AFF1--MLL

Hyperlinks to databases below
COSMIC CHIMERKB CHIMERPUB CHIMERSEQ CHITARS
FARE-CAFE TICDB TUMOR_FUSION_GDPFusionCancerConjoinG
1000Genome18CancersBodymap2HPANon_Tumor_Cells
Babiceanu_DatasetBanned_DatasetKnown_FusionsONGene DatabaseBushman Cancer Gene Database
Tumor Gene Set By UniprotOesophagus_DatasetGliomas_DatasetProstate_DatasetPancreases_Dataset
GTExKlijn_DatasetFimereli_Dataset Literature Cortex_Dataset
ChromothripsisDB

Link to Genecards:

AFF1 MLL

COSMIC

The fusion gene pair AFF1--MLL information is not available in COSMIC database.

ChimerKB

Top
The fusion gene pair AFF1--MLL information is available in CHIMERKB (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)Breakpoint_TypeGenome_BuildDiseaseValidationPMIDGene TypeSource
AFF1_MLLchr4/88024832/+ chr11/118355577/+ Exonic hg19 - - - - GenBank
AFF1_MLLchr4/87999280/+ chr11/118359329/+ Exonic hg19 - - - - GenBank
AFF1_MLLchr4/87983594/+ chr11/118359329/+ Exonic hg19 - - - - GenBank
AFF1_MLL-/-/ -/-/ - hg18 acute leukemia - 8506309 - OMIM

ChimerPUB

Top
The fusion gene pair AFF1--MLL information is not available in CHIMERPUB (CHIMERDB 3.0) database.

ChimerSEQ

Top
The fusion gene pair AFF1--MLL information is available in CHIMERSEQ (CHIMERDB 3.0) database.

Fusion_pair5'Gene Junction (Chr/Position/Strand)3'Gene Junction (Chr/Position/Strand)5'Gene_locus3'Gene_locusBreakpoint_TypeGenome_BuildFrameChr_infoCancertype_or_diseaseBarcodeIDGene TypeSource
AFF1_MLLchr4/87968752/ chr11/118359327/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AF487906 - ChiTaRs
AFF1_MLLchr4/87969550/ chr11/118354832/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AJ408946 - ChiTaRs
AFF1_MLLchr4/88005317/ chr11/118354896/ 4q22.1 11q23.3 Exonic hg19 - Inter-chr NA AF177239 - ChiTaRs
AFF1_MLLchr4/88010904/ chr11/118355645/ 4q22.1 11q23.3 Exonic hg19 - Inter-chr NA AJ408936 - ChiTaRs
AFF1_MLLchr4/88011400/ chr11/118355431/ 4q22.1 11q23.3 Exonic hg19 - Inter-chr NA AJ408921 - ChiTaRs
AFF1_MLLchr4/87994386/ chr11/118355735/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AJ408952 - ChiTaRs
AFF1_MLLchr4/87976145/ chr11/118354704/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AF397907 - ChiTaRs
AFF1_MLLchr4/87989217/ chr11/118358015/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AY288760 - ChiTaRs
AFF1_MLLchr4/87975860/ chr11/118359135/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AF487904 - ChiTaRs
AFF1_MLLchr4/87998593/ chr11/118358993/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AJ408916 - ChiTaRs
AFF1_MLLchr4/88011965/ chr11/118355475/ 4q22.1 11q23.3 Exonic hg19 - Inter-chr NA AM050777 - ChiTaRs
AFF1_MLLchr4/88007918/ chr11/118353544/ 4q22.1 11q23.3 Exonic hg19 - Inter-chr NA AF177235 - ChiTaRs
AFF1_MLLchr4/87999616/ chr11/118353433/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AJ408938 - ChiTaRs
AFF1_MLLchr4/88012888/ chr11/118357698/ 4q22.1 11q23.3 Exonic hg19 - Inter-chr NA AY288767 - ChiTaRs
AFF1_MLLchr4/87979861/ chr11/118355304/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AJ408950 - ChiTaRs
AFF1_MLLchr4/87969718/ chr11/118355457/ 4q21.3 11q23.3 Exonic hg19 - Inter-chr NA AY288769 - ChiTaRs

ChiTaRS 2.1

Top
The fusion gene pair AFF1--MLL information is available in CHITARS database.

