ASPSCR1--TFE3

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

ASPSCR1 TFE3

COSMIC

The fusion gene pair ASPSCR1--TFE3 information is available in COSMIC database.

Link
ASPSCR1--TFE3

ChimerKB

Top
The fusion gene pair ASPSCR1--TFE3 information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
ASPSCR1_TFE3-/1030/ -/1146/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
ASPSCR1_TFE3-/1030/ -/1041/ Exonic hg19 - - - Oncogene; Cosmic_recurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 11244503 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 17543078 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 18382356 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 12769020 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 18594808 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 18176180 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 renal cell carcinoma - 15138551 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 renal cell carcinoma - 11438465 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 17378669 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 15634444 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 19384069 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 18713311 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 renal cell carcinoma - 19228722 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 18094412 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 19380023 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 alveolar soft part sarcoma - 19539846 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg19 papillary renal cell carcinoma - 11358836 Oncogene; Cosmic_nonrecurrent
ASPSCR1_TFE3-/-/ -/-/ - hg18 adenocarcinoma - - Oncogene; Mitelman
ASPSCR1_TFE3-/-/ -/-/ - hg18 alveolar soft part sarcoma - - Oncogene; Mitelman
ASPSCR1_TFE3-/0/ -/0/ Exonic hg18 - - - Oncogene; TICdb
ASPSCR1_TFE3chr17/79954722/ chrX/48891766/ Genomic hg19 non–clear cell renal carcinoma RT-PCR 25401301 Oncogene; Literature_Curation
ASPSCR1_TFE3-/-/ -/-/ - hg18 alveolar soft part sarcoma - 11244503 Oncogene; OMIM

ChimerPUB

Top
The fusion gene pair ASPSCR1--TFE3 information is available in CHIMERPUB (CHIMERDB 3.0) database.

