siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs 1405   4892   5613   6387  
Biltr, Sidirect 448   938   1112   1687   1884   2333   2345   2588   2590   4191   5108   5111   5599   5605   5872   5877   5952   5961   6029   6064  
6074   6122   6132   6142   6176   6417   6437   6448   6452   6481   6508   6509   6510   6513   6518   6541  
Biltr, Rnaxs 227   228   245   246   249   254   255   256   257   261   262   295   296   306   316   317   319   324   325   326  
359   361   372   373   374   375   378   379   380   381   382   405   406   518   521   522   523   525   526   527  
528   529   571   574   581   624   625   626   631   632   634   638   639   640   642   643   679   680   681   684  
685   687   690   693   695   702   703   704   705   708   709   714   715   720   721   722   729   730   731   742  
750   762   763   772   773   776   785   788   842   945   946   950   951   957   958   963   964   978   1008   1018  
1019   1021   1022   1023   1041   1045   1068   1077   1098   1099   1111   1113   1114   1120   1121   1139   1140   1142   1143   1144  
1146   1149   1150   1151   1152   1176   1177   1178   1179   1195   1197   1198   1199   1200   1201   1204   1205   1206   1207   1209  
1263   1274   1282   1315   1316   1317   1318   1319   1323   1324   1403   1404   1406   1407   1460   1461   1481   1482   1512   1514  
1515   1516   1531   1542   1624   1625   1626   1627   1640   1641   1642   1646   1647   1653   1654   1656   1662   1663   1664   1665  
1678   1679   1680   1681   1692   1693   1704   1705   1711   1741   1779   1780   1781   1855   1856   1878   1879   1880   1881   1891  
1920   1924   1926   1933   1934   1938   1939   1951   1952   1953   1958   1959   1960   1965   1973   1974   1977   1978   2054   2090  
2143   2161   2162   2310   2312   2313   2314   2315   2317   2318   2319   2320   2360   2363   2364   2365   2366   2367   2416   2448  
2521   2522   2523   2526   2529   2530   2531   2533   2542   2543   2612   2613   2614   2616   2617   2618   2619   2625   2692   2693  
2703   2704   2764   2765   2785   2806   2807   2842   2843   2844   2845   2848   2851   2852   2856   2938   2940   2942   2943   2944  
2983   2984   2987   2988   3043   3045   3046   3079   3080   3081   3086   3089   3093   3096   3097   3099   3100   3101   3102   3103  
3104   3105   3106   3107   3108   3111   3114   3115   3193   3194   3195   3196   3215   3218   3345   3346   3347   3348   3349   3350  
3351   3460   3461   3462   3463   3464   3480   3481   3484   3511   3512   3513   3522   3523   3540   3542   3543   3544   3619   3620  
3621   3622   3623   3624   3625   3656   3717   3718   3738   3794   3795   3796   3807   3816   3818   3819   3865   3866   3867   3868  
3869   3870   3871   3890   3891   3892   3893   3898   3919   3920   3921   3924   3927   3930   3963   3965   3970   3971   3972   4049  
4050   4051   4053   4054   4061   4062   4103   4106   4108   4109   4110   4111   4118   4119   4120   4121   4122   4123   4156   4186  
4187   4214   4215   4216   4260   4261   4263   4264   4272   4273   4274   4275   4293   4294   4295   4296   4297   4299   4380   4381  
4383   4416   4417   4420   4421   4423   4424   4425   4429   4432   4433   4502   4503   4504   4505   4506   4507   4558   4560   4608  
4609   4614   4635   4636   4637   4638   4643   4671   4681   4730   4783   4807   4818   4819   4820   4821   4822   4852   4856   4857  
4858   4859   4860   4861   4862   4864   4865   4866   4867   4870   4872   4884   4885   4886   4889   4890   4891   4893   4894   4895  
4961   4962   4963   4966   4967   4968   4981   4985   4986   4989   4990   5130   5209   5210   5211   5212   5213   5215   5217   5239  
5240   5241   5242   5243   5268   5269   5383   5398   5399   5400   5401   5403   5404   5405   5406   5475   5476   5555   5556   5558  
5559   5560   5561   5578   5579   5580   5583   5584   5593   5612   5615   5620   5624   5633   5635   5646   5656   5657   5658   5684  
5685   5688   5690   5691   5692   5693   5694   5702   5708   5726   5752   5791   5793   5794   5797   5798   5800   5801   5802   5803  
5804   5805   5808   5809   5813   5826   5829   5830   5834   5836   5837   5838   5839   5849   5850   5851   5866   5867   5869   5870  
5871   5874   5875   5876   5884   5885   5887   5888   5895   5896   5906   5923   5924   5925   5929   5937   5939   5942   5943   5944  
5946   5947   5949   5950   5955   5956   5959   5968   5979   5980   6012   6013   6014   6015   6017   6019   6020   6021   6022   6023  
6031   6048   6053   6068   6071   6072   6078   6080   6082   6083   6084   6086   6090   6106   6107   6108   6121   6160   6161   6165  
6166   6195   6196   6197   6198   6201   6202   6203   6205   6206   6207   6208   6209   6210   6228   6233   6253   6254   6255   6256  
6262   6265   6291   6296   6335   6336   6350   6351   6362   6366   6370   6385   6386   6388   6389   6410   6411   6412   6414   6415  
6418   6432   6439   6442   6447   6453   6455   6467   6468   6469   6472   6473   6474   6475   6476   6477   6520   6545  
Biltr, Ernai, Rnaxs, Sidirect 4863   5810  
Biltr, Ernai, Sidirect 2341   5900   6120  
Biltr, Rnaxs, Sidirect 318   327   694   1110   1655   1657   1677   1707   1708   1925   2581   2582   2583   3922   4052   4871   4896   5585   5586   5594  
5647   5795   5799   5807   5814   5880   5948   5957   5958   6016   6024   6077   6081   6087   6091   6266   6408   6409   6416   6433  
6443   6444   6454   6478   6519   6521  
Biltr, Ernai 6407  


