but not specifically, with BCR/ABL1 rearrangement. " /// Some BCR/ABL1(-) B-ALL cases (including hyperdiploid or cases with normal karyotype) were CD66c positive (31%). /// Several diagnostic methods have been proposed using flow cytometry to identify BCR/ABL1(+) B-ALL. /// Co-expression of CD66c(+) CD13(+) was more frequent in BCR/ABL1(+) B-ALL (29%) than BCR/ABL1(-) cases (4%) (P = 0.0044).
BCR_ABL1t(9;22) / 22829126leukemia - - Accurate and standardized methods for the quantitative measurement of BCR-ABL1 are a prerequisite for monitoring of treatment response in t(9;22)-positive leukemia. /// "Here, we describe a novel multiplex assay system based on the proven TaqMan and Armored RNA technologies and optimized for sensitive detection of three BCR-ABL1 fusion transcripts and ABL1 in a single reaction. " /// Direct comparison with a reference laboratory calibrated to the international scale (IS) demonstrated minimal analytical bias between methods and an overall accuracy and precision within the performance range required for quantitative measurement of BCR-ABL1 on the IS. /// Establishment of a standardized multiplex assay with the analytical performance required for quantitative measurement of BCR-ABL1 on the international reporting scale..
BCR_ABL1- 24070327- - - The hallmark of CML (chronic myeloid leukaemia) is the BCR (breakpoint cluster region)-ABL fusion gene.
BCR_ABL1t(9;22) / inv(16) / t(9;22) / inv(16)(p13q22) / 24724063acute myeloid leukemia;myeloid leukemia;leukemia;hematologic malignancy;hematologic malignancy - - This study shows that observations of bone marrow morphology, initial and follow-up cytogenetic studies, and karyotyping of BCR/ABL1 and CBFB/MYH11 provide valuable information for characterizing hematologic malignancies exhibiting t(9;22) and inv(16) coexistence..
BCR_ABL1del(20q) / t(9;22) / del(20q) / 21350093myelodysplastic syndrome;leukemia - - All patients initially had BCR-ABL1 and t(9;22) (q34;q11.2) and achieved morphologic and cytogenetic remission after therapy. /// "BCR-ABL1 fusion transcript levels were absent or low (median, 0.01%). "
BCR_ABL1- 24837466chronic myeloid leukemia;myeloid leukemia;leukemia - - The vast majority of chronic myeloid leukemia patients express a BCR-ABL1 fusion gene mRNA encoding a 210 kDa tyrosine kinase which promotes leukemic transformation. /// "A possible differential impact of the corresponding BCR-ABL1 transcript variants e13a2 (""b2a2"") and e14a2 (""b3a2"") on disease phenotype and outcome is still a subject of debate. " /// "However, clinical outcome under imatinib treatment was comparable and no risk prediction can be made according to e13a2 versus e14a2 BCR-ABL1 transcript type at diagnosis. " /// Distinct characteristics of e13a2 versus e14a2 BCR-ABL1 driven chronic myeloid leukemia under first-line therapy with imatinib..
BCR_ABL1- 25500442chronic myeloid leukemia;myeloid leukemia;leukemia - - The BCR-ABL1 fusion gene is the molecular marker of chronic myeloid leukemia (CML).
BCR_ABL1- 23859904acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Frequency of the ETV6-RUNX1, BCR-ABL1, TCF3-PBX1, and MLL-AFF1 fusion genes in Guatemalan pediatric acute lymphoblastic leukemia patients and their ethnic associations.. /// "This study assesses whether an ethnic influence has an effect on the frequency of any of the four fusion genes: BCR-ABL1, ETV6-RUNX1, TCF3-PBX1, and MLL-AFF1 found in ALL. " /// We found 10 patients who had the BCR-ABL1 fusion gene (7%).
BCR_ABL1- 25389112chronic myeloid leukemia;myeloid leukemia;leukemia - - The decrease of Chibby1 (CBY1) contributes to ? catenin constitutive activation associated with the presence of the BCR-ABL1 fusion gene of chronic myeloid leukemia (CML). /// DNA methyltransferase 1 drives transcriptional down-modulation of ? catenin antagonist Chibby1 associated with the BCR-ABL1 gene of chronic myeloid leukemia..
BCR_ABL1- 26147002chronic myeloid leukemia;myeloid leukemia;leukemia - - The down-modulation of the ?-catenin antagonist Chibby 1 (CBY1) associated with the BCR-ABL1 fusion gene of chronic myeloid leukemia (CML) contributes to the aberrant activation of ?-catenin, particularly in leukemic stem cells (LSC) resistant to tyrosine kinase (TK) inhibitors.
BCR_ABL1- 21382019- - - Molecular testing for the BCR-ABL1 fusion gene by real time quantitative polymerase chain reaction (RT-qPCR) is the most sensitive routine approach for monitoring the response to therapy of patients with chronic myeloid leukaemia. /// Guidelines for the measurement of BCR-ABL1 transcripts in chronic myeloid leukaemia..
BCR_ABL1- 20620598acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - In the 18 ALL cases tested in Sudan, a notable excess of MLL-AF4 (17%) and BCR-ABL1 (22%) fusion genes was found. /// " An international project was conducted to identify the common acute lymphoblastic leukemia (ALL)-specific fusion genes (ETV6-RUNX1,MLL-AF4,TCF3-PBX1, and BCR-ABL1) in developing countries to provide additional prognostic information at diagnosis. "
BCR_ABL1t(9;22) / 19876398chronic myeloid leukemia;myeloid leukemia;leukemia PCR - Reciprocal t(9;22) ABL/BCR fusion proteins: leukemogenic potential and effects on B cell commitment.. /// Our here presented data establish the reciprocal ABL/BCR fusion proteins as second oncogenes encoded by the t(9;22) in addition to BCR/ABL and suggest that ABL/BCR contribute to the determination of the leukemic phenotype through their influence on the lineage commitment.. /// "Interestingly, BCR/ABL gave origin exclusively to a myeloid phenotype independently from the culture conditions whereas p96(ABL/BCR) and to a minor extent p40(ABL/BCR) forced the B-cell commitment of SL-cells and UCBC. " /// The leukemic potential of the ABL/BCR fusion proteins was assessed by in a transduction/transplantation model.
BCR_ABL1t(9;22) / t(1;21)(p36;q22) / t(9;22) / 22036054adenocarcinoma - - Cytogenetic analysis showed a karyotype of 46,XX,dup(1)(q21q32),add(5)(q33),t(9;22)(q34;q11.2)[12]/47,idem,+der(22)t(9;22)[8], and BCR/ABL1 rearrangement was detected.
BCR_ABL1- 17452251chronic myeloid leukemia;myeloid leukemia;leukemia - - The molecular hallmark of CML is the BCR-ABL fusion gene, usually with specific breakpoints within ABL intron 1 and BCR introns b2, b3, and e19.
BCR_ABL1- 20300999leukemia PCR - CML comprises approximately 20% of all leukemias and is characterized by a balanced (9;22) chromosomal translocation that results in the formation of a chimeric gene comprised of the BCR (breakpoint cluster region) gene and the ABL oncogene (BCR-ABL fusion gene).
BCR_ABL1- 26417552myeloproliferative disorder;chronic myeloid leukemia;myeloid leukemia;leukemia - - It is characterized by the presence of Philadelphia chromosome (Ph) with BCR - ABL 1 fusion gene.
BCR_ABL1t(9;22) / t(9;22) / 17090304chronic myeloid leukemia;myeloid leukemia;leukemia - - Our data presented here describe for the first time an analysis of the biological function of the reciprocal t(9;22) ABL/BCR fusion proteins in comparison to their physiological counterpart BCR.. /// "BCR and its mutants, the reciprocal t(9;22)-associated ABL/BCR fusion proteins, differentially regulate the cytoskeleton and cell motility.. " /// "BCR and its mutants, the reciprocal t(9;22)-associated ABL/BCR fusion proteins, differentially regulate the cytoskeleton and cell motility. " /// "Depending on the breakpoint on chromosome 22 (the Philadelphia chromosome--Ph+) the derivative 9+ encodes either the p40(ABL/BCR) fusion transcript, detectable in about 65% patients suffering from chronic myeloid leukemia, or the p96(ABL/BCR) fusion transcript, detectable in 100% of Ph+ acute lymphatic leukemia patients. " /// The ABL/BCRs are N-terminally truncated BCR mutants. /// "We investigated the effects of BCR and ABL/BCRs i.) on the activation status of Rho, Rac and cdc42 in GTPase-activation assays. " /// "Here we show that both ABL/BCRs lost fundamental functional features of BCR regarding the regulation of small Rho-like GTPases with negative consequences on cell motility, in particular on the capacity to adhere to endothelial cells. " /// "We, therefore, compared the function of the ABL/BCR proteins with that of wild-type BCR. "
BCR_ABL1- 22824785chronic myeloid leukemia;myeloid leukemia;leukemia - - However, it has not been established whether SOCS2 is involved in CML, caused by the BCR/ABL1 fusion gene, or important for normal hematopoietic stem cell (HSC) function. /// SOCS2 is dispensable for BCR/ABL1-induced chronic myeloid leukemia-like disease and for normal hematopoietic stem cell function.. /// "Furthermore, by using a retroviral BCR/ABL1-induced mouse model of CML, we demonstrate that SOCS2 is dispensable for the induction and propagation of the disease, suggesting that the SOCS2-mediated feedback regulation of the JAK/STAT pathway is deficient in BCR/ABL1-induced CML.. "
BCR_ABL1- 25501026chronic myeloid leukemia;myeloid leukemia;leukemia - - The BCR-ABL1 fusion gene, encoding a constitutively active tyrosine kinase, is thought to be sufficient to cause chronic phase (CP) CML, whereas additional genetic lesions are needed for progression into CML BC. /// "In primary mice, BCR-ABL1 expression induced an inflammatory-like state in the bone marrow and spleen, and mast cells were the only myeloid lineage specifically expanded by BCR-ABL1. " /// "To generate a humanized CML model, we retrovirally expressed BCR-ABL1 in the cord blood CD34(+) cells and transplanted these into NOD-SCID (non-obese diabetic/severe-combined immunodeficient) interleukin-2-receptor ?-deficient mice. "
BCR_ABL1- 17701954acute lymphoblastic leukemia;chronic myeloid leukemia;myeloid leukemia;lymphoblastic leukemia;leukemia - - The resulting fusion gene, BCR-ABL1, encodes for a chimerical oncoprotein (BCR-ABL) with constitutive tyrosine kinase activity, which leads to uncontrolled cell proliferation, reduced apoptosis, and impaired cell adhesion.
BCR_ABL1- 19135771hematologic malignancy;hematologic malignancy - - The P190 and P210 BCR/ABL1 fusion genes are mainly associated with different types of hematologic malignancies, but it is presently unclear whether they are functionally different following expression in primitive human hematopoietic cells. /// "Our data suggest that the early cellular and transcriptional effects of P190 BCR/ABL1 and P210 BCR/ABL1 expression are very similar when they are expressed in the same human progenitor cell population, and that STAT5 is an important regulator of BCR/ABL1-induced erythroid cell expansion.. " /// Gene expression profiling revealed that P190 BCR/ABL1 and P210 BCR/ABL1 induced almost identical gene expression profiles. /// Expression of P190 and P210 BCR/ABL1 in normal human CD34(+) cells induces similar gene expression profiles and results in a STAT5-dependent expansion of the erythroid lineage.. /// "Under in vitro conditions favoring B-cell differentiation, neither P190 nor P210 BCR/ABL1-expressing cells formed detectable levels of CD19-positive cells. " /// Expression of either P190 BCR/ABL1 or P210 BCR/ABL1 resulted in expansion of erythroid cells and stimulated erythropoietin-independent burst-forming unit-erythroid colony formation. /// "By using a lentiviral anti-signal transducer and activator of transcription 5 (STAT5) short-hairpin RNA, we found that both P190 BCR/ABL1- and P210 BCR/ABL1-induced erythroid cell expansion were STAT5-dependent. " /// "We investigated and systematically compared the effects of retroviral P190 BCR/ABL1 and P210 BCR/ABL1 expression on cell proliferation, differentiation, and global gene expression in human CD34(+) cells from cord blood. "
BCR_ABL1t(9;22) / t(12;21)(p13;q22) / 21822204acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - BCR-ABL1, t(12;21)(p13;q22).
BCR_ABL1t(9;22) / 22372202lymphoblastic leukemia - - Specific subsets of MPAL are defined by chromosomal anomalies such as the t(9;22) Philadelphia chromosome BCR-ABL1 or involvement of the MLL gene on chromosome 11q23.
BCR_ABL1t(9;22)(q34;q11) / 25360156acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - In addition, an abnormal FISH pattern previously described as the deletion of the 3'BCR region in some BCR/ABL1 positive cases was not proved in our patient. /// "A cryptic BCR/ABL1 fusion, which was caused by the insertion of part of the ABL1 gene into the 22q11 region, was proved in HeH clone by FISH, RT-PCR and CGH-SNP array. " /// An unusual case of high hyperdiploid childhood ALL with cryptic BCR/ABL1 rearrangement.. /// "A novel case of extremely rare childhood ALL, characterized by HeH and a cryptic BCR/ABL1 fusion, is presented and to the best of our knowledge described for the first time. " /// Here we report a new case of a 17-year-old girl with newly diagnosed ALL and uncommon cytogenetic and clinical finding combining high hyperdiploidy and a cryptic BCR/ABL1 fusion and an inherited Charcot-Marie-Tooth neuropathy detected during the induction treatment.
BCR_ABL1t(9;22) / 12432215- PCR;RT-PCR - BCR-ABL fusion transcripts lack ABL exon a1 and consist of BCR exons fused directly to ABL exon a2.
BCR_ABL1t(10;22)(q11;q11) / t(6;10)(q27;q11) / 22513837leukemia - - Myeloproliferative neoplasms are frequently associated with aberrant constitutive tyrosine kinase (TK) activity resulting from chimaeric fusion genes or point mutations such as BCR-ABL1 or JAK2 V617F.
BCR_ABL1- 16598834- FISH;PCR;RT-PCR - Commercial FISH probes showed an atypical pattern and the BCR/ABL fusion transcript was detected by RT-PCR, but not the reciprocal ABL/BCR.
BCR_ABL1inv(16) / t(4;11) / t(11;19) / 23091311- PCR - Fifteen fusion transcripts were included: BCR-ABL1, PML-RARA, ZBTB16-RARA, RUNX1-RUNX1T1, CBFB-MYH11, DEK-NUP214, TCF3-PBX1, ETV6-RUNX1, MLL-AFF1, MLL-MLLT4, MLL-MLLT3, MLL-MLLT10, MLL-ELL, MLL-MLLT1, and MLL-MLLT6.
BCR_ABL1- 23986553essential thrombocythemia - - Polycythaemia vera (PV), essential thrombocythemia (ET) and idiopathic myelofibrosis (MF), are the most common myeloproliferative neoplasms (MPN) in patients without the BCR-ABL1 gene rearrangement.
BCR_ABL1t(9;22) / 26799612chronic myeloid leukemia;myeloid leukemia;leukemia - - The molecular consequence of this translocation is the generation of a BCR-ABL1 fusion oncogene, which in turn translates into a BCR-ABL oncoprotein. /// "Although second and third generation TKIs are potent and selective TKIs, they exhibit unique pharmacological profiles and response patterns relative to different patient and disease characteristics, such as patients' comorbidities, disease stage, and BCR-ABL1 mutational status. "