OrganismChimeraIDFusion genepairHead geneTail gene
GeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%IdentGeneChromosomeGenomic_startGenomic_stopStrandFusiongene_startposFusiongene_endpos%Ident
Human AF487906AFF1--MLL AFF14 87968543 87968752 + 1 211 98.6 MLL11 118359327 118360590 + 203 435 99.6
Human AJ408946AFF1--MLL AFF14 87969487 87969550 + 1 64 100 MLL11 118354832 118354895 + 63 126 100
Human AF177239AFF1--MLL AFF14 87968312 88005317 + 1 481 100 MLL11 118354896 118355013 + 479 596 100
Human AF492831AFF1--MLL AFF14 87968543 87968752 + 1 211 98.6 MLL11 118359327 118359417 + 203 293 100
Human AJ408936AFF1--MLL AFF14 88010843 88010904 + 1 62 100 MLL11 118355645 118355710 + 60 125 100
Human AJ408921AFF1--MLL AFF14 88011333 88011400 + 1 68 100 MLL11 118355431 118355493 + 67 129 100
Human AJ408952AFF1--MLL AFF14 87994313 87994386 + 1 74 100 MLL11 118355735 118355792 + 68 125 100
Human AF397907AFF1--MLL AFF14 87975707 87976145 + 1 439 100 MLL11 118354704 118355013 + 438 747 100
Human AY288760AFF1--MLL AFF14 87988892 87989217 + 1 326 99.4 MLL11 118358015 118358110 + 327 422 99
Human AF487904AFF1--MLL AFF14 87975560 87975860 + 36 336 99.7 MLL11 118359135 118360873 + 335 2073 99.7
Human AJ408916AFF1--MLL AFF14 87998537 87998593 + 1 57 100 MLL11 118358993 118359060 + 56 123 100
Human AF177238AFF1--MLL AFF14 87968312 88005317 + 1 481 100 MLL11 118354896 118355013 + 479 596 100
Human AM050777AFF1--MLL AFF14 88011767 88011965 + 1 199 100 MLL11 118355475 118355700 + 200 425 100
Human AF177235AFF1--MLL AFF14 88007606 88007918 + 1 313 100 MLL11 118353544 118354403 + 313 1175 99.1
Human AJ408938AFF1--MLL AFF14 87999557 87999616 + 1 60 100 MLL11 118353433 118353502 + 60 124 100
Human AY288767AFF1--MLL AFF14 88012714 88012888 + 1 175 100 MLL11 118357698 118357770 + 174 246 100
Human AJ408950AFF1--MLL AFF14 87979793 87979861 + 1 69 100 MLL11 118355304 118355365 + 68 129 100
Human AY288769AFF1--MLL AFF14 87969488 87969718 + 1 229 100 MLL11 118355457 118355631 + 230 404 100

FARE-CAFE

Top
The fusion gene pair AFF1--MLL information is available in FARE-CAFE.

Cancer Information
Fusion_ProteinCancer_TypeFP_Experimental_MethodFP_KaryotypeFP_Reference
AFF1/AF4/MLLT2-MLL Acute Lymphoblastic Leukemia FISH,Southern blot,SSCP,PCR,DNA sequencing,LDI-PCR,Western blot,RT-PCR,Exontrapping,RACE,G-Banding t(4;11)(q21;q23) PubMed:17889710