Target Position: 5398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5398AGCGCCAGCUCUACCAGUU74.1071809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5085416AGCGCCAGCTCTACCAGTTAACTGGTAGAGCTGGCGCT0.171500.018200.706900.750000.913000.75000


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363UGUCAGCUGGAGGAACCAU71.33272286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7712381TGTCAGCTGGAGGAACCATATGGTTCCTCCAGCTGACA0.084600.020400.551700.750000.913000.62500


Target Position: 4261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4261CCUGCACGACCUCCGCUUC63.65383750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4414279CCTGCACGACCTCCGCTTCGAAGCGGAGGTCGTGCAGG0.152800.054800.672400.750000.923900.75000


Target Position: 4858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4858UCCCACACUGAAACCAAAA72.10592154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5474876TCCCACACTGAAACCAAAATTTTGGTTTCAGTGTGGGA0.894700.247700.870700.750001.000001.00000


Target Position: 3717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3717AGGUGGACGAGAACCAGAA86.8313353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9723735AGGTGGACGAGAACCAGAATTCTGGTTCTCGTCCACCT0.335100.002300.672400.750000.929300.62500


Target Position: 4891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4891CCAGACAACCAAAACAUAU84.0537559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1014909CCAGACAACCAAAACATATATATGTTTTGGTTGTCTGG0.945500.809700.801701.000001.000001.00000


Target Position: 3924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3924UGUCAUCUGAAAUGGAAAC61.27324256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9053942TGTCATCTGAAATGGAAACGTTTCCATTTCAGATGACA0.072300.014500.560300.500000.994600.87500


Target Position: 1018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1018UCCUGCCCAGCCGAAAGAG47.53545957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9061036TCCTGCCCAGCCGAAAGAGCTCTTTCGGCTGGGCAGGA0.052400.003000.560300.500000.967400.62500


Target Position: 6387, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6387CAGAGAGCAUCUUUCUUUU89.3884224