BCR_ABL1- 26252834- - - Molecular characterization and follow-up of five CML patients with new BCR-ABL1 fusion transcripts.. /// We report five chronic myeloid leukaemia (CML) patients in whom we identified and characterized undescribed BCR-ABL1 fusion transcripts.
BCR_ABL1- 25692130acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - The earliest deaths occurred at months 1, 2, and 3 after diagnosis in patients with MLL, ETV6-RUNX1, and BCR-ABL1 gene rearrangements, respectively. /// "The aims of this multicenter study were to determine the prevalence of the four most common gene rearrangements [ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, and MLL rearrangements] and to explore their relationship with mortality rates during the first year of treatment in ALL children from Mexico City. " /// "ETV6-RUNX1 was detected in 21 (7.4%) patients, TCF3-PBX1 in 20 (7.1%) patients, BCR-ABL1 in 5 (1.8%) patients, and MLL rearrangements in 4 (1.4%) patients. "
BCR_ABL1- 16205638lymphoblastic leukemia;leukemia - - Pre-B lymphoblastic leukemia cells carrying a BCR-ABL1 gene rearrangement exhibit an undifferentiated phenotype. /// "Comparing matched leukemia sample pairs from patients before and during therapy with the BCR-ABL1 kinase inhibitor STI571 (Imatinib), inhibition of BCR-ABL1 partially corrected aberrant expression of IK6 and lineage infidelity of the leukemia cells. " /// "As shown by inducible expression of BCR-ABL1 in human and murine B-cell precursor cell lines, BCR-ABL1 induces the expression of a dominant-negative IKAROS splice variant, termed IK6. " /// "Therefore, we propose that BCR-ABL1 induces aberrant splicing of IKAROS, which interferes with lineage identity and differentiation of pre-B lymphoblastic leukemia cells.. " /// BCR-ABL1 induces aberrant splicing of IKAROS and lineage infidelity in pre-B lymphoblastic leukemia cells..
BCR_ABL1t(9;22) / 18406872chronic myeloid leukemia;myeloid leukemia;leukemia - - To date, however, the frequency of such deletions in the subgroup of CML patients in whom the BCR/ABL1 fusion arises via submicroscopic chromosomal insertion (masked Ph) has not been investigated.
BCR_ABL1t(2;8) / inv(4)(p16q25) / t(1;7)(q25;q32) / t(5;6)(q21;q21) / 26648836acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia FISH;PCR;RT-PCR - Since December 2002, RT-PCR determinations were systematically carried out for BCR-ABL1, KMT2A-AFF1, ETV6-RUNX1, and TCF3-PBX1 rearrangements in children, adding KMT2A-MLLT3 and KMT2A-MLLT1 in infants. /// "We compared cytogenetic and RT-PCR results for BCR-ABL1, KMT2A-AFF1 and TCF3-PBX1 rearrangements in 497 children evaluated by both methods. "
BCR_ABL1- 15949566leukemia - - In this study, we report the case of a Philadelphia (Ph) positive chronic myelogenous leukemia (CML) patient with the presence of p190 and p210 BCR-ABL1 mRNA fusion transcripts derived from e1a2 and b3a2 BCR-ABL1 genomic rearrangements, respectively. /// Coexistence of different clonal populations harboring the b3a2 (p210) and e1a2 (p190) BCR-ABL1 fusion transcripts in chronic myelogenous leukemia resistant to imatinib.. /// "The presence of e1a2 BCR-ABL1 genomic rearrangement was seen in 2 different clones, one with the rearrangement and another one with the rearrangement and deletion of the BCR gene of the non-rearranged chromosome 22. " /// Loss of normal BCR in one cell clone may contribute to the resistance to imatinib due to the lack of BCR mediated inhibition of BCR-ABL1..
BCR_ABL1- 24876147chronic myeloid leukemia;myeloid leukemia;leukemia PCR - [Chronic myeloid leukemia with variant e19a2 BCR-ABL1 fusion transcript: interest of the molecular identification at diagnosis for minimal residual disease follow-up].. /// "For rare BCR-ABL1 transcripts, an international standardization, as it is developed for conventional transcripts, is lacking. " /// Disease monitoring was performed by cytogenetic analyses and quantification of the BCR-ABL1 transcript. /// Molecular techniques identified the presence of the rare e19a2 BCR-ABL1 transcript.
BCR_ABL1- 26448695leukemia FISH;PCR;RT-PCR - BCR/ABL1 rearrangement was confirmed by fluorescent in situ hybridization (FISH) analysis. /// The BCR/ABL1 ES probe on interphase cells indicated p190 minor m-BCR/ABL fusion in 46% and a second abnormal clone with double Ph (+) in 16% of the cells analyzed confirmed by reverse transcription-PCR (RT-PCR).
BCR_ABL1t(9;9;22) / 8629106chronic myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - In 8 cases of Ph' negative patients, 4 had BCR 3/ABL II rearrangement, 3 had both rearrangements while 1 had no BCR/ABL rearrangement.
BCR_ABL1t(9;22)(q34;q11) / 1931706- - - It is now known that as a result of the Ph translocation, p160BCR and p145ABL (the normal BCR and ABL gene products) are replaced by p210BCR-ABL.
BCR_ABL1t(9;22) / 12716364- - - Reports of physical separation of ABL-BCR in non-deleted patients, as well as evolution from classical to variant Ph, introduce further heterogeneity to the vPh subgroup and raise the possibility that such translocations may herald disease progression. /// "We assessed the frequency of der(9) deletions, ABL-BCR abrogation, cytogenetic evolution and cryptic rearrangement in a large cohort of 54 patients with vPh CML. " /// The components of ABL-BCR were physically separated in a further 52% of patients while fused in the remaining 11%. /// "Deletion encompassing the reciprocal product (ABL-BCR) from the derivative chromosome 9 [der(9)] occurs in 15% of all patients, but with greater frequency in vPh patients. " /// "Deletions encompassing ABL-BCR were detected in 37% of patients, consistent with a model in which a greater number of chromosome breaks increases the risk of genomic loss. "
BCR_ABL1- 21637474chronic myeloid leukemia;myeloid leukemia;leukemia - - In this study we report the frequencies of BCR-ABL1 fusion transcript variants studied in 43 CML patients from Sudan. /// Frequencies of BCR-ABL1 fusion transcripts among Sudanese chronic myeloid leukaemia patients.. /// "The study includes 46 Sudanese patients, three of which negative for the BCR-ABL1 fusion transcript. " /// "In conclusion, we observed a significant correlation between sex and type of BCR-ABL1 transcript, an observation that deserves further investigation.. "
BCR_ABL1- 26856288acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Abnormal genes detected were BCR/ABL1 major transcript in 5 (12.5%), ETV6/RUNX1 in 2 (5.0%), MLL/AF4 none and none of the patients had more than one fusion gene. /// "Presence of fusion the genes BCR/ABL1, ETV6/RUNX1, and MLL/AF4 does not have any impact on the clinical and laboratory features of ALL at presentation.. "
BCR_ABL1- 22300134- - - BCR/ABL1 fusion transcripts generated from alternative splicing: implications for future targeted therapies in Ph+ leukaemias.. /// In this review we discuss the importance of recent advances based on the discovery of novel BCR/ABL1 variants and their potential role as new targets/biomarkers of Ph+ leukaemias in the light of the current therapeutic trends. /// " Philadelphia (Ph+) positive leukaemias are an example of haematological malignant diseases where different chromosomal rearrangements involving both BCR and ABL1 genes generate a variety of chimeric proteins (BCR/ABL1 p210, p190 and p230) which are considered pathological ""biomarkers"". "
BCR_ABL1- 23168614acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Acute lymphoblastic leukemia associated with RCSD1-ABL1 novel fusion gene has a distinct gene expression profile from BCR-ABL1 fusion..
BCR_ABL1- 21168207myeloid leukemia;leukemia - - In addition, significant negative correlations were observed between CMTM5 and three leukemia-specific fusion genes (AML1-ETO, PML-RAR? and BCR/ABL1).
BCR_ABL1- 20571941- FISH;PCR;RT-PCR - A nationwide study was started in 1993 to provide genetic diagnosis for all newly diagnosed childhood ALL cases in Hungary using cytogenetic examination, DNA-index determination, FISH (aneuploidy, ABL/BCR, TEL/AML1) and molecular genetic tests (ABL/BCR, MLL/AF4, TEL/AML1).
BCR_ABL119p13.11 / 24813417- - - To assess the presence of genetic imbalances in patients with myeloproliferative neoplasms (MPNs), 38 patients with chronic eosinophilia were studied by array comparative genomic hybridization (aCGH): seven had chronic myelogenous leukaemia (CML), BCR-ABL1 positive, nine patients had myeloproliferative neoplasia Ph- (MPN-Ph-), three had a myeloid neoplasm associated with a PDGFRA rearrangement, and the remaining two cases were Lymphoproliferative T neoplasms associated with eosinophilia.
BCR_ABL1- 9858221- PCR;RT-PCR - Patients with CML in blast crisis, or with Philadelphia positive acute lymphoblastic leukaemia (ALL), can have a smaller BCR-ABL fusion transcript possessing only the first exon of BCR fused to ABL.
BCR_ABL1- 24389534chronic myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - Detection and quantification of BCR-ABL1 fusion transcripts by droplet digital PCR.. /// Monitoring BCR-ABL1 fusion transcripts by real-time quantitative RT-PCR has become an important clinical test for the management of patients with chronic myeloid leukemia. /// We expect the advantages of droplet digital RT-PCR will make it the preferred method for quantification of BCR-ABL1 fusion transcripts.
BCR_ABL1- 25982135acute lymphoblastic leukemia;T ALL;lymphoblastic leukemia;leukemia - - Of those tested, ETV6-RUNX1 translocation was detected in 13.2%, while BCR-ABL1 translocation and MLL gene rearrangements were seen in 7.3% and 4.6%, respectively.
BCR_ABL1t(9;22) / 22058195leukemia - - Through fusion to BCR the ABL kinase in p185(BCR/ABL) and p210(BCR/ABL) "escapes" the auto-inhibition mechanisms of c-ABL, such as allosteric inhibition.
BCR_ABL1- 20557306leukemia PCR;RT-PCR - Treatment of CML with the tyrosine kinase inhibitor (TKI) imatinib mesylate results in the emergence of point mutations within the kinase domain (KD) of the BCR-ABL1 fusion transcript. /// The introduction of next-generation TKIs that can overcome the effects of some BCR-ABL1 KD mutations requires quantitative mutation profiling methods to assess responses.
BCR_ABL1- 24482808leukemia PCR - Clinical application of catalytically cleavable fluorescence probe technology for multiplexing quantification of BCR-ABL1 fusion transcripts.. /// Accurate measurement of BCR-ABL1 fusion transcripts is critical for therapeutic stratification in patients with chronic myelogenous leukemia (CML). /// "Here, we developed a one-step multiplex RQ-PCR method based on the catalytically cleavable fluorescence probe technology for quantification of BCR-ABL1 transcripts. "
BCR_ABL1- 26243622chronic myeloid leukemia;myeloid leukemia;leukemia - - The aim of the present study was to evaluate the clinical performances of a novel assay for the quantification of BCR-ABL1 fusion transcripts (e13a2 and e14a2) and ABL1 in a single reaction. /// " Although monitoring of BCR-ABL1 translocation has become an established practice in the management of chronic myeloid leukemia (CML), the detection limit of the BCR-ABL1 transcripts needs more standardization. " /// Evaluation of a novel multiplex RT-qPCR assay for the quantification of leukemia-associated BCR-ABL1 translocation.. /// "In a retrospective comparative clinical study performed in a reference laboratory, RNA was extracted from 48 CML patient blood samples with various BCR-ABL1/ABL1 ratios and RT-qPCR was performed using either MAScIR assay or the RT-qPCR simplex reference assay used in routine clinical testing. " /// "The present study illustrates the utility of MAScIR assay as a sensitive, rapid, and cost-effective quantitative device to monitor the BCR-ABL1 ratios by RT-qPCR on whole blood of diagnosed Philadelphia chromosome-positive (Ph+) leukemia patients. "
BCR_ABL1- 2227945- - - Ph-negative CML comprises (1) cases of submicroscopic (hidden) insertion of 9q34-ABL within 22q11-BCR, and (2) cases without BCR-ABL rearrangement.
BCR_ABL1t(9;22)(q34;q11) / 8609723granulocytic sarcoma RT-PCR - The cells had high protein kinase (p210BCR-ABL) activity and carried two identified variants of an ABL-BCR message. /// "We conclude that the KBM-7 cell line will be of value for investigating molecular events underlying neoplastic transformation in CML, in particular for studying the effects of BCR-ABL and ABL-BCR on the proliferation of CML cells in the absence of normal BCR and c-ABL messages.. "
BCR_ABL1t(15;21) / t(9;22) / t(15;21) / 24123676leukemia - - Our data suggest that RUNX1 haploinsufficiency collaborates with the BCR-ABL1 oncogene in this leukemia.
BCR_ABL1t(9;22)(q34;q11) / 19075651chronic myeloid leukemia;myeloid leukemia;leukemia - - This translocation creates two new genes, BCR-ABL on the 22q- (Ph chromosome) and the reciprocal ABL-BCR on 9q-.
BCR_ABL1t(9;22) / 25709891leukemia FISH;PCR;RT-PCR - Preleukemic or smoldering chronic myelogenous leukemia (CML):BCR-ABL1 positive: A brief case report..
BCR_ABL1t(9;22)(q34;q11) / 25337274acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Expression of CD25 is a specific and relatively sensitive marker for the Philadelphia chromosome (BCR-ABL1) translocation in pediatric B acute lymphoblastic leukemia..
BCR_ABL1- 8340287acute lymphoid leukemia PCR - Consistent with this result, polymerase chain reaction (PCR) analyses detected a BCR-ABL mRNA with BCR exon 1 fused to ABL exon 2.
BCR_ABL1- 26206693acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - The e1a3 BCR-ABL1 fusion transcript in philadelphia chromosome-positive acute lymphoblastic leukemia..
BCR_ABL1- 26023536acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Erratum: Two Cases of Acute Lymphoblastic Leukemia with an e1a3 BCR-ABL1 Fusion Transcript..
BCR_ABL1- 22208485leukemia - - To describe the approach used by an individual laboratory for development and validation of a laboratory-developed quantitative reverse transcription polymerase chain reaction test for BCR-ABL1 fusion transcripts. /// Elements of design and analytic validation of a laboratory-developed quantitative molecular test are discussed using quantitative detection of BCR-ABL1 fusion transcripts as an example. /// Design and analytic validation of BCR-ABL1 quantitative reverse transcription polymerase chain reaction assay for monitoring minimal residual disease.. /// We demonstrate how one laboratory validated and clinically implemented a quantitative BCR-ABL1 assay that can be used for the management of patients with chronic myelogenous leukemia..