Fusion_pairTranslocationPMIDDiseaseValidationGene TypeSentence_highlight
ASPSCR1_TFE3- 25048860kidney cancer - - A total of five TFE3 gene fusions (PRCC-TFE3, ASPSCR1-TFE3, SFPQ-TFE3, NONO-TFE3, and CLTC-TFE3) and one TFEB gene fusion (MALAT1-TFEB) have been identified in RCC tumours and characterized at the mRNA transcript level. /// "A total of five TFE3 gene fusions (PRCC-TFE3, ASPSCR1-TFE3, SFPQ-TFE3, NONO-TFE3, and CLTC-TFE3) and one TFEB gene fusion (MALAT1-TFEB) have been identified in RCC tumours and characterized at the mRNA transcript level. "
ASPSCR1_TFE3- 25453902alveolar soft part sarcoma - - We proved the oncogenic capacity of this fusion gene by driving sarcomagenesis in mice from conditional ASPSCR1-TFE3 expression.
ASPSCR1_TFE3- 23288701alveolar soft part sarcoma;sarcoma - - Combining integrated genomics and functional genomics to dissect the biology of a cancer-associated, aberrant transcription factor, the ASPSCR1-TFE3 fusion oncoprotein. /// "As the results indicated that ASPSCR1-TFE3 functions predominantly as a strong transcriptional activator, we hypothesized that a subset of its up-regulated direct targets mediate its oncogenic properties. " /// "Here we examined the functional properties of the ASPSCR1-TFE3 fusion oncoprotein, defined its target promoters on a genome-wide basis and performed a high-throughput RNA interference screen to identify which of its transcriptional targets contribute to cancer cell proliferation. " /// "Combining integrated genomics and functional genomics to dissect the biology of a cancer-associated, aberrant transcription factor, the ASPSCR1-TFE3 fusion oncoprotein.. " /// "As validation of this approach to identify genuine ASPSCR1-TFE3 target genes, two up-regulated genes bound by ASPSCR1-TFE3, CYP17A1 and UPP1, were shown by multiple lines of evidence to be direct, endogenous targets of transactivation by ASPSCR1-TFE3." /// "Genome-wide location analysis performed on the FU-UR-1 cell line, which expresses endogenous ASPSCR1-TFE3, identified 2193 genes bound by ASPSCR1-TFE3. " /// "Integration of these data with expression profiles of ASPS tumour samples and inducible cell lines expressing ASPSCR1-TFE3 defined a subset of 332 genes as putative up-regulated direct targets of ASPSCR1-TFE3, including MET (a previously known target gene) and 64 genes as down-regulated targets of ASPSCR1-TFE3. " /// "As validation of this approach to identify genuine ASPSCR1-TFE3 target genes, two up-regulated genes bound by ASPSCR1-TFE3, CYP17A1 and UPP1, were shown by multiple lines of evidence to be direct, endogenous targets of transactivation by ASPSCR1-TFE3. " /// We first confirmed that ASPSCR1-TFE3 has a predominantly nuclear localization and functions as a stronger transactivator than native TFE3.
ASPSCR1_TFE3t(X;17)(p11.2;q25) / / 20002771alveolar soft part sarcoma - - Activated c-Met and the phosphorylation of its downstream effectors validate an intact signalling cascade probably induced by the ASPSCR1-TFE3 chimeric transcription factor. /// Activated c-Met and the phosphorylation of its downstream effectors validate an intact signalling cascade probably induced by the ASPSCR1-TFE3 chimeric transcription factor.
ASPSCR1_TFE3- 21835426granular cell tumors - - Technique for differentiating alveolar soft part sarcoma from other tumors in paraffin-embedded tissue: comparison of immunohistochemistry for TFE3 and CD147 and of reverse transcription polymerase chain reaction for ASPSCR1-TFE3 fusion transcript. /// "In non-alveolar soft part sarcoma tumors, the ASPSCR1-TFE3 fusion transcript was not detected; however, the TFE3 immunoreactivity was observed in 2 of 5 granular cell tumors." /// "Three important characteristics of alveolar soft part sarcoma, the presence of ASPSCR1-TFE3 fusion transcript, nuclear immunoreactivity for TFE3, and immunoreactivity for monocarboxylate transporter 1 and CD147, have recently been reported." /// "Thus, detection of the ASPSCR1-TFE3 fusion transcript was considered applicable for formalin-fixed, paraffin-embedded tissues with superior sensitivity as compared with TFE3 immunohistochemical staining. " /// "To identify the best marker for alveolar soft part sarcoma in formalin-fixed, paraffin-embedded tissues, we evaluated the sensitivity and specificity of the detection of the ASPSCR1-TFE3 fusion transcript along with the immunoreactivity for TFE3 and CD147 in 24 alveolar soft part sarcomas and 23 non-alveolar soft part sarcoma tumors, including 5 granular cell tumors, 5 paragangliomas, 3 clear cell sarcomas, and 10 clear cell renal cell carcinomas. " /// "The ASPSCR1-TFE3 fusion transcript was detected in 24 of 24 alveolar soft part sarcomas (7 type 1, 17 type 2), and TFE3 immunoreactivity was observed in 22 of 24 alveolar soft part sarcomas. " /// Our results demonstrate that the most sensitive marker of alveolar soft part sarcoma was the presence of the ASPSCR1-TFE3 fusion transcript. /// "Three important characteristics of alveolar soft part sarcoma, the presence of ASPSCR1-TFE3 fusion transcript, nuclear immunoreactivity for TFE3, and immunoreactivity for monocarboxylate transporter 1 and CD147, have recently been reported. " /// Technique for differentiating alveolar soft part sarcoma from other tumors in paraffin-embedded tissue: comparison of immunohistochemistry for TFE3 and CD147 and of reverse transcription polymerase chain reaction for ASPSCR1-TFE3 fusion transcript.. /// "In alveolar soft part sarcomas with unusual locations or histology, we consider that the detection of the ASPSCR1-TFE3 fusion transcript would be the highly effective diagnostic technique.. " /// "In non-alveolar soft part sarcoma tumors, the ASPSCR1-TFE3 fusion transcript was not detected. "

ChimerSEQ

Top
The fusion gene pair ASPSCR1--TFE3 information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
ASPSCR1_TFE3chr17/79954722/ chrX/48891659/ 17q25.3 Xp11.23 Exonic hg19 - Inter-chr alveolar soft part sarcoma renal cell carcinoma AY034077 Oncogene; ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair ASPSCR1--TFE3 information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AY034077ASPSCR1--TFE3 ASPSCR117 79954636 79954722 + 1 87 100 TFE3X 48891659 48891767 - 87 195 100
Human AY034078ASPSCR1--TFE3 ASPSCR117 79954636 79954722 + 1 87 100 TFE3X 48891659 48895640 - 87 300 100