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1638719CAGAGAGCATCTTTCTTTT1/1/0/0100.00ABCC1NM_004996.3+NM_019899.2+NM_019900.2+NM_019862.2+NM_019898.21+1+1+1+1NANANA8:2020369..2020387(-)|16:16236754..16236772(+)|4:34618385..34618403(+)00ABCC1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6726405CAGAGAGCATCTTTCTTTTAAAAGAAAGATGCTCTCTG0.084300.008400.784500.750001.000001.00000


Target Position: 4966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4966AGGAGAGACAGAGAUGCGA78.49551145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9874984AGGAGAGACAGAGATGCGATCGCATCTCTGTCTCTCCT0.083300.062200.551700.500001.000001.00000


Target Position: 4122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4122CGAUCAAUGGGGGAGAAAA91.5638139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2614140CGATCAATGGGGGAGAAAATTTTCTCCCCCATTGATCG0.602800.063000.793101.000001.000001.00000


Target Position: 6166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6166GGGCUGAGAAGUAACAUUC75.80221529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9726184GGGCTGAGAAGTAACATTCGAATGTTACTTCTCAGCCC0.029200.002900.819000.750001.000001.00000


Target Position: 3513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3513CCAUCGCCGCCAUCAUCAU79.68251000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2953531CCATCGCCGCCATCATCATATGATGATGGCGGCGATGG0.272000.054800.689701.000001.000001.00000


Target Position: 6081, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6081GAAUAUCAAUGAUUUUUUU92.2494116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4216099GAATATCAATGATTTTTTTAAAAAAATCATTGATATTC0.179900.068500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6079-6101TTGAATATCAATGATTTTTTTTTAAAAAAAUCAUUGAUAUUCAAGAAUAUCAAUGAUUUUUUUUUU-12.08.721


Target Position: 3656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3656GGGGUCAGCGUCAUUCGAG72.57452045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873674GGGGTCAGCGTCATTCGAGCTCGAATGACGCTGACCCC0.027800.004300.681000.750001.000001.00000


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533UGACAUUUACCUCUUCGAU77.18871315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082551TGACATTTACCTCTTCGATATCGAAGAGGTAAATGTCA0.224500.118000.543100.750001.000001.00000


Target Position: 1404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404UCACCAAUUCAGCCAGAAA84.37528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6011422TCACCAATTCAGCCAGAAATTTCTGGCTGAATTGGTGA0.117500.110900.724100.750001.000001.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730GCUCGUCUUGUCCUGUUUC69.79592557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
632748GCTCGTCTTGTCCTGTTTCGAAACAGGACAAGACGAGC0.091700.013100.681000.750001.000001.00000


Target Position: 1199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1199GGGCCGCAGAUCUUAAAGU76.37011449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651217GGGCCGCAGATCTTAAAGTACTTTAAGATCTGCGGCCC0.281400.008600.784500.750001.000001.00000


Target Position: 6205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6205CGCCCUGUGUUUGAAACCG60.23174414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9196223CGCCCTGTGTTTGAAACCGCGGTTTCAAACACAGGGCG0.208100.113100.508600.500001.000001.00000


Target Position: 5834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5834CCACCUCUUUUCUUUCCCU78.06481192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9595852CCACCTCTTTTCTTTCCCTAGGGAAAGAAAAGAGGTGG0.672900.616800.500000.750001.000001.00000


Target Position: 964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
964GGAAUGCGCCAAGACUAGG63.76363737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
983982GGAATGCGCCAAGACTAGGCCTAGTCTTGGCGCATTCC0.034100.002100.525900.500001.000001.00000


Target Position: 1019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019CCUGCCCAGCCGAAAGAGA73.51441892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831037CCTGCCCAGCCGAAAGAGATCTCTTTCGGCTGGGCAGG0.292200.003300.620700.750000.962000.62500


Target Position: 5829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5829UCUUACCACCUCUUUUCUU68.33632846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6295847TCTTACCACCTCTTTTCTTAAGAAAAGAGGTGGTAAGA0.828400.438200.586200.750001.000001.00000