BCR_ABL1- 22031455lymphoblastic leukemia;leukemia - - As previously reported, Bcl-2 expression was lower in B-LL with BCR-ABL1 gene rearrangement, but the fluorescence intensity of this group of specimens was still significantly higher than that seen for hematogones.
BCR_ABL1- 22249155chronic myeloid leukemia;myeloid leukemia;leukemia - - International reporting scale of BCR-ABL1 fusion transcript in chronic myeloid leukemia: first report from India.. /// "In collaboration with an international reference laboratory in Adelaide, S.A., Australia, we have established and validated a lab-specific conversion factor for expressing BCR-ABL1 transcript levels in the IS. " /// "In this report, we explain the process and steps involved in obtaining a valid lab-specific conversion factor for expressing BCR-ABL1 transcript levels in the IS.. " /// "This requires accurate measurement of BCR-ABL1 transcripts normalized to a control gene, as well as defining a level (BCR-ABL1/control gene ratio) that will correlate with sustained clinical response. " /// A BCR-ABL1/control gene ratio of 0.10% represents MMR in the IS.
BCR_ABL1- 22166509acute myeloid leukemia;myeloid leukemia;myelodysplastic syndrome;leukemia - - This patient's poor clinical outcome may have been exacerbated by the acquisition of the BCR-ABL1 fusion transcript overlapping with the aggressive nature of MDS-F.. /// We report the case of a 66-year-old male patient diagnosed with refractory anemia with excess blasts-2 with fibrosis (MDS RAEB-2-F) with a normal karyotype and negative findings for both BCR-ABL1 transcript and JAK2 V617F mutations. /// Acquisition of a BCR-ABL1 transcript in a patient with disease progression from MDS with fibrosis to AML with myelodysplasia-related changes..
BCR_ABL1- 22614971acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - High-risk ALL was defined by MRD ? 1 ?? 10(-3) at week 12 and/or poor prednisolone response, BCR-ABL1, MLL gene rearrangements, hypodiploid less than 45 chromosomes, or induction failure.
BCR_ABL1- 25553301acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Two cases of acute lymphoblastic leukemia with an e1a3 BCR-ABL1 fusion transcript..
BCR_ABL1- 17957805leukemia - - The success of the tyrosine kinase inhibitor (TKI), imatinib, as the currently recommended first-line treatment of early chronic phase CML has both fueled the need for timely and reproducible molecular testing of the BCR-ABL1 fusion transcript in diagnosis and monitoring as well as necessitated the detection of kinase domain mutations that confer resistance to this agent.
BCR_ABL1- 25976962leukemia;polycythemia vera - - In this review, we discuss the role and caveats of BCR-ABL1 fusion transcript evaluation in CML diagnosis and monitoring, as well as ABL1 kinase mutation testing in the setting of tyrosine kinase inhibitor resistance.
BCR_ABL1- 9536079- - - Chronic myeloid leukaemia (CML) develops when two genes, BCR on chromosome 22 and ABL on chromosome 9, recombine to form a hybrid BCR-ABL gene with leukaemogenic properties.
BCR_ABL1- 9809034chronic myeloid leukemia;myeloid leukemia;leukemia RT-PCR - The BCR/ABL1-D probe, formatted to display a fluorescent signal for both the reciprocal products of a 9/22 rearrangement, gave a positive fusion signal on the derivatives 9 and 22. /// "Fluorescence in situ hybridization with a BCR/ABL1-S probe, which is formatted to display a BCR/ABL fusion signal on chromosome 22, gave a positive fusion signal on a chromosome 9. "
BCR_ABL1- 20508029chronic myeloid leukemia;myeloid leukemia;leukemia PCR - The e14/a2 (b3/a2) type BCR-ABL mRNA incorporated a 42-nucleotide intronic insertion of ABL intron Ib between BCR exon e14 and ABL exon a2. /// We identified a novel breakpoint cluster region-ABL rearrangement in a chronic myeloid leukemia (CML) patient. /// "Using a PCR-based method, this analysis revealed that i) BCR intron 14 brought a potential lariat branch point and the polypyrimidine tract, ii) the BCR-ABL breakpoint created a chimeric acceptor site, and iii) the inserted sequence of ABL intron Ib carried at its 3' end a well-conserved donor splice site. "
BCR_ABL1t(9;22) / 22248505acute myeloid leukemia;acute lymphoblastic leukemia;chronic myeloid leukemia PCR;RT-PCR - Minimal residual disease was monitored by RQ-PCR for the BCR-ABL1/ABL ratio.
BCR_ABL1t(9;22) / 26555285leukemia PCR - We developed an NGS-based BCR-ABL1 mutation test on the Ion Torrent Personal Genome Machine (PGM) to test for resistance mutations, primarily in the kinase domain in BCR-ABL1. /// "Detection of BCR-ABL1 mutations that confer tyrosine kinase inhibitor resistance using massively parallel, next generation sequencing.. " /// The advantages of NGS make it a superior method for inventorying BCR-ABL1 resistance mutations.
BCR_ABL1del(20q) / 19624538- PCR - A retrospective comparison of WT1 and BCR-ABL1 expression was performed in 40 imatinib-treated chronic myeloid leukaemia patients. /// In two patients WT1 expression was increasing despite very low BCR-ABL1 levels. /// The overall correlation of WT1 and BCR-ABL1 was low.
BCR_ABL1- 25057418T ALL;lymphoblastic leukemia;leukemia - - Same BCR-ABL1 fusion transcript with minor breakpoint was present in both the lymph node and marrow specimens. /// Case 2 is the first reported case of T-lymphoblastic CML-BP harboring BCR-ABL1 transcript with a minor breakpoint.
BCR_ABL1- 1518145leukemia - - Ph1 constricts ABL/BCR within M-BCR in CML and in one half of the adult Ph1 AL.
BCR_ABL1t(9;22) / 7723412chronic myeloid leukemia;myeloid leukemia;leukemia - - This parental bias led to the hypothesis that the genes disrupted by the translocation, BCR and ABL, were themselves imprinted, and that in CML the BCR-ABL gene was formed by BCR sequences of maternal and ABL sequences of paternal origin.
BCR_ABL1- 10865410leukemia PCR;RT-PCR - In these BCR/ABL transcript positive cases, the incidence of BCR exon3/ABL exon2 (B3A2) and BCR exon 2/ABL exon2 rearrangement was 25 (89.3%) and 3 (10.7%) cases, respectively.
BCR_ABL1- 23940019acute lymphoblastic leukemia;T ALL;lymphoblastic leukemia;leukemia - - The distribution of common genetic abnormalities was similar to that reported from western populations, with 24.6% hyperdiploidy, 21% RUNX1-ETV6 positivity, 4.2% BCR-ABL1 positivity, and 2.5% with MLL gene rearrangement.
BCR_ABL1- 26017033acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - The primary and relapsed leukemias shared the identical BCR-ABL1 fusion genomic sequence and two identical immunoglobulin gene rearrangements, indicating that the relapse was a derivative of the founding clone.
BCR_ABL1t(9;22) / 21380694hematologic malignancy PCR;RT-PCR - The reciprocal ABL-BCR product is also transcriptionally active in the majority of cases (4, 5)..
BCR_ABL1- 16141323acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - We therefore investigated BTK function in B cell precursor leukemia cells carrying a BCR-ABL1, E2A-PBX1, MLL-AF4, TEL-AML1, or TEL-PDGFRB gene rearrangement.
BCR_ABL1- 20352097- - - Applying this system to a human cell line, we successfully recapitulated two types of pathogenic chromosomal translocations in human diseases: MYC/IgH and BCR/ABL1.
BCR_ABL1- 17196995colorectal cancer;colorectal carcinoma - - Our finding BCR and ABL located within two of the instability-associated regions, and the involvement of these two regions occurring coordinately, suggests a system akin to the BCR-ABL translocation of CML may be involved in genomic instability in about one-third of human colorectal carcinomas..
BCR_ABL1t(9;22) / 7723414- - - Recent molecular genetic studies however, have shown that BCR and ABL are expressed on both alleles and that the maternal and paternal ABL genes contribute equally often to the BCR-ABL fusion messenger.
BCR_ABL1t(9,22) / t(9,22) / t(9;22) / / 10654081leukemia - - In addition to this, chromosomes 9 and 22 were frequently associated in pairs detected as false-positive ABL-BCR fusions.
BCR_ABL1t(9;22) / 25840461myeloproliferative disorder;leukemia - - Given that the BCR-ABL1 oncogene is a known key cause of CML, it has led to the development of numerous small molecule tyrosine-kinase inhibitors (TKIs), which target the specific oncogene mutation in CML. /// "The resulting translocation leads to the development of the BCR-ABL1 oncogene, a constitutively active fusion protein, which leads to uncontrolled cell proliferation and reduced apoptosis and has a clear association with driving the malignant activity of CML cells. "
BCR_ABL1t(9;22) / t(9;22) / 8656667- PCR;RT-PCR - The role, if any, of the reciprocal ABL-BCR hybrid gene in CML is unknown. /// "Although its mRNA message is in frame, no ABL-BCR fusion protein has yet been identified in CML patients. "
BCR_ABL1t(9;22) / t(9;22;16) / 15721642leukemia - - The b3a2 transcript of BCR-ABL1 was detected both at diagnosis and 7 months after therapy. /// All chromosomes have participated in these variants and the BCR-ABL1 hybrid gene is always present.
BCR_ABL1t(9;22) / 15145216chronic myeloid leukemia;myeloid leukemia;leukemia - - The expression profile also included genes encoding transcription factors, kinases, and signal transduction molecules, as well as genes regulating cell growth, differentiation, apoptosis, and cell adhesion, features previously suggested to be affected by BCR/ABL1. /// "In an effort to better understand the transcriptional program activated by BCR/ABL1, we used cDNA microarrays to evaluate the relative expression of approximately 6450 human genes in U937 myelomonocytic cells expressing P210 BCR/ABL1 via a tetracycline-inducible promoter. " /// "In contrast, relatively few genes are known to be regulated by BCR/ABL1 at the level of transcription. " /// The resulting fusion of the BCR and ABL1 loci produces the constitutively active BCR/ABL1 tyrosine kinase. /// We confirmed the previously reported up-regulation of the PIM1 and JUN oncogenes by BCR/ABL1. /// These observations shed novel insight into the mechanism of BCR/ABL1 action and provide a range of targets for further investigation.. /// "In addition, we identified 59 more genes up-regulated by BCR/ABL1. " /// An additional seven BCR/ABL1-regulated genes were found to be IFN-responsive in U937 cells. /// "A wide range of signal transduction molecules are activated by BCR/ABL1, including MYC, PI-3 kinase, and different STAT molecules. " /// Identification of genes differentially regulated by the P210 BCR/ABL1 fusion oncogene using cDNA microarrays..
BCR_ABL1- 22887688acute lymphoblastic leukemia;chronic myeloid leukemia;myeloid leukemia;lymphoblastic leukemia;leukemia PCR - A multiplex long-range PCR-based assay was developed to allow fast and reliable amplification of patient-specific BCR-ABL1 fusion sequences from genomic DNA. /// Genomic BCR-ABL1 breakpoints in pediatric chronic myeloid leukemia..
BCR_ABL1- 15721638acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - We report on a 72-year-old male patient with a BCR/ABL1 rearrangement positive acute lymphoblastic leukemia (common ALL, or c-ALL.
BCR_ABL1- 24319172acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Cytogenetics provide reliable risk stratification for treatment: high hyperdiploidy and ETV6-RUNX1 are good risk, whereas BCR-ABL1, MLL rearrangements, and hypodiploidy are poor risk.
BCR_ABL1- 23675566leukemia PCR - The most known fusions are ETV6-RUNX1 or BCR-ABL1 in B-cell progenitor (BCP)-ALL, and rearrangements of MLL in pediatric ALL and AML. /// "IKZF1 deletions were first identified by SNP arrays in ALL patients, and later identified with a high prevalence in BCR-ABL1(+) patients. "
BCR_ABL17p15.2 / 17p13.3 / 9p24.1 / 22456238acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Finally, BCR-ABL1 positive cases, in contrast to negative ones, were characterized by slightly, but still significantly, higher expression levels of miR-29b.. /// "miR-101-2 was recurrently downregulated, and although the related CNN LOH was detected only in BCR-ABL1 negative cases (2/14), deletions of miR-101-2 were observed solely in BCR-ABL1 positive cases (4/7). "
BCR_ABL1- 10629590chronic myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - The consequent BCR-int-ABL transcript was translated into a BCR-ABL protein of 1804 amino acid residues with a molecular mass of 197.5 kilodaltons (kDa) called p200 BCR-ABL.
BCR_ABL1- 23071469lymphoblastic leukemia;leukemia - - The e8a2 fusion transcript in B lymphoblastic leukemia with BCR-ABL1 rearrangement..
BCR_ABL116p11.2 / 21156236chronic myeloid leukemia;myeloid leukemia;leukemia - - Early molecular response (EMR), defined as >50% reduction in the ratio of BCR-ABL1 to ABL1 within 6 months after dose escalation, was a major endpoint for analysis. /// GSTT1 copy number gain was related to short time to treatment failure (TTFx) in patients without BCR-ABL1 mutations (P = 0.007).
BCR_ABL1t(6;15)(p25;q22) / t(6;19) / t(9;22)(q34;q11) / t(9;22) / t(6;15) / 8111741leukemia - - Because only one additional fragment was observed, both cell lines apparently share the same breakpoint in the ABL/BCR gene.
BCR_ABL1- 22110503acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia PCR - Screening for BCR-ABL1 mutations in Philadelphia-positive ALL allows to identify patients who may benefit from second-generation tyrosine kinase inhibitors or from novel compounds targeting the T315I mutation.
BCR_ABL1- 20227268acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - STAT5 also plays a key role in the generation of B cell precursor acute lymphoblastic leukemia, whereby the BCR-ABL1 translocation or the collaboration of JAK2 mutations with overexpression of the thymic stromal lymphopoietin receptor CRLF2 results in constitutive STAT5 activation leading to cytokine-independent survival and growth of leukemic cells..