FARE-CAFE

Top
The fusion gene pair ASPSCR1--TFE3 information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
ASPSCR1-TFE3 Renal Cell Carcinoma PCR,RACE,Q-banding,FISH,RT-PCR t(X;17)(p11;q25) PubMed:11438465

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform1 ASPSCR1 _ _ 1 TFE3 48895535 0 0 accacaggactgcagctccccagcacgCccgtggaccgggag 11438465 _
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform2 ASPSCR1 _ _ 1 TFE3 48895908 0 1 cacctgcagcaggcgcgccggcagcagCccgtggaccgggag 11438465 _
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform3 ASPSCR1 79954722 0 1 TFE3 48895550 0 1 AAGAAGTCCAAGTCGGGCCAGGATCCCCAGCAGGAGCAGGAGCAGGAGCGGGAGCGGGATCCCCAGCAGGAGCAGGAGCGGGAGCGGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTG 17149613 _
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform4 ASPSCR1 79954722 0 1 TFE3 48891659 0 1 AAGAAGTCCAAGTCGGGCCAGGATCCCCAGCAGGAGCAGGAGCAGGAGCGGGAGCGGGATCCCCAGCAGGAGCAGGAGCGGGAGCGGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGG 17149613 _
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform5 ASPSCR1 79954722 0 1 TFE3 48891659 0 1 AAGAAGTCCAAGTCGGGCCAGGATCCCCAGCAGGAGCAGGAGCAGGAGCGGGAGCGGGATCCCCAGCAGGAGCAGGAGCGGGAGCGGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGG _ AY034077
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform6 ASPSCR1 79954722 0 1 TFE3 48891659 0 1 AAGAAGTCCAAGTCGGGCCAGGATCCCCAGCAGGAGCAGGAGCAGGAGCGGGAGCGGGATCCCCAGCAGGAGCAGGAGCGGGAGCGGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGG _ AY034078

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform1 - - - -ASPSCR1 1) TUG-UBL1
2) UBX
1) CDC48_2 , CDC48_N , UBX
TFE3 1) MITF_TFEB_C_3_N
2) HLH
3) DUF3371
1) HLH , Myc-LZ , PAS , LIM
1) TUG-UBL1
2) UBX
3) MITF_TFEB_C_3_N
4) HLH
5) DUF3371
1) CDC48_2 , CDC48_N , UBX
2) HLH , Myc-LZ , PAS , LIM
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform2 - - - -ASPSCR1 1) TUG-UBL1
2) UBX
1) CDC48_2 , CDC48_N , UBX
TFE3 1) MITF_TFEB_C_3_N
2) HLH
3) DUF3371
1) HLH , Myc-LZ , PAS , LIM
1) TUG-UBL1
2) UBX
3) MITF_TFEB_C_3_N
4) HLH
5) DUF3371
1) CDC48_2 , CDC48_N , UBX
2) HLH , Myc-LZ , PAS , LIM
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform3 1) TUG-UBL1
- - -ASPSCR1 1) TUG-UBL1
2) UBX
1) CDC48_2 , CDC48_N , UBX
TFE3 1) MITF_TFEB_C_3_N
2) HLH
3) DUF3371
1) HLH , Myc-LZ , PAS , LIM
1) UBX
2) MITF_TFEB_C_3_N
3) HLH
4) DUF3371
1) CDC48_2 , CDC48_N , UBX
2) HLH , Myc-LZ , PAS , LIM
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform4 1) TUG-UBL1
- - -ASPSCR1 1) TUG-UBL1
2) UBX
1) CDC48_2 , CDC48_N , UBX
TFE3 1) MITF_TFEB_C_3_N
2) HLH
3) DUF3371
1) HLH , Myc-LZ , PAS , LIM
1) UBX
2) MITF_TFEB_C_3_N
3) HLH
4) DUF3371
1) CDC48_2 , CDC48_N , UBX
2) HLH , Myc-LZ , PAS , LIM
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform5 1) TUG-UBL1
- - -ASPSCR1 1) TUG-UBL1
2) UBX
1) CDC48_2 , CDC48_N , UBX
TFE3 1) MITF_TFEB_C_3_N
2) HLH
3) DUF3371
1) HLH , Myc-LZ , PAS , LIM
1) UBX
2) MITF_TFEB_C_3_N
3) HLH
4) DUF3371
1) CDC48_2 , CDC48_N , UBX
2) HLH , Myc-LZ , PAS , LIM
ASPSCR1-TFE3 ASPSCR1-TFE3-Isoform6 1) TUG-UBL1
- - -ASPSCR1 1) TUG-UBL1
2) UBX
1) CDC48_2 , CDC48_N , UBX
TFE3 1) MITF_TFEB_C_3_N
2) HLH
3) DUF3371
1) HLH , Myc-LZ , PAS , LIM
1) UBX
2) MITF_TFEB_C_3_N
3) HLH
4) DUF3371
1) CDC48_2 , CDC48_N , UBX
2) HLH , Myc-LZ , PAS , LIM