Target Position: 3462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462GCUCCCUGUUCAACGUCAU80.7167865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3863480GCTCCCTGTTCAACGTCATATGACGTTGAACAGGGAGC0.173500.031600.698301.000001.000001.00000


Target Position: 1663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663GAGCAAAGACAAUCGGAUC77.59631252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8971681GAGCAAAGACAATCGGATCGATCCGATTGTCTTTGCTC0.058500.033200.629300.500001.000001.00000


Target Position: 694, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694CACUUUCUACGUCUACUUU84.9519490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
573712CACTTTCTACGTCTACTTTAAAGTAGACGTAGAAAGTG0.301300.186700.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
692-714ATCACTTTCTACGTCTACTTTTCAAAGUAGACGUAGAAAGUGAUCACUUUCUACGUCUACUUUUCU18.917.722


Target Position: 4299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4299AGGACCCUGUUUUGUUUUC58.15784741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9814317AGGACCCTGTTTTGTTTTCGAAAACAAAACAGGGTCCT0.149400.002100.672400.500001.000001.00000


Target Position: 5692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5692GACCUUGACUAGAAAUAGA96.043443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6735710GACCTTGACTAGAAATAGATCTATTTCTAGTCAAGGTC0.283500.034500.594800.500001.000001.00000


Target Position: 4871, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4871CCAAAACAUAAAAACCAAA87.9642293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
564889CCAAAACATAAAAACCAAATTTGGTTTTTATGTTTTGG0.984600.972600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4869-4891AACCAAAACATAAAAACCAAACCUUUGGUUUUUAUGUUUUGGUUCCAAAACAUAAAAACCAAACCU18.812.222


Target Position: 5980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5980CUCCCUUGGCAUCCGGUUA74.911670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6785998CTCCCTTGGCATCCGGTTATAACCGGATGCCAAGGGAG0.084400.008200.775900.750000.956500.75000


Target Position: 1098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098AGUGGAACCCCUCUCUGUU78.75641116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011116AGTGGAACCCCTCTCTGTTAACAGAGAGGGGTTCCACT0.047300.003100.560300.750000.962000.87500


Target Position: 1405, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1405CACCAAUUCAGCCAGAAAA89.2918229

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4140519CACCAATTCAGCCAGAAAA1/1/0/094.96ABCC1NM_019899.2+NM_004996.3+NM_019862.2+NM_019900.2+NM_019898.21+1+1+1+1NANANA16:16142010..16142028(+)00ABCC1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5951423CACCAATTCAGCCAGAAAATTTTCTGGCTGAATTGGTG0.103600.110000.793100.750001.000001.00000


Target Position: 4819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4819GCGCCCAGGGAGGAGUCAG60.18834427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7714837GCGCCCAGGGAGGAGTCAGCTGACTCCTCCCTGGGCGC0.063700.005300.637900.750000.923900.87500


Target Position: 6012, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6012GGCAGCAUUGUGGAGAACU74.00391827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6406030GGCAGCATTGTGGAGAACTAGTTCTCCACAATGCTGCC0.087700.009900.793100.750001.000001.00000


Target Position: 1781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1781CUGAAGGUGCUGAAGAAGU72.62782039

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111799CTGAAGGTGCTGAAGAAGTACTTCTTCAGCACCTTCAG0.095500.009800.577600.500001.000001.00000


Target Position: 1205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1205CAGAUCUUAAAGUUGCUCA85.389453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901223CAGATCTTAAAGTTGCTCATGAGCAACTTTAAGATCTG0.112000.045100.560300.500001.000001.00000


Target Position: 2366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366CAGCUGGAGGAACCAUAUU78.86511108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5852384CAGCTGGAGGAACCATATTAATATGGTTCCTCCAGCTG0.225000.011700.775900.750000.913001.00000


Target Position: 5956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5956UCCUUGUUUUUAGAUGUUA74.6711702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6445974TCCTTGTTTTTAGATGTTATAACATCTAAAAACAAGGA0.086600.087500.836200.750001.000001.00000