BCR_ABL1- 20811403chronic myeloid leukemia;myeloid leukemia;leukemia PCR - Seven of eight patients who sustained CMR off therapy had BCR-ABL1 DNA detected at least once after stopping imatinib, but none has relapsed (follow-up 12-41 months). /// We used a highly sensitive patient-specific nested quantitative PCR to look for evidence of genomic BCR-ABL1 DNA in patients who sustained CMR after stopping imatinib therapy. /// "BCR-ABL1 DNA levels increased in all of the 10 patients who lost CMR soon after imatinib cessation, whereas serial testing of patients in sustained CMR showed a stable level of BCR-ABL1 DNA. " /// This more sensitive assay for BCR-ABL1 provides evidence that even patients who maintain a CMR after stopping imatinib may harbor residual leukemia. /// "undetectable breakpoint cluster region-Abelson leukemia gene human homolog 1 (BCR-ABL1) mRNA) on imatinib can stop therapy and remain in CMR, at least for several years. "
BCR_ABL1- 20445328essential thrombocythemia - - Major/minor BCR-ABL1 rearrangement and JAK2 V617F mutation were not detected.
BCR_ABL1- 24766374chronic myeloid leukemia;myeloid leukemia;leukemia PCR - After ponatinib therapy, the T315I mutation burden decreased down to undetectable levels and the BCR-ABL1 transcripts showed a very low value (0.011%). /// "At the time of mutational analysis, during dasatinib treatment, the T315I clone was 100% and the quantification of BCR-ABL1 was 18%. "
BCR_ABL1- 23716539acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - The prevalence of the BCR/ABL1 rearrangement increased progressively with age starting from the cohort of patients 10-14 years old and was present in 52.7% of cases in the 6th decade.
BCR_ABL1- 23148371acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - In this issue of Cancer Discovery, Geng and colleagues report on their use of a combination of promoter cytosine methylation profiling with gene expression and ChIP sequencing to elucidate molecular signatures of adult B-acute lymphoblastic leukemia patient samples with BCR-ABL1, E2A-PBX1, and MLL rearrangements.
BCR_ABL1- 23614569hematologic malignancy;hematologic malignancy PCR;RT-PCR - Further, the BCR-ABL1 mRNA levels of the QST RNA isolation were highly consistent with RB RNA isolation, only when the lysis buffer RLT Plus in addition contained BME. /// We used QIAsymphony technology (QST) using a customized RNA CT 800 V6 protocol for automated semi-high-throughput isolation of RNA from human specimens and compared the results for breakpoint cluster region-c-abl oncogene 1 (BCR-ABL1) quantification by real-time quantitative polymerase chain reaction (RQ-PCR) and detection of JAK2 V617F mutations by reverse-transcriptase PCR (RT-PCR) on QST RNA with RNA isolation performed with our routine manual method using RNA-Bee (RB).
BCR_ABL1p24;q11 / t(9;22)(p24;q11) / 25789185leukemia - - Regarding BCR-ABL1??negative MPN patients this case report provides strong support for a role of JAK2 activation in the oncogenesis and suggests a possible diagnostic and therapeutic target that should be investigated. /// BCR-ABL1 negative myeloproliferative neoplasms (MPNs) are known to contain alterations of the tyrosine kinase JAK2 (located on 9p24) that result in constitutive activation of the encoded protein.
BCR_ABL1- 23911702acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - T-cell acute lymphoblastic leukemia: 31 ?? 8% versus 11 ?? 3%, P=0.003) and kept its significance in multivariate analysis considering sex, age, initial white blood cell count, and minimal residual disease in B-cell-precursor- and T-cell acute lymphoblastic leukemia, and additionally presence of ETV6/RUNX1, MLL/AF4 and BCR/ABL1 rearrangements in B-cell-precursor acute lymphoblastic leukemia (P=0.002 and P=0.025, respectively). /// "In B-cell-precursor acute lymphoblastic leukemia we observed a significant association of a high CD45 expression with older age, high initial white blood cell count, ETV6/RUNX1 negativity, absence of high hyperdiploidy (P<0.0001), MLL/AF4 positivity (P=0.002), BCR/ABL1 positivity (P=0.007), prednisone poor response (P=0.002) and minimal residual disease (P<0.0001). "
BCR_ABL1- 26366092monoclonal gammopathy - - The diagnosis is based on morphological criteria of granulocytic cells and the exclusion of genetic drivers that are known to occur in others MPNs, such as BCR-ABL1, PDGFRA/B, or FGFR1 rearrangements.
BCR_ABL1- 8158846leukemia - - Chromosomal and molecular analyses, including BCR rearrangement and BCR -ABL mRNA, before and after IFN-alpha treatment demonstrated a recovery of normal hematopoiesis by the treatment of INF-alpha, however, suppressive effect for the blast cells by IFN-alpha was insufficient.
BCR_ABL1t(5;9)(q22;q34) / 24215620acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - ALL cells carrying a SNX2-ABL1 fusion exhibited a BCR-ABL1+ ALL-like gene expression profile.
BCR_ABL1- 25401297acute myeloid leukemia;chronic myeloid leukemia;myeloid leukemia;leukemia - - The presence of a Philadelphia chromosome with a corresponding BCR-ABL1 rearrangement is the hallmark of chronic myeloid leukemia, but is considered a very rare event in de novo acute myeloid leukemia (AML). /// BCR-ABL1(+) acute myeloid leukemia: clonal selection of a BCR-ABL1(-) subclone as a cause of refractory disease with nilotinib treatment..
BCR_ABL1- 23253862- - - The incidence of co-existing BCR-ABL1 and JAK2 V617F rearrangements: implications for molecular diagnostics..
BCR_ABL1- 24698424hairy cell leukemia - - We also review all published literature on HCL with BCR/ABL1 rearrangement and discuss the pathophysiology of these unusual cases. /// De novo hairy cell leukemia with a major BCR/ABL1 rearrangement: a case report with a literature review.. /// "After a thorough analysis of previous studies and the results of this patient, we speculate that a subclone evolved to have an additional genetic BCR/ABL1 rearrangement. " /// "Here we report a case of HCL expressing a BCR/ABL1 clone, which showed molecular remission of the fusion clones and achieved partial remission over nine months of cladribine therapy. "
BCR_ABL1- 25872147- PCR - RNA samples were extracted from 8 cell line mixtures expressing various BCR-ABL1 transcript levels. /// Quality of RNA was consistent between laboratories and met the criteria requested for quantification of BCR-ABL1 transcripts. /// "Therefore, we evaluated the minicapsule-based innovative process developed by Imagene (Evry, France) for implementing DNA and RNA controls designed for clonality assessment of lymphoproliferations and BCR-ABL1 mRNA quantification, respectively. "
BCR_ABL1- 19901533acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - In a recent study on 111 cases of pre-B cell-derived human ALL, we found that ALL cells carrying a BCR-ABL1-gene rearrangement lack expression of a functional pre-B cell receptor in virtually all cases.
BCR_ABL1- 20082857precursor B cell leukemia - - ABL1 gene deletion without BCR/ABL1 rearrangement in a young adolescent with precursor B-cell acute lymphoblastic leukemia: clinical study and literature review.. /// "however, it is plausible that ABL1 deletion without BCR/ABL1 rearrangement is a rare but recurrent genetic abnormality in precursor B-ALL patients. " /// " Entire ABL1 gene deletion without BCR/ABL1 rearrangement is a rare phenomenon, with only four cases previously reported. " /// Here we describe a fifth case of ABL1 deletion without BCR/ABL1 rearrangement in an adolescent patient with precursor B-cell lymphoblastic leukemia (B-ALL) and review the relevant literature.
BCR_ABL1- 19175693essential thrombocythemia;polycythemia vera;primary myelofibrosis;systemic mastocytosis - - Therapeutically validated oncoproteins in myeloproliferative neoplasms (MPN) include BCR-ABL1 and rearranged PDGFR proteins. /// "BCR-ABL1 is associated with chronic myelogenous leukaemia (CML) and mutant PDGFR with an MPN phenotype characterized by eosinophilia and in addition, in case of FIP1L1-PDGFRA, bone marrow mastocytosis. "
BCR_ABL1- 24060288chronic myeloid leukemia;myeloid leukemia;leukemia PCR - Of the 4 patients with evidence of MRD in peripheral blood, 2 had negative and 2 had positive BCR-ABL1 colonies.
BCR_ABL1- 24845374chronic myeloid leukemia - - There should be no dysplasia, monocytosis, molecular evidence of BCR-ABL1, PDGFRA, PDGFRB, or FGRF1 rearrangements and no identifiable cause for physiologic neutrophilia or, if present, demonstration of myeloid clonality.
BCR_ABL1- 22453304- - - ABL1 deletion without BCR/ABL1 rearrangement is originated from a large-sized 9q deletion..
BCR_ABL1- 25143840leukemia;multiple myeloma;lymphoproliferative disorder - - Cytogenetics revealed normal karyotype, JAK2 kinase was negative, and rearrangement of BCR-ABL1, PDGFRA, PDGFRB, and FGFR1 was negative.
BCR_ABL1- 24335708- - - In the current WHO classification of myeloid disorders, chronic neutrophilic leukaemia (CNL) is recognized as a myeloproliferative neoplasm characterized by sustained neutrophilic leukocytosis, hepatosplenomegaly and bone marrow granulocytic hyperplasia without evidence of dysplasia, BCR-ABL1 or rearrangements of PDGFRA, PDGFRB or FGFR1.
BCR_ABL1- 21486895- PCR - The BCR-ABL1 T315I mutation imparts resistance to tyrosine kinase inhibitors currently available for treatment of chronic myelogenous leukaemia. /// A pyrosequencing-based test for detection and relative quantification of the BCR-ABL1 T315I point mutation.. /// "The goals of this study were to retrospectively review the authors' experience with Sanger sequencing-based BCR-ABL1 kinase domain mutation testing, paying particular attention to the T315I mutation, and to develop an alternative test for relative quantification of T315I using pyrosequencing. " /// The resulting cDNA was subjected to an initial round of PCR across the BCR-ABL1 breakpoint followed by a second round to amplify the sequence flanking ABL1 codon 315.
BCR_ABL1- 25983565leukemia;lymphoproliferative disorder - - Tests for both Janus kinase mutation JAK2 V617F and rearrangement of the genes BCR-ABL1, platelet-derived growth factor receptor-? (PDGFR?), PDGFR?, and fibroblast growth factor receptor-1 (FGFR1) were negative.
BCR_ABL1- 23127356- PCR - Chronic myeloid leukaemia (CML) is characterized by the Philadelphia chromosome resulting in the BCR-ABL1 gene whose mRNA transcript detection is commonly used for diagnosis and monitoring of therapeutic response. /// Patient-specific individual BCR-ABL1 fusion sites were successfully detected in 10 out of 13 patients. /// Identification of the genomic BCR-ABL1 fusion sequence from blood specimen stored on filter paper.. /// DNA was isolated from dried blood stains from CML patients stored on filter paper (Guthrie cards) after a median period from diagnosis of 11 years (range: 5-12 years) and analyzed with a two round long-range multiplex PCR (MLR-PCR) to identify the genomic BCR-ABL1 breakpoint.
BCR_ABL1- 26276770lymphoblastic leukemia - - Many of the submitted cases showed interesting diagnostic, immunophenotypic, or clinical aspects of B-ALL with BCR/ABL1, MLL-associated, and other recurrent chromosomal abnormalities.
BCR_ABL1- 7734352- PCR;RT-PCR - We have used a two-step reverse transcriptase polymerase chain reaction (RT-PCR) to detect the transcripts of the chimaeric genes BCR/ABL, ABL/BCR, as well as the normal ABL and BCR genes in 24 CML patients treated with IFN. /// "However, 7/10 ABL/BCR mRNA positive patients achieved a major cytogenetic response to IFN. " /// The function and clinical significance of the newly discovered ABL/BCR mRNA has not been investigated for a correlation with CML prognosis or response to therapy. /// "but of the 13 ABL/BCR mRNA negative patients, only two achieved a major cytogenetic response (P = 0.013). " /// "Also, no correlation was found between expression of BCR, ABL or BCR/ABL mRNA and response to treatment with IFN. " /// Interferon response in chronic myeloid leukaemia correlates with ABL/BCR expression: a preliminary study..
BCR_ABL1- 23575066chronic myeloid leukemia;myeloid leukemia;leukemia - - BCR-ABL1 in leukemia: disguise master outplays riding shotgun.. /// "This review unfolds current understanding of BCR-ABL1 (break point cluster region-c-abl oncogene 1, non-receptor tyrosine kinase) signaling with a focus on apoptotic suppressive mechanisms and alternative approaches to chronic myeloid leukemia therapy.. "
BCR_ABL1- 23341502prostate cancer - - We tested a set of cell lines positive for the BCR-ABL1 fusion and prostate cancers positive for the TMPRSS2-ERG fusion.
BCR_ABL1- 25554588chronic myeloid leukemia;myeloid leukemia;leukemia PCR - The BCR-ABL1 sequence has advantages over the BCR-ABL1 transcript as a molecular marker in chronic myeloid leukemia and has been used in research studies. /// "We developed a DNA real-time quantitative PCR (qPCR) method for quantification of BCR-ABL1 sequences, which is also potentially suitable for routine use. " /// BCR-ABL1 sequences were quantified relative to BCR sequences in 521 assays on 266 samples from 92 patients. /// "The BCR-ABL1 breakpoint was sequenced after isolation by nested short-range PCR of DNA from blood, marrow, and cells on slides, obtained either at diagnosis or during treatment, or from artificial mixtures. "
BCR_ABL1- 20808301chronic myeloid leukemia;myeloid leukemia;leukemia PCR - Despite maintenance of a complete cytogenetic response, a progressive rise of the BCR-ABL1 transcript was detected and loss of major molecular response occurred about 2 years after stopping IFN-? therapy. /// After nine boosts of vaccine the patient developed an adequate b2a2-25 peptide-specific CD4(+) T-cell response and BCR-ABL1 transcript started to decline in peripheral blood. /// "At the last evaluation, 39 months since vaccinations commenced, the patient is in complete molecular response with an undetectable level of BCR-ABL1 transcript both in peripheral blood and in bone marrow and she continues to receive boosts of vaccine every 3 months as the only treatment.. "
BCR_ABL1- 23541592leukemia PCR - The effects of room temperature storage time, different primers, and RNA input in the reverse transcription (RT) reaction on BCR-ABL1 and ?-glucuronidase (GUSB) cDNA yield were assessed in whole blood samples mixed with K562 cells. /// BCR-ABL1 per 10(3) GUSB values were significantly reduced (P = 0.004) after 48-hour storage. /// "BCR-ABL1 was measured relative to GUSB to control for sample loading, and each gene was measured relative to known numbers of respective internal standard molecules to control for variation in quality and quantity of reagents, thermal cycler conditions, and presence of PCR inhibitors. " /// "Consequently, the yield of BCR-ABL1 was higher with gene-specific RT primers at all RNA inputs tested, increasing to as much as 158-fold. " /// Quality control methods for optimal BCR-ABL1 clinical testing in human whole blood samples.. /// We conclude that optimal measurement of BCR-ABL1 per 10(3) GUSB in whole blood is obtained when gene-specific primers are used in RT and samples are analyzed within 24 hours after blood collection.. /// Gene-specific primers yielded more BCR-ABL1 cDNA than random hexamers at each RNA input.