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
ASPSCR1-TFE3 hsa-miR-335-5phsa-miR-455-3p hsa-let-7b-5p Microarray,NGS

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
ASPSCR1-TFE3 NM_001251888.1 - - -

TicDB

Top
The fusion gene pair ASPSCR1--TFE3 information is available in TICDB.
HeadGeneTailGenePubmedIDSequence
ASPSCR1 TFE3 11438465 accacaggactgcagctccccagcacgCccgtggaccgggag
ASPSCR1 TFE3 11438465 cacctgcagcaggcgcgccggcagcagCccgtggaccgggag
ASPSCR1 TFE3 17149613 AAGAAGTCCAAGTCGGGCCAGGATCCCCAGCAGGAGCAGGAGCAGGAGCGGGAGCGGGATCCCCAGCAGGAGCAGGAGCGGGAGCGGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTG
ASPSCR1 TFE3 17149613 AAGAAGTCCAAGTCGGGCCAGGATCCCCAGCAGGAGCAGGAGCAGGAGCGGGAGCGGGATCCCCAGCAGGAGCAGGAGCGGGAGCGGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGG
ASPSCR1 TFE3 AY034077 AAGAAGTCCAAGTCGGGCCAGGATCCCCAGCAGGAGCAGGAGCAGGAGCGGGAGCGGGATCCCCAGCAGGAGCAGGAGCGGGAGCGGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGG
ASPSCR1 TFE3 AY034078 AAGAAGTCCAAGTCGGGCCAGGATCCCCAGCAGGAGCAGGAGCAGGAGCGGGAGCGGGATCCCCAGCAGGAGCAGGAGCGGGAGCGGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGG

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair ASPSCR1--TFE3 information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair ASPSCR1--TFE3 information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair ASPSCR1--TFE3 information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene ASPSCR1--TFE3 has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene ASPSCR1--TFE3 is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene ASPSCR1--TFE3 is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene ASPSCR1--TFE3 is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene ASPSCR1--TFE3 was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair ASPSCR1--TFE3 information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene ASPSCR1--TFE3 is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene ASPSCR1--TFE3 has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene ASPSCR1 is a known oncogene according to ONGENE database.


The tail gene TFE3 is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene ASPSCR1 is cancer associated according to Bushman Cancer Gene database.


The tail gene TFE3 is cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene ASPSCR1 is proto-oncogene or tumor suppresor gene according to Uniprot database.


The tail gene TFE3 is proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene ASPSCR1--TFE3 is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene ASPSCR1--TFE3 is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair ASPSCR1--TFE3 information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene ASPSCR1--TFE3 is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene ASPSCR1--TFE3 has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair ASPSCR1--TFE3 information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair ASPSCR1--TFE3 information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair ASPSCR1--TFE3 is found in known fusion genelist compiled from literature.

FusionGeneArticleLink
ASPSCR1--TFE3RNA sequencing of Xp11 translocation-associated cancers reveals novel gene fusions and distinctive clinicopathologic correlationshttps://www.ncbi.nlm.nih.gov/pubmed/29713041
ASPSCR1--TFE3The pathology of soft tissue sarcomas (Marta Sbaraglia and Angelo P. Dei Tos; ONCOLOGY IMAGING)https://doi.org/10.1007/s11547-018-0882-7

Cortex_Dataset

Top
Fusion gene ASPSCR1--TFE3 is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair ASPSCR1--TFE3 information is not available in ChromothripsisDB database.