Target Position: 1144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1144CUACUUCCUCAUGAGCUUC65.07523491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9571162CTACTTCCTCATGAGCTTCGAAGCTCATGAGGAAGTAG0.178100.142100.500000.500001.000001.00000


Target Position: 6453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6453ACAUUAGAUAAACUAAGUU80.957848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7496471ACATTAGATAAACTAAGTTAACTTAGTTTATCTAATGT0.083900.009800.560300.750000.972800.75000


Target Position: 702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
702ACGUCUACUUUUCCCUCUU74.39251743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502720ACGTCTACTTTTCCCTCTTAAGAGGGAAAAGTAGACGT0.967100.326500.637900.750001.000001.00000


Target Position: 523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
523CAUGCUGCUUGCUACCUUU88.0956284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484541CATGCTGCTTGCTACCTTTAAAGGTAGCAAGCAGCATG0.214800.019900.655200.750000.962000.87500


Target Position: 5871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5871GGUUAUGAAGCUUUCAAAG78.32031163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4755889GGTTATGAAGCTTTCAAAGCTTTGAAAGCTTCATAACC0.276000.021000.715500.750001.000001.00000


Target Position: 5813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5813UGAUUUUGUUCUUUUUUCU74.25231775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9755831TGATTTTGTTCTTTTTTCTAGAAAAAAGAACAAAATCA0.742400.393300.500000.500001.000001.00000


Target Position: 5130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5130UCCUAGUGACCAAAUUCAG64.15923660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9815148TCCTAGTGACCAAATTCAGCTGAATTTGGTCACTAGGA0.162400.009600.586200.500001.000001.00000


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978CUAGGAAGCAGCCGGUGAA85.5266442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
986996CTAGGAAGCAGCCGGTGAATTCACCGGCTGCTTCCTAG0.032200.006300.500000.750001.000001.00000


Target Position: 5929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5929ACCAAAAAAAUGUCCCCUU67.73622961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5045947ACCAAAAAAATGTCCCCTTAAGGGGACATTTTTTTGGT0.133200.057300.715500.750001.000001.00000


Target Position: 6350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6350UCAGACUUGCUAAGAAUUA77.2161309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5656368TCAGACTTGCTAAGAATTATAATTCTTAGCAAGTCTGA0.664600.212000.689700.750001.000001.00000


Target Position: 2613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2613CCAAGGGGAUGCUGAAGAA92.6928100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7972631CCAAGGGGATGCTGAAGAATTCTTCAGCATCCCCTTGG0.055500.006400.672401.000001.000001.00000


Target Position: 750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
750CAGAUCGCUCACCCCUGUU73.90661839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
606768CAGATCGCTCACCCCTGTTAACAGGGGTGAGCGATCTG0.099600.023600.637900.750000.940200.62500


Target Position: 5800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5800UUACAGUGUUGAUUGAUUU75.74921542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8215818TTACAGTGTTGATTGATTTAAATCAATCAACACTGTAA0.202600.019300.534500.500001.000001.00000


Target Position: 1142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1142CCCUACUUCCUCAUGAGCU73.5911877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841160CCCTACTTCCTCATGAGCTAGCTCATGAGGAAGTAGGG0.174100.132500.637900.750001.000001.00000


Target Position: 3540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3540UUGGCCUCAUCUACUUCUU63.73843739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9073558TTGGCCTCATCTACTTCTTAAGAAGTAGATGAGGCCAA0.273100.003600.508600.500001.000001.00000


Target Position: 2310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310CACAGCAGGCCUGGAUUCA76.96561349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892328CACAGCAGGCCTGGATTCATGAATCCAGGCCTGCTGTG0.027700.004600.569000.500000.907600.75000


Target Position: 1934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1934GCCUUGUUCAACAUCCUCC65.05853497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7041952GCCTTGTTCAACATCCTCCGGAGGATGTTGAACAAGGC0.465700.043100.629300.500001.000001.00000


Target Position: 3807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3807UUCUGUUUGCUGCCCUGUU62.68453952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9843825TTCTGTTTGCTGCCCTGTTAACAGGGCAGCAAACAGAA0.028100.016600.525900.500001.000001.00000