BCR_ABL1t(9;14)(q34;q32) / 15713800acute lymphoblastic leukemia;chronic myeloid leukemia;T ALL;myeloid leukemia;lymphoblastic leukemia - - The BCR-ABL1 fusion kinase is frequently associated with chronic myeloid leukemia and B-cell acute lymphoblastic leukemia but is rare in T-cell acute lymphoblastic leukemia (T-ALL). /// EML1-ABL1 and breakpoint cluster region (BCR)-ABL1 were equally sensitive to the tyrosine kinase inhibitor imatinib.
BCR_ABL1- 22226019acute lymphoblastic leukemia;T ALL;lymphoblastic leukemia;leukemia PCR;RT-PCR - BCR-ABL1, 1.6%.
BCR_ABL1- 17485517acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - In addition, AID introduced DNA single-strand breaks within the tumor suppressor gene CDKN2B in Ph(+) ALL cells, which was sensitive to BCR-ABL1 kinase inhibition and silencing of AID expression by RNA interference. /// Forced expression of BCR-ABL1 in Ph(-) ALL cells and inhibition of the BCR-ABL1 kinase showed that aberrant expression of AID depends on BCR-ABL1 kinase activity. /// The Philadelphia chromosome (Ph) encoding the oncogenic BCR-ABL1 kinase defines a subset of acute lymphoblastic leukemia (ALL) with a particularly unfavorable prognosis.
BCR_ABL1- 20413659chronic myeloid leukemia;myeloid leukemia;leukemia - - Surprisingly, at CML diagnosis, 15 of 18 patients (83%) had a sizeable clonal, BCR-ABL1 negative lymphocyte population, which was uncommon in healthy persons (1 of 12.
BCR_ABL1- 19474126leukemia - - Treatment-specific sensitivity assays are being developed for targeted drugs such as farnesyl transferase inhibitors in AML or imatinib in BCR-ABL1 positive acute lymphoblastic leukaemia (ALL).
BCR_ABL1- 19806146acute myeloid leukemia;myeloid leukemia;myelodysplastic syndrome;leukemia;hypereosinophilic syndrome - - The diagnosis of chronic myelogenous leukemia requires the presence of BCR-ABL1, while its absence is required for all other MPN.
BCR_ABL1- 25675863acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Telomerase activity was significantly lower in Philadelphia chromosome-negative/IKAROS-deleted (BCR-ABL1(-)/IKAROS(del)) cases compared to Philadelphia chromosome-positive (BCR-ABL1+) BCP-ALLs.
BCR_ABL1- 25807654chronic myeloid leukemia - - The clinical characteristics of a 45-year-old Chinese female CML patient with e19a2 BCR/ABL1 transcript were described. /// This patient developed an acquired resistance associated with two p-BCR/ABL1 mutations (E255K and G250E) during treatment with imatinib. /// The ?-BCR/ABL1 mutation should be investigated after imatinib treatment failure..
BCR_ABL1- 24859364chronic myeloid leukemia;myeloid leukemia;leukemia - - However, the poorest outcomes among the 95 evaluable patients with BCR-ABL1 >10% at 3 months were identified by the rate of BCR-ABL1 decline from baseline, assessed by estimating the number of days over which BCR-ABL1 halved. /// Patients with BCR-ABL1 halving time <76 days (n = 74) had significantly superior outcomes compared with patients whose BCR-ABL1 values did not halve by 76 days (n = 21. /// Prognosis for patients with CML and >10% BCR-ABL1 after 3 months of imatinib depends on the rate of BCR-ABL1 decline.. /// Our study highlighted that the rate of BCR-ABL1 decline may be a critical prognostic discriminator of the patients with very poor outcome among those >10% at 3 months. /// All outcomes were significantly superior for the 410 patients with BCR-ABL1 ?10% at 3 months (P < .001).
BCR_ABL1- 24480987leukemia - - Horizontal transfer of BCR-ABL1 mRNA from MVs into the recipient cells was critical to the transformation. /// We found that MVs derived from K562 leukemia cells contained the breakpoint cluster region-Abelson leukemia gene human homolog 1 (BCR-ABL1) mRNA.
BCR_ABL1- 21732333- - - Mutations at the gatekeeper residues of BCR-ABL1 (eg, the threonine-to-isoleucine mutation at codon 315) and other oncogenic kinases have proven highly resistant to currently available TKIs. /// The rise and fall of gatekeeper mutations? The BCR-ABL1 T315I paradigm.. /// "Imatinib mesylate, a breakpoint cluster region-Abelson BCR-ABL1 inhibitor, was the first TKI approved in cancer medicine and has served as a model for the development of similar agents for other cancers. "
BCR_ABL1- 7786776- PCR - The translocation event was characterized further in three other patients by amplifying the reciprocal ABL-BCR junction on the 9q+ chromosome and also normal ABL around breakpoints.
BCR_ABL1- 23107779acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Genetic lesions such as BCR-ABL1, E2A-PBX1, and MLL rearrangements (MLLr) are associated with unfavorable outcomes in adult B-cell precursor acute lymphoblastic leukemia (B-ALL). /// "We identify a novel clinically actionable biomarker in B-ALLs: IL2RA (CD25), which is linked with BCR-ABL1 and an inflammatory signaling network associated with chemotherapy resistance. " /// "The E2993 trial clinical data showed that CD25 expression was strongly associated with a poor outcome in patients with ALL regardless of BCR-ABL1 status, suggesting CD25 as a novel prognostic biomarker for risk stratification in B-ALLs. "
BCR_ABL1- 15611260acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - Thus, inhibition of BCR-ABL1 in pre-B ALL cells 1) recapitulates early B cell development, 2) directly shows that IGK, KDE, and IGL genes are rearranged in sequential order, and 3) provides a model for Ig L chain gene regulation in the human.. /// We studied whether inhibition of BCR-ABL1 kinase activity using STI571 can relieve this differentiation block. /// The BCR-ABL1 kinase expressed in acute lymphoblastic leukemia (ALL) drives malignant transformation of pre-B cells and prevents further development.
BCR_ABL1- 26391311chronic myeloid leukemia;myeloid leukemia;leukemia - - The mechanisms of BCR-ABL1 point mutations, amplification of the BCR-ABL1 gene and increased expression of efflux drug transporters, which play important roles in resistance, have been extensively described. /// " Chronic myeloid leukemia (CML) is a myeloproliferative neoplasm characterized by the causative oncoprotein BCR-ABL1 (Breakpoint-cluster region/Abelson kinase), which is a fusion protein with constitutive tyrosine kinase activity. "
BCR_ABL1- 15908956acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - In all patients, normal and leukemic repopulating stem cells could successfully be separated prospectively, and notably, the size of the normal HSC compartment in ETV6-RUNX1 and P190 BCR-ABL1 ALLs was found to be unaffected by the expansive leukemic stem cell population.. /// "The transformed leukemia-initiating stem cells in both P190 and P210 BCR-ABL1 ALLs had, as in ETV6-RUNX1 ALLs, a committed B progenitor phenotype. " /// "Major breakpoint BCR-ABL1 fusions (encoding P210 BCR-ABL1) originated in hematopoietic stem cells (HSCs), whereas minor BCR-ABL1 fusions (encoding P190 BCR-ABL1) had a B-cell progenitor origin, suggesting that P190 and P210 BCR-ABL1 ALLs represent largely distinct tumor biological and clinical entities. "
BCR_ABL1- 23575065leukemia - - In this review, our current comprehension of BCR-ABL1 signaling will be summarized.. /// "Besides, we discuss why activation of BCR-ABL1, as an outcome of distinct oncogenic events, results in miscellaneous clinical outcomes, and how the intricacy of the BCR-ABL1 signaling network might dictate therapeutic approaches. " /// In this particular review we discuss the oncogenes and tumor suppressors comprising the regulatory network upstream and downstream of BCR-ABL1 and dismantle how derailed BCR-ABL1 signaling provides cell a selective growth advantage. /// "It is a well-established fact that through the aberrant activation of BCR-ABL1 signal transduction cascade, the perception of cellular growth signals becomes disconnected from the processes promoting cell growth, and this underlies the pathophysiology of leukemia. " /// "Breakpoint cluster region-c-abl oncogene 1, non-receptor tyrosine kinase signaling: current patterns of the versatile regulator revisited.. " /// " Increasing sophisticated information suggests that cancer cells express constitutively active oncogenic kinases such as breakpoint cluster region- c-abl oncogene 1, non-receptor tyrosine kinase (BCR-ABL1) that promote carcinogenesis independent of extrinsic growth factors. "
BCR_ABL1- 26883104acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - BCR-ABL1, ETV6-RUNX1, E2A-PBX1, and MLL rearrangements (B-NEG ALL) and the differences between children, adolescents/young adults (AYA) and adults, we analyzed 168 B-NEG ALLs by genome-wide technologies.
BCR_ABL1- 21299849acute lymphoblastic leukemia;chronic myeloid leukemia;myeloid leukemia;lymphoblastic leukemia;leukemia - - The BCR-ABL1 translocation occurs in chronic myeloid leukemia (CML) and in 25% of cases with acute lymphoblastic leukemia (ALL). /// None of these cell lines carries mutations in the kinase domain of BCR-ABL1 or other molecular aberrations previously indicted in the context of imatinib-resistance. /// We screened a panel of BCR-ABL1 positive ALL and CML cell lines to find models for imatinib-resistance. /// "Five of 19 BCR-ABL1 positive cell lines were resistant to imatinib-induced apoptosis (KCL-22, MHH-TALL1, NALM-1, SD-1, SUP-B15). " /// "None of the resistant cell lines carried mutations in the kinase domain of BCR-ABL1 and all showed resistance to second generation TKI, nilotinib or dasatinib. " /// "STAT5, ERK1/2 and the ribosomal S6 protein (RPS6) are BCR-ABL1 downstream effectors, and all three proteins are dephosphorylated by imatinib in sensitive cell lines. " /// "PI3K pathway inhibitors effected dephosphorylation of RPS6 in imatinib-resistant cell lines suggesting that an oncogene other than BCR-ABL1 might be responsible for activation of the PI3K/AKT1/mTOR pathway, which would explain the TKI resistance of these cells. "
BCR_ABL1- 11122114- - - We identified a novel BCR-ABL transcript in a chronic myelogenous leukaemia (CML) patient who relapsed after bone marrow transplantation (BMT), containing a fusion between part of BCR exon 3, 44 nucleotides derived from ABL intron 1b and ABL exon 2.
BCR_ABL1- 23550022chronic myeloid leukemia;myeloid leukemia;leukemia - - Chronic myeloid leukemia (CML) is a cancer of blood cells driven by the BCR-ABL1 oncogenic protein tyrosine kinase, which is the product of a reciprocal chromosomal translocation known as the Philadelphia chromosome. /// "Discovery of tyrosine kinase inhibitors targeting the BCR-ABL1 kinase revolutionized CML therapy, but these drugs are unable to eradicate the disease due to the presence of a drug-insensitive stem cell population that sustains continued growth of the malignant cells. "
BCR_ABL1- 26980048acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia PCR;RT-PCR - AID protein is expressed in a large proportion of Ph+ ALL cases at levels detectable by IHC in clinical samples and might be useful to rapidly identify cases likely to have a BCR/ABL1 fusion.
BCR_ABL1- 23876601chronic myeloid leukemia;myeloid leukemia;leukemia PCR;RT-PCR - The BCR-ABL1 translocation is a hallmark of chronic myeloid leukemia. /// "Because patients treated with imatinib and other tyrosine kinase inhibitors achieve lower levels of detectable disease, quantitation of BCR-ABL1 transcripts with quantitative RT-PCR has become an essential tool in chronic myeloid leukemia monitoring. " /// Achieving defined levels of BCR-ABL1 on the International Scale within specific time frames is an important measure for assessing patient response and probability for relapse and progression. /// Molecular monitoring of chronic myeloid leukemia: international standardization of BCR-ABL1 quantitation..
BCR_ABL1- 11256626- - - We demonstrate that suitable masked antisense RNA can discriminate between the two forms of BCR-ABL mRNA that result from the Philadelphia chromosomal translocations, as well as discriminating the normal BCR and ABL mRNA..
BCR_ABL1- 25074248acute myeloid leukemia;myeloid leukemia;myelodysplastic syndrome;leukemia;hematopoietic malignancy - - We describe a case of relapsed acute myeloid leukemia (AML) after HCT that developed a BCR-ABL1 translocation along with erythrophagocytosis by blasts as a secondary change at the time of relapse.
BCR_ABL1- 21062244chronic myeloid leukemia;myeloid leukemia;leukemia - - CML is characterized by the presence of the Philadelphia chromosome, which is the product of a reciprocal translocation between chromosomes 9 and 22 that results in the formation of BCR-ABL1. /// This underlines the importance of BCR-ABL1 at this stage of the disease. /// Apart from its diagnostic importance in CML patients BCR-ABL1 it is a potent oncogene. /// Clinical experience shows that long term remissions can be achieved at a high rate at least in chronic phase by specific inhibition of BCR-ABL1. /// "How is BCR-ABL1 organized on the genetic level, is there a genetic precursor lesion as discussed for Philadelphia-negative myeloproliferative diseases, what is its role in pathogenesis and progression of CML and what is its role in the CML-stem cell? These questions will be discussed in this review.. "
BCR_ABL1- 16683885leukemia;hematologic malignancy - - The identification of the Philadelphia chromosome and the subsequent discovery that it represents a translocation between the long arms of chromosomes 9 and 22 producing an aberrant tyrosine kinase, known as BCR-ABL1, has catalyzed our understanding and treatment of this hematologic malignancy. /// These inhibitors appear effective in inhibiting most of the mutant BCR-ABL1 molecules that are resistant to IM. /// "The dominant mechanism appears to be mutations in the kinase domain of BCR-ABL1, which result in altered affinity of IM for the BCR-ABL1 protein. " /// "An extensive search for molecules to block the aberrant BCR-ABL1 protein resulted in the development of IM as an orally bioavailable agent with remarkable efficacy in producing hematologic, cytogenetic, and molecular remissions. "