Genomic Information
Fusion_ProteinFusion_Protein_Isoforms5'_ProteinF_B_PFBP_in_Exon/Intron5'_Protein_on_Positive/Negative_Strands3'_ProteinS_B_P3'_Protein_on_Positive/Negative_StrandsSBP_in_Exon/IntronFusion_Protein_mRNA_sequenceFusion_Protein_ReferenceFusion_Protein_GenbankID
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform1 AFF1/AF4/MLLT2 88009332 0 1 MLL 118353676 1 0 CATTGAGGATTAGGGTTCAGATGACTTACTTAGGCTGACATGGCTGGTAAGGATTGGAGTTAGGATTGCAATCTGAGCGGCTCACGCCTGTGATCCCAGCACTTTGGGAAGCCGAAGCAGGCAGATCACTTGAGGTCAGG _ AF177233
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform2 AFF1/AF4/MLLT2 87970315 0 1 MLL 118356354 1 0 AAAGGGGGGGGGGGGCAACTTAACATTCTCTCTAAAAATAACAAACCTAAAAAATTGCTTTAAGCAATTGCACTTCAAACACTTATGGATATAATTAGATAAATTGGCAAATCTGTAGATATAAAGA _ AJ408897
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform3 AFF1/AF4/MLLT2 88001691 0 1 MLL 118361342 1 0 GTCTGGCTCCTTTTAGTAGGAGTAGCAGTATTTGGCTGGAGACCCTATTGGGAGAGTGACTTAGGATAATCATATAAAGTTCACTGTATAAGTAAGATAAGCAGATCAGTTTGAAGAA _ AJ408908
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform4 AFF1/AF4/MLLT2 _ _ 1 MLL 118355475 1 0 ACTTTGGGAGGCCGAGGTGGGTGGATCACTTGAGTCCAGGAGTTTAATGACATTGTGATGTCACACTAATTTTATGCTTTTCATCCTTATTTTCCATCCA _ AM050777
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform5 AFF1/AF4/MLLT2 88011965 0 1 MLL 118355475 1 0 AGATCTGTGTTTTGTTCAATCTGATATGCATGTTCATTGTTTTATATACATAATACATATATTGAGAGAGTGAGAGAGCTATTCCTTTCCATGATACTGTTGTGAAAAGTAGTTCTAGGCCAGGTATGGTGGCTCATGCCTGTATTCCCAGTACTTTGGGAGGCCGAGGTGGGTGGATCACTTGAGTCCAGGAGTTTAATGACATTGTGATGTCACACTAATTTTATGCTTTTCATCCTTATTTTCCATCCAAAGTTGTGTAATTGTAAAACTTTCCTAAGTGACCTTTCTCTCTCCACAGGAGGATTGTGAAGCAGAAAATGTGTGGGAGATGGGAGGCTTAGGAATCTTGACTTCTGTTCCTATAACACCCAGGGTGGTTTGCTTTCTCTGTGCCAGTAGTGGGCATGTAGAGGTAAGGCATC _ AM050777
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform6 AFF1/AF4/MLLT2 88009210 0 1 MLL 118355471 1 0 GCTTTTAATTTATTAAGTGCCTTCTGTGCAGTATTCATTCAGTACGGTACATAAAGTACCACTCTGACATTGTGATGTCACACTAATTTTATGCTTTTCATCCTTATTTTCCATCCAAAGTTGTGTAATTGTAAAACTTT _ AY288765
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform7 AFF1/AF4/MLLT2 88012888 0 1 MLL 118357698 1 0 TTTCAACTTATGCATGAAAAAAGTTTGAATAGATGGATAGCTGCAAGTCATAATGAAATAATTATAGAATCTGTGATGGGTAGTATGGGTATTCTCTACACTGTTTCCATTTTTCTAGATATTTGAAAGTTTCATAAGACTATCCTTTTAATACTAAAAGCTCAACGGTTTTCTCAACCCTGCCCACTTGCCATTTGAAGTTATTACTAGCAAAATTACAAATTATTGCCTACTATTCATTTACTA _ AY288767
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform8 AFF1/AF4/MLLT2 87976144 0 1 MLL 118354694 1 0 _ _ _
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform9 AFF1/AF4/MLLT2 88003602 0 1 MLL 118359316 1 0 _ _ _
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform10 AFF1/AF4/MLLT2 87975860 0 1 MLL 118359130 1 0 _ _ _
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform11 AFF1/AF4/MLLT2 88011721 0 1 MLL 118354763 1 0 _ _ _
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform12 AFF1/AF4/MLLT2 _ _ 1 MLL 118356345 1 0 _ _ _
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform13 AFF1/AF4/MLLT2 88001845 0 1 MLL 118355109 1 0 _ _ _