Target Position: 2988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2988AGGCCAAGAAGGAGGAGAC67.54462997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913006AGGCCAAGAAGGAGGAGACGTCTCCTCCTTCTTGGCCT0.050800.005400.525900.500000.978300.87500


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788CCUAAUCCCUGCCCAGAGU69.93772527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
585806CCTAATCCCTGCCCAGAGTACTCTGGGCAGGGATTAGG0.112600.070900.637900.750000.918500.62500


Target Position: 3971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3971GAGUAUUCAGAGACUGAGA94.212767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6923989GAGTATTCAGAGACTGAGATCTCAGTCTCTGAATACTC0.141800.010200.586200.500000.907600.75000


Target Position: 5804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5804AGUGUUGAUUGAUUUUGUU82.4391686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7395822AGTGTTGATTGATTTTGTTAACAAAATCAATCAACACT0.422500.037400.560300.750001.000001.00000


Target Position: 5838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5838CUCUUUUCUUUCCCUCUCA81.3767798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9585856CTCTTTTCTTTCCCTCTCATGAGAGGGAAAGAAAAGAG0.333600.369900.586200.500001.000001.00000


Target Position: 5239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5239GGUCUACCAGGAACGCUUC71.77822209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8605257GGTCTACCAGGAACGCTTCGAAGCGTTCCTGGTAGACC0.207900.003600.681000.750001.000001.00000


Target Position: 3461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3461GGCUCCCUGUUCAACGUCA86.7123362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5113479GGCTCCCTGTTCAACGTCATGACGTTGAACAGGGAGCC0.160300.022300.775900.750000.989100.62500


Target Position: 5243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5243UACCAGGAACGCUUCAUUU73.01571984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9845261TACCAGGAACGCTTCATTTAAATGAAGCGTTCCTGGTA0.162500.002100.681000.500001.000001.00000


Target Position: 1965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1965ACAUUCUCCCCAUGGUCAU70.2642475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7731983ACATTCTCCCCATGGTCATATGACCATGGGGAGAATGT0.120100.090000.551700.750000.989101.00000


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120GGUGUUAUACAAGACCUUU85.8834422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931138GGTGTTATACAAGACCTTTAAAGGTCTTGTATAACACC0.056600.012500.853401.000001.000001.00000


Target Position: 6411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6411AAAACGCAUAUAUUUAUUU76.50761427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9816429AAAACGCATATATTTATTTAAATAAATATATGCGTTTT0.166100.104500.500000.500001.000001.00000


Target Position: 6072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6072CCCAUCUUUGAAUAUCAAU78.05061193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8106090CCCATCTTTGAATATCAATATTGATATTCAAAGATGGG0.075600.004400.982801.000001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773GAAACCAUCCACGACCCUA87.4192326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
976791GAAACCATCCACGACCCTATAGGGTCGTGGATGGTTTC0.477400.111800.500000.750001.000001.00000


Target Position: 1315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1315GCUGCACCAGUACUUCCAC71.7562210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8701333GCTGCACCAGTACTTCCACGTGGAAGTACTGGTGCAGC0.110200.003400.560300.750001.000001.00000


Target Position: 1974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974CCAUGGUCAUCAGCAGCAU82.031730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7961992CCATGGTCATCAGCAGCATATGCTGCTGATGACCATGG0.055600.019800.689701.000001.000001.00000


Target Position: 6509, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6509CGAACAUUUGCAGUAAAAA91.0362155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6507-6529TGCGAACATTTGCAGTAAAAAAAUUUUUACUGCAAAUGUUCGCACGAACAUUUGCAGUAAAAAAAU4.914.832


Target Position: 5213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5213CCCAUCACCUCUAACAUCC62.18974065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8625231CCCATCACCTCTAACATCCGGATGTTAGAGGTGATGGG0.322500.176200.620700.500001.000001.00000


Target Position: 4186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4186CCUGGGCUUAUUUCGGAUC58.56974672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8954204CCTGGGCTTATTTCGGATCGATCCGAAATAAGCCCAGG0.039200.004100.663800.750001.000001.00000