BCR_ABL1- 18612408leukemia;hematologic malignancy FISH;PCR;RT-PCR - Moreover, by immunoblotting and flow cytometry, we show that phosphorylation of BCR-ABL1 is increased in AQP5-overexpressing CML cells and decreased in AQP5 siRNA-treated CML cells.
BCR_ABL1- 20231813megakaryocytic leukemia - - We describe the first pediatric patient presenting with megakaryocytic leukemia and having BCR-ABL1 translocation as the single chromosomal abnormality.
BCR_ABL1- 20442364acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia;down syndrome - - We reviewed data from 2811 children with ALL enrolled in Children's Oncology Group P9900, which included prospective testing for the major cytogenetic lesions in childhood ALL: ETV6-RUNX1, TCF3-PBX1, BCR-ABL1, and MLL translocations and trisomies of chromosomes 4 and 10. /// "However, when children with MLL translocations, BCR-ABL1, ETV6-RUNX1, and trisomies 4 and 10 were excluded, the EFS and OS were similar for children with and without DS (EFS 68.0 %+/- 9.3% vs 70.5% +/- 1.9%, P = .817. "
BCR_ABL1- 8251912leukemia - - Several important issues in CML research are not covered in this brief review such as the structural or molecular basis of the translocation between ABL and BCR, the relationship between CML and ALL with an identical or related BCR/ABL abnormality, the biology of CML stem and progenitor cells and immunologic aspects of CML.
BCR_ABL1- 18408710- - - IKZF1 (encoding the transcription factor Ikaros) was deleted in 83.7% of BCR-ABL1 ALL, but not in chronic-phase CML. /// "To define oncogenic lesions that cooperate with BCR-ABL1 to induce ALL, we performed a genome-wide analysis of diagnostic leukaemia samples from 304 individuals with ALL, including 43 BCR-ABL1 B-progenitor ALLs and 23 CML cases. " /// " The Philadelphia chromosome, a chromosomal abnormality that encodes BCR-ABL1, is the defining lesion of chronic myelogenous leukaemia (CML) and a subset of acute lymphoblastic leukaemia (ALL). " /// These findings suggest that genetic lesions resulting in the loss of Ikaros function are an important event in the development of BCR-ABL1 ALL.. /// BCR-ABL1 lymphoblastic leukaemia is characterized by the deletion of Ikaros..
BCR_ABL1- 25748621acute myeloid leukemia;acute lymphoblastic leukemia;chronic myeloid leukemia - - CBF) or BCR-ABL1 fusion and activation of multiple kinases in chronic myeloid leukemia (CML).
BCR_ABL1- 15254401leukemia - - Unexpectedly, B cell precursor leukemia cells harboring a BCR-ABL1 gene rearrangement do not depend on antigen receptor mediated survival signals. /// "However, upon inhibition of the BCR-ABL1 kinase activity by STI571, only leukemia cells expressing an antigen receptor are able to survive. " /// "Since resistance to STI571 is frequent in the therapy of BCR-ABL1(+) B cell precursor leukemia, antigen receptor signaling may represent a mechanism through which these cells can temporarily evade STI571-induced apoptosis. " /// Interference of BCR-ABL1 kinase activity with antigen receptor signaling in B cell precursor leukemia cells..
BCR_ABL1- 18268888leukemia PCR;RT-PCR - RT-PCR studies in 93 patients with chronic myelogenous leukemia from the Mexican West were done in order to know the proportion of b2a2 and b3a2 BCR/ABL1 transcripts. /// Prevalence of the BCR/ABL1 transcripts in Mexican patients with chronic myelogenous leukemia..
BCR_ABL1- 22937329chronic myeloid leukemia;myeloid leukemia;leukemia PCR - While most patients with chronic myeloid leukemia (CML) express either e13a2 or e14a2 BCR-ABL1 transcripts, a significant minority expresses variant transcripts, of which e19a2 is the most common. /// "Although considered to have a relatively favourable outcome, reported responses to tyrosine kinase inhibitor (TKI) therapy are variable with molecular monitoring in CML patients with e19a2 BCR-ABL1 transcripts rarely reported. " /// Chronic Myeloid Leukemia with e19a2 BCR-ABL1 Transcripts and Marked Thrombocytosis: The Role of Molecular Monitoring.. /// This case serves to demonstrate the requirement for prospective real-time quantitative PCR (RQ-PCR) assays for patients with variant BCR-ABL1 transcript types and standardisation of such assays to enable modern patient management.. /// "A case of e19a2 BCR-ABL1 CML with marked thrombocytosis is described in which the value of molecular monitoring is emphasised during treatment interruptions, dose reductions, and changes. "
BCR_ABL1- 10615128- - - One model uses the 'knock-in' approach to induce leukaemia by p190 BCR-ABL1(ref. /// Reversibility of acute B-cell leukaemia induced by BCR-ABL1.. /// "The most common form, p210 BCR-ABL1, is found in more than 90% of patients with chronic myelogenous leukaemia (CML) and in up to 15% of adult patients with de novoacute lymphoblastic leukaemia (ALL). " /// We have taken a new approach to determine if ablation of the genetic abnormality is sufficient for reversion by generating a conditional transgenic model of BCR-ABL1 (also known as BCR-ABL)-induced leukaemia.
BCR_ABL1- 25913326chronic myeloid leukemia;myeloid leukemia;leukemia - - A thirty-five nucleotides BCR-ABL1 insertion mutation of controversial significance confers resistance to imatinib in a patient with chronic myeloid leukemia (CML).. /// "Although deletion or insertion of nucleotides in BCR-ABL1 has rarely been described, we identified a CML patient with an already described 35 nucleotides insertion (BCR-ABL1(35INS)) of controversial significance, that confers resistance to imatinib but sensitivity to dasatinib.. "
BCR_ABL1- 20447687chronic myeloid leukemia;myeloid leukemia;leukemia - - A T315I mutation in e19a2 BCR/ABL1 chronic myeloid leukemia responding to dasatinib..
BCR_ABL1- 24752059chronic myeloid leukemia;myeloid leukemia;leukemia - - Molecular Response of e19a2 BCR-ABL1 Chronic Myeloid Leukemia With Double Philadelphia Chromosome to Dasatinib..
BCR_ABL1- 21641037chronic myeloid leukemia;myeloid leukemia;leukemia - - Molecular response to first line nilotinib in a patient with e19a2 BCR-ABL1 chronic myeloid leukemia..
BCR_ABL1- 24109527bone marrow fibrosis - - A minority of chronic myeloid leukaemia (CML) patients express variant transcripts of which the e19a2 BCR-ABL1 fusion is the most common. /// Rapid Evolution to Blast Crisis Associated with a Q252H ABL1 Kinase Domain Mutation in e19a2 BCR-ABL1 Chronic Myeloid Leukaemia.. /// "A case of e19a2 BCR-ABL1 CML is described in whom imatinib resistance, associated with a Q252H ABL1 kinase domain mutation, became apparent soon after initiation of TKI therapy. " /// Instances of tyrosine kinase inhibitor (TKI) resistance in e19a2 BCR-ABL1 CML patients have rarely been reported. /// This scenario of Q252H-associated TKI resistance with rapid BC transformation has not been previously documented in e19a2 BCR-ABL1 CML.
BCR_ABL1- 21072049acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia - - The first case of acute lymphoblastic leukemia with the e19a2 BCR-ABL1 transcript: imatinib therapy followed by unrelated donor transplantation induces a durable molecular response..
BCR_ABL1- 19136943prostate cancer - - As a proof of concept, we successfully used integrative transcriptome sequencing to 're-discover' the BCR-ABL1 (ref.
BCR_ABL1- 19157547acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia PCR;RT-PCR - However, BCR-ABL1 expression may not reflect the percentage of leukemic cells as FCM and IG/TCR rearrangement quantification do, and these methods are thus complementary.. /// The other discordant case showed high BCR-ABL1 RNA level while the other methods did not detect any MRD.
BCR_ABL1t(9;22) / t(9;22)(q34;q11) / 2171702chronic myeloid leukemia;myeloid leukemia;leukemia ISH - The association of 5' BCR and 3' ABL at the 5' junction of the chromosome 9 insert was typical of that found for the BCR-ABL fusion gene in other patients with the standard t(9;22) and CML.
BCR_ABL1t(9;22) / 23171293leukemia;sarcoma;lymphoma ISH - Fluorescence in situ hybridization performed on paraffin sections confirmed that both T-lymphoblast and myeloblast populations were positive for the t(9;22) BCR/ABL1 translocation.
BCR_ABL1- 24740226chronic myeloid leukemia;myeloid leukemia;leukemia - - The BCR-ABL1 fusion gene, the causative lesion of chronic myeloid leukemia (CML) in >95 % of newly presenting patients, offers both a therapeutic and diagnostic target. /// Real-time quantification assay to monitor BCR-ABL1 transcripts in chronic myeloid leukemia..
BCR_ABL1t(9;22) / 19479611chronic myeloid leukemia;myeloid leukemia;leukemia - - patients with submicroscopic deletion in the fusion region ABL/BCR of the sole t(9;22) vs.
BCR_ABL1- 9352747leukemia ISH - Philadelphia (Ph) chromosome formation results in the relocation of the ABL oncogene from the chromosome 9q34 to BCR region on 22q11, forming the BCR/ABL fusion gene.
BCR_ABL1- 17215855myeloproliferative disorder;chronic myeloid leukemia;myeloid leukemia;leukemia ISH - In CML the BCR-ABL1 fusion gene was detected in CD34+/CD133+ cells, granulo-monocytes, eosinophils, erythrocytes, megakaryocytes and B-lymphocytes. /// FIP1L1-PDGFRA in chronic eosinophilic leukemia and BCR-ABL1 in chronic myeloid leukemia affect different leukemic cells.. /// "Fluorescence in situ hybridization specific for BCR-ABL1 and for FIP1L1-PDGFRA was combined with cytomorphology or with lineage-restricted monoclonal antibodies and applied in CML and CEL, respectively. " /// "This study provided evidence for marked differences in the leukemic masses which are targeted by imatinib in CEL or CML, as harboring FIP1L1-PDGFRA or BCR-ABL1.. "
BCR_ABL1- 25183062glioblastoma multiforme - - The extraordinary success of imatinib in the treatment of BCR-ABL1 associated cancers underscores the need to identify novel functional gene fusions in cancer.
BCR_ABL1p24;q11.2 / t(9;22) / 22549126myeloproliferative disorder;leukemia ISH - Translocation (9;22)(q34;q11.2) resulting in BCR/ABL1 fusion at the molecular level is the hallmark of chronic myelogenous leukemia (CML).
BCR_ABL1t(9;22) / 22989955chronic myeloid leukemia;myeloid leukemia;leukemia ISH - Fluorescence in situ hybridization revealed an unusual signal pattern revealing the BCR-ABL1 fusion signal on chromosome 12, while no reciprocal ABL1-BCR fusion was detected on der(9) chromosome. /// Unusual location of BCR-ABL1 fusion sequences in a chronic myeloid leukemia patient.. /// "The relocation of BCR-ABL1 fusion sequences to 12p11 site in our patient represents a rare type of variant translocation, as in almost all patients the chimeric BCR-ABL1 gene is located on der(22) chromosome. " /// We describe a case of a chronic myeloid leukemia patient displaying the chimeric BCR-ABL1 gene on 12p11.
BCR_ABL1t(9;22;20)(q34;q11;p13) / t(9;22;20) / 1958592chronic myeloid leukemia;myeloid leukemia;leukemia ISH - The close association of 5'-BCR and 3'-ABL was demonstrated by field inversion gel electrophoresis, and in situ hybridization showed that BCR-ABL was located on the short arm of chromosome 20.
BCR_ABL1t(9;22) / 25901138chronic myeloid leukemia;myeloid leukemia;leukemia ISH - Neutrophilic-chronic myelogenous leukemia (CML-N) is a rare chronic myelogenous leukemia (CML) variant characterized by BCR-ABL1 positive chronic neutrophilia.
BCR_ABL1t(9;12) / t(9;12) / del(9) / 18656692acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia ISH - ETV6/ABL1 and BCR/ABL1 FK display similar activity but they may not be identical in function. /// Fusion kinases (FK) like BCR/ABL1 mediate leukemic transformation and represent therapeutic targets.
BCR_ABL1- 12419580chronic myeloid leukemia ISH - Fluorescence in situ hybridization studies showed that the 18p rearrangement resulted from translocation of the main part of chromosome 22 long arm to 18p, including BCR-ABL1 fusion. /// "The 18p abnormality resulted, thus, in loss of 18p and duplication of BCR-ABL1 in both patients. " /// "Identical abnormality of the short arm of chromosome 18 in two Philadelphia-positive chronic myelocytic leukemia patients with erythroblastic transformation, resulting in duplication of BCR-ABL1 fusion.. "
BCR_ABL1- 18425374- - - Together with previous findings, these data suggest that these variant translocations occur more often as a 3-break single-step process with no reciprocal ABL-BCR fusion.
BCR_ABL1t(9;22) / t(9;22) / 18156729acute lymphoblastic leukemia;lymphoblastic leukemia;leukemia ISH - Fluorescence in situ hybridization analysis showed two ABL-BCR fusion signals on the derivative chromosome 9 and one BCR-ABL fusion signal on the derivative chromosome 22.
BCR_ABL1t(3;5) / 20085582- ISH - We identified four patients who presented with BCR-ABL1 negative myeloproliferative neoplasms and cytogenetically visible abnormalities of chromosome band 5q31-35.
BCR_ABL1- 11810275chronic myeloid leukemia;myeloid leukemia;leukemia - - Leukemic cells of a patient diagnosed with chronic myeloid leukemia (CML) showed a complex BCR-ABL1 rearrangement hidden within a normal appearing karyotype.
BCR_ABL1- 22875628hematologic malignancy;hematologic malignancy ISH - Ruxolitinib-treated Ba/F3 cells transformed to IL3 independence by ETV6-JAK2 showed reduced proliferation and survival (IC(50) = 370 nM) compared with KG1A or Ba/F3 cells transformed by BCR-ABL1, SPBN1-FLT3 and ZMYM2-FGFR1 (IC(50) > 10 ?M for all).
BCR_ABL1- 25928096chronic myeloid leukemia;myeloid leukemia;leukemia - - Next generation sequencing (NGS) of amplicons larger than 1000?bp simplified and accelerated a process of characterization of patient-specific BCR-ABL1 genomic fusions. /// " In chronic myeloid leukemia, the identification of individual BCR-ABL1 fusions is required for the development of personalized medicine approach for minimal residual disease monitoring at the DNA level. " /// Characterization of 46 patient-specific BCR-ABL1 fusions and detection of SNPs upstream and downstream the breakpoints in chronic myeloid leukemia using next generation sequencing..
BCR_ABL1- 24339928chronic myeloid leukemia;myeloid leukemia;leukemia ISH - These results advance low Chibby1 expression associated with BCR-ABL1 as a component of beta catenin signaling in leukemic stem cells. /// "however, it is strictly dependent upon BCR-ABL1 expression because it was not observed at the moment of major molecular response under tyrosine kinase inhibitor therapy. " /// "We investigated the impact of BCR-ABL1 on Chibby1, a beta catenin antagonist involved in cell differentiation and transformation. "