Domains and DDI Information
Fusion_ProteinFusion_Protein_IsoformsDomains_in_5'PartnerDDIs_for_Domains_in_5'PartnerDomains_in_3'PartnerDDIs_for_Domains_in_3'Partner5'_Protein5'P_Domains5'P_Domains_DDI_partners3'_Protein3'P_Domains3'P_Domains_DDI_partnersMissing_FP_DomainsMissing_FP_Domains_DDI
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform1 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform2 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform3 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform4 - - 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) AF-4
2) zf-CXXC
1) Pkinase , Cyclin_N
2) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform5 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform6 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform7 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform8 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform9 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform10 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform11 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform12 - - 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) AF-4
2) zf-CXXC
1) Pkinase , Cyclin_N
2) DNA_methylase
AFF1/AF4/MLLT2-MLL AFF1/AF4/MLLT2-MLL-Isoform13 1) AF-4
- 1) PHD
2) zf-HC5HC2H
3) FYRN
4) FYRC
5) SET
1) PHD , Bromodomain , JmjC , RRM_1
2) FYRC
3) FYRN
4) SET , Pre-SET , SAD-SRA , MORN , Rubis-subs-bind
AFF1/AF4/MLLT2 1) AF-4
-MLL 1) zf-CXXC
2) PHD
3) zf-HC5HC2H
4) FYRN
5) FYRC
6) SET
1) DNA_methylase
2) PHD , Bromodomain , JmjC , RRM_1
3) FYRC
4) FYRN
5) MORN , Pre-SET , Rubis-subs-bind
1) zf-CXXC
1) DNA_methylase

miRNA Information
Fusion_ProteinmiRNAs_Targets_Fusion_proteinMissing_MiRNAs_Targets_Fusion_proteinFP_miRNA_Validation_method
AFF1/AF4/MLLT2-MLL hsa-miR-128-3p hsa-miR-128bhsa-miR-877-5phsa-miR-615-3p _

Transcription Factors Information
Fusion_Protein5'P_Ref_mRNA_seqIDFP_Transcription_factorsFP_Missing_TFsFP_TF_Reference
AFF1/AF4/MLLT2-MLL NM_001166693.1 1) MITF_HUMAN
2) RB1_HUMAN
3) STAT1_HUMAN
4) RBL2_HUMAN
5) RUNX1_HUMAN
6) PRDM14_HUMAN
7) ESTROGEN RECEPTOR ALPHA_HUMAN
8) ETS1_HUMAN
9) EGR1_HUMAN
10) FOS_HUMAN
11) GATA2_HUMAN
12) GATA3_HUMAN
13) SOX2_HUMAN
14) E2F1_HUMAN
15) TAL1_HUMAN
16) CTCF_HUMAN
17) BRG1_HUMAN
18) HNF4A_HUMAN
19) TFAP2C_HUMAN
20) FOXA1_HUMAN
21) CEBPA_HUMAN
22) STAT6_HUMAN
23) ESR1_HUMAN
24) ESR2_HUMAN
25) FOXP1_HUMAN A
26) NR1H3_HUMAN A
27) SETDB1_HUMAN A
28) TRIM24_HUMAN
- 1) 21258399
2) 20385362
3) 19122651
4) 20385362
5) 20019798
6) 20953172
7) 20547749
8) 20019798
9) 20690147
10) 20139302
11) 21808000
12) 21878914
13) 21211035
14) 21310950
15) 21795385
16) 21795385
17) 19505939
18) 21646355
19) 21572391
20) 21572391
21) 20219941
22) 21828071
23) 20348243
24) 21235772
25) 21924763 A
26) 22292898 A
27) 21430779 A
28) 21164480

TicDB

Top
The fusion gene pair AFF1--MLL information is not available in TicDB.

TUMOR FUSION Gene Data Portal

Top
The fusion gene pair AFF1--MLL information is not available in TUMOR FUSION Gene Data Portal.

FusionCancer

Top
The fusion gene pair AFF1--MLL information is not available in FusionCancer Database.

ConjoinG

Top
The fusion gene pair AFF1--MLL information is not available in ConjoinG Database.