Target Position: 6253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6253AGGGAAGCAGCAUCUUUUA84.9237494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2856271AGGGAAGCAGCATCTTTTATAAAAGATGCTGCTTCCCT0.228700.061000.810300.750001.000001.00000


Target Position: 6476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6476GGGAUCCUUUUGUAAUGAC74.7071696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6656494GGGATCCTTTTGTAATGACGTCATTACAAAAGGATCCC0.082600.016900.672400.750001.000001.00000


Target Position: 2530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2530CGCUGACAUUUACCUCUUC75.9781511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4862548CGCTGACATTTACCTCTTCGAAGAGGTAAATGTCAGCG0.296600.080900.750000.750001.000001.00000


Target Position: 6439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6439UAUACCAUUCUUUCACAUU73.50211899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8616457TATACCATTCTTTCACATTAATGTGAAAGAATGGTATA0.110400.034300.534500.500001.000001.00000


Target Position: 1403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403AUCACCAAUUCAGCCAGAA74.2221787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181421ATCACCAATTCAGCCAGAATTCTGGCTGAATTGGTGAT0.158100.123900.508600.500000.989100.62500


Target Position: 2365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365UCAGCUGGAGGAACCAUAU73.71941857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4502383TCAGCTGGAGGAACCATATATATGGTTCCTCCAGCTGA0.338100.023500.681000.750000.913000.87500


Target Position: 6335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6335AGGCUGCCCCAAGACUCAG59.98894446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9336353AGGCTGCCCCAAGACTCAGCTGAGTCTTGGGGCAGCCT0.280400.002800.560300.500000.907600.62500


Target Position: 2940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2940GGGACAUCAGCAGGCACCA82.0176733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582958GGGACATCAGCAGGCACCATGGTGCCTGCTGATGTCCC0.046000.019000.646600.750001.000001.00000


Target Position: 2942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2942GACAUCAGCAGGCACCACA85.675435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9172960GACATCAGCAGGCACCACATGTGGTGCCTGCTGATGTC0.124700.022400.612100.500000.994600.62500


Target Position: 5475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5475UGGUUGGACUAACGGCUAA80.5518886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8295493TGGTTGGACTAACGGCTAATTAGCCGTTAGTCCAACCA0.109300.004100.810300.750001.000001.00000


Target Position: 4061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4061CGGAACUACUGCCUGCGCU74.0361823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7504079CGGAACTACTGCCTGCGCTAGCGCAGGCAGTAGTTCCG0.067900.014300.560300.750000.907600.75000


Target Position: 6210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6210UGUGUUUGAAACCGUGUUG58.36134716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9406228TGTGTTTGAAACCGTGTTGCAACACGGTTTCAAACACA0.033000.014600.560300.500001.000001.00000


Target Position: 1201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201GCCGCAGAUCUUAAAGUUG72.19232131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5471219GCCGCAGATCTTAAAGTTGCAACTTTAAGATCTGCGGC0.136200.015300.853400.750001.000001.00000


Target Position: 3816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3816CUGCCCUGUUUGCGGUGAU71.06862332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9533834CTGCCCTGTTTGCGGTGATATCACCGCAAACAGGGCAG0.077200.002500.603400.750000.929300.87500


Target Position: 324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
324UCCCCUUCUACUUCCUCUA72.34482088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341342TCCCCTTCTACTTCCTCTATAGAGGAAGTAGAAGGGGA0.500200.186700.698300.750001.000001.00000


Target Position: 6417, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6417CAUAUAUUUAUUUUUUGUA92.71299

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6415-6437CGCATATATTTATTTTTTGTAAGUACAAAAAAUAAAUAUAUGCGCAUAUAUUUAUUUUUUGUAAGU5.6-8.621


Target Position: 6432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6432UGUAAGUUAUACCAUUCUU79.35251052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6886450TGTAAGTTATACCATTCTTAAGAATGGTATAACTTACA0.172500.042400.569000.750000.978300.62500