ChimerSEQ

Top
The fusion gene pair BCR--ABL1 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
BCR_ABL1chr22/23524426/+ chr9/133729450/+ 22q11.23 9q34.12 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2817-03A Kinase; Oncogene; FusionScan
BCR_ABL1chr22/23632600/+ chr9/133729450/+ 22q11.23 9q34.12 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2901-03A Kinase; Oncogene; FusionScan
BCR_ABL1chr22/23632600/+ chr9/133729450/+ 22q11.23 9q34.12 Exonic hg19 In-Frame Inter-chr LAML TCGA-AB-2941-03A Kinase; Oncogene; FusionScan
BCR_ABL1chr22/23631808/ chr9/133738148/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA DQ898314 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632600/ chr9/133729451/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA M25946 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23654023/ chr9/133729451/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA AF487522 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23524427/ chr9/133747512/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA DQ912588 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23524426/ chr9/133738147/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA DQ898313 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632602/ chr9/133730188/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA EU236680 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23524426/ chr9/133729448/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA M19730 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23631779/ chr9/133729451/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA EF423615 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23631811/ chr9/133730186/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA AM491359 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23524430/ chr9/133730185/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA S72479 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23596172/ chr9/133729537/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA EU216070 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23631809/ chr9/133747514/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA DQ912589 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23631808/ chr9/133729449/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA AJ131467 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23603179/ chr9/133729540/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA EU216064 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23613779/ chr9/133729451/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA AM491362 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632601/ chr9/133747516/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA DQ912590 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23596172/ chr9/133762357/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA AF533988 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23631881/ chr9/133729090/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA AY789120 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23634575/ chr9/133607565/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA JQ425238 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632451/ chr9/133615066/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA U19408 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632564/ chr9/133614220/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA JQ425244 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632742/ chr9/133607147/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA JQ425253 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632845/ chr9/133727499/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA U19399 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23633428/ chr9/133651603/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA JQ425249 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23633595/ chr9/133705632/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA U19400 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632056/ chr9/133729676/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA AM886138 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632721/ chr9/133686163/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA JQ425239 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23633376/ chr9/133667600/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA JQ425251 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632358/ chr9/133729652/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA AM600680 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23631865/ chr9/133729719/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA AM400881 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23633710/ chr9/133674522/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA JQ425241 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23631916/ chr9/133722533/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA U19406 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23632600/ chr9/133596052/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA EU447303 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23603622/ chr9/133729451/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA EU216059 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23615935/ chr9/133729435/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr NA EU394717 Kinase; Oncogene; ChiTaRs
BCR_ABL1chr22/23615962/ chr9/133590436/ 22q11.23 9q34.12 Exonic hg19 - Inter-chr biphenotypic leukemia;acute myeloid leukemia;acute lymphoblastic leukemia;lymphoblastic lymphoma;chronic myeloid leukemia AB069693 Kinase; Oncogene; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair BCR--ABL1 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human DQ898314BCR--ABL1 BCR22 23631739 23631808 + 1 70 100 ABL19 133738148 133738220 + 69 141 100
Human M25946BCR--ABL1 BCR22 23631775 23632600 + 1 109 100 ABL19 133729451 133730372 + 110 468 100
Human AF487522BCR--ABL1 BCR22 23637274 23654023 + 1 379 100 ABL19 133729451 133729497 + 380 426 100
Human DQ912588BCR--ABL1 BCR22 23524261 23524427 + 1 167 100 ABL19 133747512 133747583 + 163 234 100
Human DQ898313BCR--ABL1 BCR22 23524261 23524426 + 1 166 100 ABL19 133738147 133738220 + 164 237 100
Human EU236680BCR--ABL1 BCR22 23630290 23632602 + 1 252 100 ABL19 133730188 133730234 + 251 297 100
Human M19730BCR--ABL1 BCR22 23524011 23524426 + 1 416 99.6 ABL19 133729448 133729525 + 414 491 100
Human AM491360BCR--ABL1 BCR22 23629427 23632602 + 1 297 100 ABL19 133730188 133738340 + 296 782 100
Human S72478BCR--ABL1 BCR22 23631784 23632602 + 1 102 100 ABL19 133730188 133730227 + 101 140 100
Human AJ131466BCR--ABL1 BCR22 23629349 23632600 + 1 373 99.8 ABL19 133729451 133738303 + 374 997 99.9
Human EF423615BCR--ABL1 BCR22 23630339 23631779 + 7 103 100 ABL19 133729451 133730234 + 103 323 100
Human AM491359BCR--ABL1 BCR22 23629427 23631811 + 1 223 99.6 ABL19 133730186 133738340 + 219 707 99.8
Human S72479BCR--ABL1 BCR22 23524336 23524430 + 1 95 100 ABL19 133730185 133730227 + 89 131 100
Human EU216070BCR--ABL1 BCR22 23523148 23596172 + 1 1467 100 ABL19 133729537 133729612 + 1467 1542 100
Human AM491361BCR--ABL1 BCR22 23523972 23524430 + 1 459 100 ABL19 133730185 133738340 + 453 942 100
Human AM491363BCR--ABL1 BCR22 23629427 23654023 + 1 835 99.8 ABL19 133729451 133738340 + 836 1496 99.7
Human AY043457BCR--ABL1 BCR22 23631705 23631811 + 1 107 100 ABL19 133730186 133730293 + 103 210 100
Human X07537BCR--ABL1 BCR22 23524381 23524426 + 1 46 100 ABL19 133729448 133729506 + 44 102 100
Human DQ912589BCR--ABL1 BCR22 23631704 23631809 + 6 111 100 ABL19 133747514 133747583 + 109 178 100
Human AJ131467BCR--ABL1 BCR22 23629349 23631808 + 1 298 100 ABL19 133729449 133738303 + 297 922 100
Human EU216071BCR--ABL1 BCR22 23523148 23632600 + 1 2059 100 ABL19 133729451 133761070 + 2060 5373 100
Human EU216064BCR--ABL1 BCR22 23523148 23603179 + 1 1504 100 ABL19 133729540 133729612 + 1503 1575 100
Human AM491362BCR--ABL1 BCR22 23523972 23613779 + 1 1097 100 ABL19 133729451 133738340 + 1098 1758 99.9
Human AF113911BCR--ABL1 BCR22 23523972 23524426 + 1 455 100 ABL19 133729448 133738303 + 453 1079 100
Human X06418BCR--ABL1 BCR22 23523105 23524426 + 1 1322 100 ABL19 133729448 133729493 + 1320 1365 97.9
Human DQ912590BCR--ABL1 BCR22 23631704 23632601 + 6 186 100 ABL19 133747516 133747583 + 186 253 100
Human EU216066BCR--ABL1 BCR22 23523148 23631808 + 1 1621 100 ABL19 133729449 133761070 + 1620 4935 100
Human AF533988BCR--ABL1 BCR22 23524254 23596172 + 1 361 99.8 ABL19 133762357 133763024 + 362 1029 99.9
Human AY789120BCR--ABL1 BCR22 23631731 23631881 + 1 151 100 ABL19 133729090 133729602 + 150 663 99.5
Human JQ425238BCR--ABL1 BCR22 23634499 23634575 + 1 77 100 ABL19 133607565 133607712 + 78 225 100
Human U19408BCR--ABL1 BCR22 23632424 23632451 + 1 25 100 ABL19 133615066 133615111 + 17 62 100
Human JQ425244BCR--ABL1 BCR22 23632485 23632564 + 1 80 100 ABL19 133614220 133614365 + 80 225 100
Human JQ425253BCR--ABL1 BCR22 23632627 23632742 + 1 116 100 ABL19 133607147 133607260 + 112 225 100
Human U19399BCR--ABL1 BCR22 23632826 23632845 + 1 20 100 ABL19 133727499 133727534 + 20 55 100
Human JQ425249BCR--ABL1 BCR22 23633292 23633428 + 1 137 100 ABL19 133651603 133651692 + 136 225 100
Human U19400BCR--ABL1 BCR22 23633576 23633595 + 1 20 100 ABL19 133705632 133705802 + 20 188 99.5
Human AM886138BCR--ABL1 BCR22 23631778 23632056 + 1 280 98.3 ABL19 133729676 133730250 + 279 853 100
Human JQ425239BCR--ABL1 BCR22 23632548 23632721 + 1 174 99.5 ABL19 133686163 133686213 + 175 225 100
Human JQ425251BCR--ABL1 BCR22 23633268 23633376 + 1 109 100 ABL19 133667600 133667715 + 110 225 100
Human AM600680BCR--ABL1 BCR22 23631780 23632358 + 1 579 99.9 ABL19 133729652 133730250 + 579 1176 100
Human AM400881BCR--ABL1 BCR22 23631795 23631865 + 1 71 100 ABL19 133729719 133730174 + 72 527 100
Human AB069693BCR--ABL1 BCR22 23615268 23615962 + 1 195 100 ABL19 133590436 133590492 - 193 249 100
Human JQ425241BCR--ABL1 BCR22 23633592 23633710 + 1 119 100 ABL19 133674522 133674627 + 120 225 100
Human U19406BCR--ABL1 BCR22 23631897 23631916 + 1 20 100 ABL19 133722533 133722593 + 19 79 100
Human EU447303BCR--ABL1 BCR22 23631739 23632600 + 1 145 100 ABL19 133596052 133730228 + 141 488 99.8
Human EU216059BCR--ABL1 BCR22 23523148 23603622 + 1 1647 100 ABL19 133729451 133729478 + 1647 1674 100
Human EU394717BCR--ABL1 BCR22 23615269 23615935 + 1 167 100 ABL19 133729435 133729506 + 167 238 100
Human EF158045BCR--ABL1 BCR22 23631739 23631808 + 1 70 100 ABL19 133729449 133730236 + 69 293 100

FARE-CAFE

Top
The fusion gene pair BCR--ABL1 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
BCR-ABL1 chronic myeloid leukemia,ALL, Diffuse large B-cell lymphoma Southern blot,PCR,DNA sequencing,G-Banding,FISH,RT-PCR (9;22)(q34;q11) PubMed:18408710

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
BCR-ABL1 BCR-ABL1-Isoform1 BCR _ _ 1 ABL1 133729448 1 0 aacaaggacaggggtcttcggagtCctgaactcagaagcccttcagcggccagtagc 17268511 _
BCR-ABL1 BCR-ABL1-Isoform2 BCR 23633696 0 1 ABL1 133662113 1 0 CCTCATAAACGCTGGTGTTTGGCTTGTCATAGAAGGGCATTTAAGTGACTTTGCCAAGAGAAACAGTAA _ U19398
BCR-ABL1 BCR-ABL1-Isoform3 BCR 23632845 0 1 ABL1 133727499 1 0 TGGGAGCTGGTGAGCTGCCCATAATGACATGATTTGGGATTACTCTTTCAGAGAA _ U19399
BCR-ABL1 BCR-ABL1-Isoform4 BCR 23633595 0 1 ABL1 133705632 1 0 CTAAAATTCTTTAAACCCTAAAGCGGATTTACTCTAAGGCAGTTCAGATTTGGTCCCAGCTGAGAATTATAGCCTGGAAATACCAACAGGAAAATCAGTGTCATTTGAAGGACAGTCATCTGTGCAGCCTGTGCATGAAATCATGGGTCTGAATTAGGCCCCATTCAAGATGCGGGGGTGTGGGGTTT _ U19400
BCR-ABL1 BCR-ABL1-Isoform5 BCR _ _ 1 ABL1 133657893 1 0 GATTAGCCAGGCTAGGCAGTTTTAAATCCTGGCTTTCCCCTTAACTTGGGTGGGATCACACCATTAACCGTGTTACCCCTCTGAAGCTTTGGCTCCCACACCTGTGAGATGTGAATGTTGATAACACACACCCACCTCATAGGATTAATGAGAACATGCCAAGATATAATGCGCTGAAGGTCTTAGCATGCCTGCGCAGAGCCCCAGCAT _ U19403
BCR-ABL1 BCR-ABL1-Isoform6 BCR _ _ 1 ABL1 133605821 1 0 AATTGCAGGGGTTTGGCAAGCACCTTTTCATATGTTTACTGGCCATTTGGAATATATGTGT _ U19404
BCR-ABL1 BCR-ABL1-Isoform7 BCR 23632451 0 1 ABL1 133615066 1 0 ACACAGTGTCCACCGGATGGATTTTATAAGTTGATCCAACCATGGTATGACTTCTGTGGGTAA _ U19408
BCR-ABL1 BCR-ABL1-Isoform8 BCR 23524426 0 1 ABL1 133729448 1 0 CAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCC _ X07537
BCR-ABL1 BCR-ABL1-Isoform9 BCR _ _ 1 ABL1 _ 1 _ aacaaggacaggggtcttcggagtCctgaactcaggtgatcca 17268511 _
BCR-ABL1 BCR-ABL1-Isoform10 BCR 23632615 0 1 ABL1 133729436 1 0 ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAGTAAGTACTGGTTTGCCCTTTCTCTTCCAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGC _ AH001427
BCR-ABL1 BCR-ABL1-Isoform11 BCR 23632600 0 1 ABL1 133729451 1 0 TGACCATCAATAAGGAAGATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTT _ AJ131466
BCR-ABL1 BCR-ABL1-Isoform12 BCR 23631808 0 1 ABL1 133729449 1 0 CTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTT _ AJ131467
BCR-ABL1 BCR-ABL1-Isoform13 BCR 23632600 0 1 ABL1 133729451 1 0 TCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAA _ M25946
BCR-ABL1 BCR-ABL1-Isoform14 BCR 23633068 0 1 ABL1 _ 1 _ ACAGCAGAGCAGATTTGGCTGCTCTGTCGAGCTGGATGGATACTACTTTTTTTTTCCTTTCCCTCTAAGTGGGGGTCTCCCCCAGCTACTGGAGCTGTCAGAACAAAGAGACAGGGTCTTGCT _ M31759
BCR-ABL1 BCR-ABL1-Isoform15 BCR 23632602 0 1 ABL1 133730188 1 0 ATTCCGCTGACCATCAATAAGGAAGATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGA _ S72478
BCR-ABL1 BCR-ABL1-Isoform16 BCR 23524430 0 1 ABL1 133730185 1 0 GTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGA _ S72479