1000Genome

Top
Fusion gene AFF1--MLL has not been seen in a healthy sample (RNA-seq data from some samples from 1000 genomes project: Greger et al., Tandem RNA Chimeras Contribute to Transcriptome Diversity in Human Population and Are Associated with Intronic Genetic Variants, Plos One, Aug 2014 ). Therefore this candidate fusion gene has a low probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

18Cancers

Top
Fusion gene AFF1--MLL is not found in a RNA-seq dataset of 18 types of cancers from 600 tumor samples (B. Alaei-Mahabadia et al., Global analysis of somatic structural genomic alterations and their impact on gene expression in diverse human cancers, PNAS, Nov. 2016 )

Bodymap2

Top
Fusion gene AFF1--MLL is not found in the list of known false positive fusion genes. The list has been generated from healthy human samples collected from 16 organs from Illumina BodyMap2 RNA-seq database. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

HPA

Top
Fusion gene AFF1--MLL is not found in a healthy sample (RNA-seq database of 27 healthy tissues from 95 human individuals). A candidate fusion gene found in this dataset has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Non_Tumor_Cells

Top
Fusion gene AFF1--MLL was not found among the fusion genes which have been previously reported/found in non-tumor cell lines, like for example HEK293. The genes which are observed in those list can be considered as non-somatic mutation. [Fusion gene List compiled from FusionCatcher]

Babiceanu_Dataset

Top
The fusion gene pair AFF1--MLL information is not available in Babiceanu_Dataset.

Banned_Dataset

Top
Fusion gene AFF1--MLL is not found in the list of known false positive fusion genes. A candidate fusion gene found in this list has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Known_Fusions

Top
Fusion gene AFF1--MLL has been found in the list of fusions previously reported or published in scientific articles/reports/books/abstracts/databases, indexed by Google, Google Scholar, PubMed, etc. This label has only the role to answer with YES or NO the question "has ever before a given (candidate) fusion gene been published or reported?". This label does not have in anyway the role to provide the original references to the original scientific articles/reports/books/abstracts/databases for a given fusion gene.[Fusion gene List compiled from FusionCatcher]

ONGene Database

Top
The head gene AFF1 is a known oncogene according to ONGENE database.


The tail gene MLL is a known oncogene according to ONGENE database.

Bushman Cancer Gene Database

Top
The head gene AFF1 is cancer associated according to Bushman Cancer Gene database.
The tail gene MLL is not cancer associated according to Bushman Cancer Gene database.

Tumor Gene Set By Uniprot

Top
The head gene AFF1 is proto-oncogene or tumor suppresor gene according to Uniprot database.
The tail gene MLL is not a proto-oncogene or tumor suppresor gene according to Uniprot database.

Oesophagus_Dataset

Top
Fusion gene AFF1--MLL is not found in oesophageal tumors from TCGA samples, which are published here.

Gliomas_Dataset

Top
Fusion gene AFF1--MLL is not found in the RNA-seq dataset of 272 glioblastomas, published here.

Prostate_Dataset

Top
The fusion gene pair AFF1--MLL information is not available in Prostate Dataset (150 prostate tumor RNAs, Robison et al, Integrative Clinical Genomics of Advanced Prostate Cancer, Cell, Vol. 161, May 2015, http://dx.doi.org/10.1016/j.cell.2015.05.001).

Pancreases_Dataset

Top
Fusion gene AFF1--MLL is not found in pancreatic tumor dataset, published here.

GTEx

Top
Fusion gene AFF1--MLL has not been found in a healthy sample (GTEx database of healthy tissues (thru FusionAnnotator)). A candidate fusion gene found in this set has a very high probability of being a false positive. [Fusion gene List compiled from FusionCatcher]

Klijin_Dataset

Top
The fusion gene pair AFF1--MLL information is not available in Klijn Dataset.

Fimereli_Dataset

Top
The fusion gene pair AFF1--MLL information is not found in Fimereli_Dataset.

Literature

Top
The fusion gene pair AFF1--MLL information is not found in known fusion genelist compiled from literature.

Cortex_Dataset

Top
Fusion gene AFF1--MLL is not found in Cortex_Dataset (Fusion genes found in healthy human brains (BA9 prefrontal cortex)) . A candidate fusion gene found in this dataset has a very high probability of being a false positive.

ChromothripsisDB

Top
The fusion gene pair AFF1--MLL information is not available in ChromothripsisDB database.