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
BCR-ABL1 BCR-ABL1-Isoform1 - - 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform2 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform3 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform4 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform5 - - 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform6 - - 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform7 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform8 1) Bcr-Abl_Oligo
1) Bcr-Abl_Oligo
1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) RhoGEF
2) PH
3) C2
4) RhoGAP
5) SH3_1
1) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
2) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
3) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
4) Ras , C1_1 , RhoGAP
5) Ank_2 , P53 , SH3_1 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
BCR-ABL1 BCR-ABL1-Isoform9 - - - -BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
6) SH3_1
7) SH2
8) Pkinase_Tyr
9) F_actin_bind
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
6) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
7) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
8) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR-ABL1 BCR-ABL1-Isoform10 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform11 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform12 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform13 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
BCR-ABL1 BCR-ABL1-Isoform14 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
- -BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
3) SH3_1
4) SH2
5) Pkinase_Tyr
6) F_actin_bind
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
3) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
4) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
5) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR-ABL1 BCR-ABL1-Isoform15 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
1) SH2
2) Pkinase_Tyr
3) F_actin_bind
1) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) C2
2) RhoGAP
3) SH3_1
1) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
2) Ras , RhoGAP
3) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
BCR-ABL1 BCR-ABL1-Isoform16 1) Bcr-Abl_Oligo
1) Bcr-Abl_Oligo
1) SH2
2) Pkinase_Tyr
3) F_actin_bind
1) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
2) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
BCR 1) Bcr-Abl_Oligo
2) RhoGEF
3) PH
4) C2
5) RhoGAP
1) Bcr-Abl_Oligo
2) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
3) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
4) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
5) Ras , RhoGAP
ABL1 1) SH3_1
2) SH2
3) Pkinase_Tyr
4) F_actin_bind
1) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C
2) C1_1 , PI3Ka , SH3_1 , Y_phosphatase , C2 , PI3_PI4_kinase , SH3_2 , fn3 , PAG , Pkinase_Tyr , SOCS_box , PI3K_C2 , SH2 , STAT_bind
3) Inhibitor_Mig-6 , Y_phosphatase , Pkinase_Tyr , SH3_9 , EphA2_TM , CH , SH3_1 , Pkinase , BPS , AvrPto , FERM_M , SH2
1) RhoGEF
2) PH
3) C2
4) RhoGAP
5) SH3_1
1) C1_1 , G-alpha , Histone , PH , PH_5 , RGS , Ras , RasGEF_N , RhoGEF , SH3_9
2) Arf , BTK , C1_1 , CAMSAP_CH , Dynamin_M , IRS , PH , Pkinase , RA , Ras , RhoGEF , SH3_9 , Sif , WD40
3) C2 , PI-PLC-X , S_100 , EF-hand_10 , PI-PLC-Y , EF-hand_like , PLA2_B , FGF , SH2
4) Ras , RhoGAP
5) SH3_1 , Ank_2 , P53 , ubiquitin , Asp , PB1 , SH3_2 , F-protein , Pkinase_Tyr , Trypsin , Guanylate_kin , SH2 , p47_phox_C

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
BCR-ABL1 hsa-miR-203ahsa-miR-29a-3phsa-miR-30a-5phsa-miR-484hsa-miR-342-3phsa-miR-149-5phsa-miR-125b-5phsa-let-7b-5p hsa-miR-744-5phsa-miR-10a-5phsa-miR-197-3p Report assay,qPCR,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
BCR-ABL1 NM_004327.3 1) MITF_HUMAN
2) STAT1_HUMAN
3) RBL2_HUMAN
4) ZNF263_HUMAN
5) E2F4_HUMAN
6) RUNX1_HUMAN
7) ESTROGEN RECEPTOR ALPHA_HUMAN
8) ETS1_HUMAN
9) EGR1_HUMAN
10) FOS_HUMAN
11) GATA2_HUMAN
12) GATA3_HUMAN
13) SOX2_HUMAN
14) E2F1_HUMAN
15) TAL1_HUMAN
16) CTCF_HUMAN
17) BRG1_HUMAN
18) HNF4A_HUMAN
19) TFAP2C_HUMAN
20) FOXA1_HUMAN
21) CEBPA_HUMAN
22) STAT6_HUMAN
23) ESR1_HUMAN
24) ESR2_HUMAN
25) MEIS1_HUMAN A
26) FOXP1_HUMAN A
27) NR1H3_HUMAN A
28) SPI1_HUMAN
1) RB1_HUMAN
2) P53_HUMAN
3) E2F1_HUMAN
4) SOX2_HUMAN
5) CTCF_HUMAN
6) SETDB1_HUMAN
7) TRIM24_HUMAN
8) VDR_HUMAN
1) 21258399
2) 19122651
3) 20385362
4) 19887448
5) 21247883
6) 20019798
7) 20547749
8) 20019798
9) 20690147
10) 20139302
11) 21808000
12) 21878914
13) 21211035
14) 21310950
15) 21795385
16) 19505939
17) 21646355
18) 21572391
19) 21572391
20) 20219941
21) 21828071
22) 20348243
23) 21235772
24) 21241896 A
25) 21924763 A
26) 22292898 A
27) 21241896

TicDB

Top
The fusion gene pair BCR--ABL1 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
BCR ABL1 17268511 aacaaggacaggggtcttcggagtCctgaactcagaagcccttcagcggccagtagc
BCR ABL1 17268511 aacaaggacaggggtcttcggagtCctgaactcaggtgatcca
BCR ABL1 AH001427 ATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAGTAAGTACTGGTTTGCCCTTTCTCTTCCAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGC
BCR ABL1 AJ131466 TGACCATCAATAAGGAAGATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTT
BCR ABL1 AJ131467 CTGACATCCGTGGAGCTGCAGATGCTGACCAACTCGTGTGTGAAACTCCAGACTGTCCACAGCATTCCGCTGACCATCAATAAGGAAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAAAATGACCCCAACCTTTTCGTT
BCR ABL1 M25946 TCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCCGCTCGTTGGAACTCCAAGGAAAACCTTCTCGCTGGACCCAGTGAA
BCR ABL1 M31759 ACAGCAGAGCAGATTTGGCTGCTCTGTCGAGCTGGATGGATACTACTTTTTTTTTCCTTTCCCTCTAAGTGGGGGTCTCCCCCAGCTACTGGAGCTGTCAGAACAAAGAGACAGGGTCTTGCT
BCR ABL1 S72478 ATTCCGCTGACCATCAATAAGGAAGATGATGAGTCTCCGGGGCTCTATGGGTTTCTGAATGTCATCGTCCACTCAGCCACTGGATTTAAGCAGAGTTCAAGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGA
BCR ABL1 S72479 GTTGTCGTGTCCGAGGCCACCATCGTGGGCGTCCGCAAGACCGGGCAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAGGTGAAAAGCTCCGGGTCTTAGGCTATAATCACAATGGGGA
BCR ABL1 U19398 CCTCATAAACGCTGGTGTTTGGCTTGTCATAGAAGGGCATTTAAGTGACTTTGCCAAGAGAAACAGTAA
BCR ABL1 U19399 TGGGAGCTGGTGAGCTGCCCATAATGACATGATTTGGGATTACTCTTTCAGAGAA
BCR ABL1 U19400 CTAAAATTCTTTAAACCCTAAAGCGGATTTACTCTAAGGCAGTTCAGATTTGGTCCCAGCTGAGAATTATAGCCTGGAAATACCAACAGGAAAATCAGTGTCATTTGAAGGACAGTCATCTGTGCAGCCTGTGCATGAAATCATGGGTCTGAATTAGGCCCCATTCAAGATGCGGGGGTGTGGGGTTT
BCR ABL1 U19403 GATTAGCCAGGCTAGGCAGTTTTAAATCCTGGCTTTCCCCTTAACTTGGGTGGGATCACACCATTAACCGTGTTACCCCTCTGAAGCTTTGGCTCCCACACCTGTGAGATGTGAATGTTGATAACACACACCCACCTCATAGGATTAATGAGAACATGCCAAGATATAATGCGCTGAAGGTCTTAGCATGCCTGCGCAGAGCCCCAGCAT
BCR ABL1 U19404 AATTGCAGGGGTTTGGCAAGCACCTTTTCATATGTTTACTGGCCATTTGGAATATATGTGT
BCR ABL1 U19408 ACACAGTGTCCACCGGATGGATTTTATAAGTTGATCCAACCATGGTATGACTTCTGTGGGTAA
BCR ABL1 X07537 CAGATCTGGCCCAACGATGGCGAGGGCGCCTTCCATGGAGACGCAGAAGCCCTTCAGCGGCCAGTAGCATCTGACTTTGAGCCTCAGGGTCTGAGTGAAGCC

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair BCR--ABL1 information is available in TUMOR FUSION Gene Data Portal.
CancerTCGA_barcodeFusionPairEvalue5'Gene_Junction3'Gene_JunctionTierFrameTNWGS_validation
LAML AB-2817-03A BCR__ABL1 0.035 22:23524426/1 9:133729451/1 tier1 In-frame 2054 NA
LAML AB-2901-03A BCR__ABL1 0.035 22:23632600/1 9:133729451/1 tier2 In-frame 2055 NA
LAML AB-2941-03A BCR__ABL1 0.035 22:23632600/1 9:133729451/1 tier1 In-frame 2056 NA
LAML AB-2944-03A BCR__ABL1 0.035 22:23524426/1 9:133729451/1 tier1 In-frame 2057 NA

FusionCancer

Top
The fusion gene pair BCR--ABL1 information is available in FusionCancer Database.
Database_IDHead_gene_symbolHead_breakpoint_locationTail_gene_symbolTail_breakpoint_locationCancer_typeSRA
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR307930
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR307930
FUSC001404BCRchr22:23632599ABL1chr9:133655755Chronic myelogenous leukemiaSRR307930
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR307931
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR307931
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315299
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315299
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315300
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315300
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315305
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315305
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315306
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315306
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315309
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315309
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315310
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315310
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315311
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315311
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315312
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315312
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315336
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315336
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR315337
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR315337
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR387661
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR387661
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR387662
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR387662
FUSC001404BCRchr22:23632599ABL1chr9:133655755Chronic myelogenous leukemiaSRR387662
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393760
FUSC001404BCRchr22:23632599ABL1chr9:133655755Chronic myelogenous leukemiaSRR393760
FUSC001404BCRchr22:23631807ABL1chr9:133729450Chronic myelogenous leukemiaSRR393761
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR393761
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393761
FUSC001404BCRchr22:23631807ABL1chr9:133729450Chronic myelogenous leukemiaSRR393762
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR393762
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393762
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR393763
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393763
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393764
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR393764
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393764
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393765
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR393765
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393765
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393766
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR393766
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393767
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR393767
FUSC001404BCRchr22:23632599ABL1chr9:133729450Chronic myelogenous leukemiaSRR393768
FUSC001404BCRchr22:23632600ABL1chr9:133729451Chronic myelogenous leukemiaSRR393768

ConjoinG

Top
The fusion gene pair BCR--ABL1 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene BCR--ABL1 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene BCR--ABL1 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene BCR--ABL1 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene BCR--ABL1 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene BCR--ABL1 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair BCR--ABL1 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene BCR--ABL1 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene BCR--ABL1 has not been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. The list has been manually curated by FusionCatcher software. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene BCR is a known oncogene according to ONGENE database.


The tail gene ABL1 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene BCR is cancer associated according to Bushman Cancer Gene database.


The tail gene ABL1 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene BCR is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene ABL1 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene BCR--ABL1 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene BCR--ABL1 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair BCR--ABL1 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene BCR--ABL1 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene BCR--ABL1 has been found in a healthy sample. It has been found in GTEx database of healthy tissues (thru FusionAnnotator). A candidate fusion gene having this label has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair BCR--ABL1 information is available in Klijn Dataset.

Cell lineGene 5'Gene 3'Read evidenceKinaseChromosome 5'Position 5'Chromosome 3'Position 3'Fusion type DNAFusion type RNAFusion protein lengthTissueKnown Fusion
KU812BCRABL138Y22236326009133729451TranslocinFrame2030LymphoidFull fusion known
K-562BCRABL176Y22236326009133729451TranslocinFrame2030LymphoidFull fusion known
SUP-B15BCRABL122Y22235244269133729451TranslocinFrame1529LymphoidFull fusion known
HNT-34BCRABL140Y22236326009133729451TranslocinFrame2030LymphoidFull fusion known

Fimereli_Dataset

Top
The fusion gene pair BCR--ABL1 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair BCR--ABL1 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
BCR--ABL1Development and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumorshttps://doi.org/10.1016/j.jmoldx.2018.03.007
BCR--ABL1Development and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumorshttps://doi.org/10.1016/j.jmoldx.2018.03.007

Cortex_Dataset

Top
Fusion gene BCR--ABL1 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair BCR--ABL1 information is not available in ChromothripsisDB database.