Target Position: 6068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6068AGAACCCAUCUUUGAAUAU78.31971164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9856086AGAACCCATCTTTGAATATATATTCAAAGATGGGTTCT0.028000.006100.681000.750000.989100.62500


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373GAUGACACCUCUCAACAAA96.228139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
401391GATGACACCTCTCAACAAATTTGTTGAGAGGTGTCATC0.261800.042600.681000.750000.972800.75000


Target Position: 2944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2944CAUCAGCAGGCACCACAAC69.74342568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9832962CATCAGCAGGCACCACAACGTTGTGGTGCCTGCTGATG0.322700.009000.508600.500000.994600.87500


Target Position: 6015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6015AGCAUUGUGGAGAACUUGA80.3522907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9536033AGCATTGTGGAGAACTTGATCAAGTTCTCCACAATGCT0.093900.056300.629300.500001.000001.00000


Target Position: 4062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4062GGAACUACUGCCUGCGCUA92.4877105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6914080GGAACTACTGCCTGCGCTATAGCGCAGGCAGTAGTTCC0.076000.014200.698301.000000.907600.75000


Target Position: 3927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3927CAUCUGAAAUGGAAACCAA99.239116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9323945CATCTGAAATGGAAACCAATTGGTTTCCATTTCAGATG0.070400.002900.508600.750000.983700.62500


Target Position: 6477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6477GGAUCCUUUUGUAAUGACU85.3839454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7136495GGATCCTTTTGTAATGACTAGTCATTACAAAAGGATCC0.072100.038000.663800.750001.000001.00000


Target Position: 4895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4895ACAACCAAAACAUAUUCAA81.5509780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7244913ACAACCAAAACATATTCAATTGAATATGTTTTGGTTGT0.915500.893700.560300.750001.000001.00000


Target Position: 1707, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1707GGAUCAAAGUGCUAAAGCU95.77446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8961725GGATCAAAGTGCTAAAGCTAGCTTTAGCACTTTGATCC0.045600.004800.517200.750000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1705-1727TGGGATCAAAGTGCTAAAGCTTTAGCUUUAGCACUUUGAUCCCAGGAUCAAAGUGCUAAAGCUUUU18.316.322


Target Position: 1640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640ACGUAUCAGGUGGCCCACA72.05092163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271658ACGTATCAGGTGGCCCACATGTGGGCCACCTGATACGT0.036000.002800.569000.500000.923900.87500


Target Position: 3101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3101UUCCUCAGCAUCUUCCUUU62.20574061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7313119TTCCTCAGCATCTTCCTTTAAAGGAAGATGCTGAGGAA0.876100.319100.672400.500001.000001.00000


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639CCAAAAUUAUGACAGCCUU81.9131746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368657CCAAAATTATGACAGCCTTAAGGCTGTCATAATTTTGG0.179600.188600.706901.000001.000001.00000


Target Position: 1693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1693CGAAAUUCUCAAUGGGAUC69.82692550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7051711CGAAATTCTCAATGGGATCGATCCCATTGAGAATTTCG0.074000.008900.612100.750001.000001.00000


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957GGAAGAAGGAAUGCGCCAA86.1996402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
988975GGAAGAAGGAATGCGCCAATTGGCGCATTCCTTCTTCC0.027700.003400.724101.000001.000001.00000


Target Position: 634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
634GAGAUCCAAAAUUAUGACA85.1918468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814652GAGATCCAAAATTATGACATGTCATAATTTTGGATCTC0.341800.319900.603400.500001.000001.00000


Target Position: 3794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3794GGCAACUGCAUCGUUCUGU69.17812690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8543812GGCAACTGCATCGTTCTGTACAGAACGATGCAGTTGCC0.276000.003800.793100.750000.962000.87500


Target Position: 3108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3108GCAUCUUCCUUUUCAUGUG77.32421290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7633126GCATCTTCCTTTTCATGTGCACATGAAAAGGAAGATGC0.075800.070700.560300.750001.000001.00000


Target Position: 4890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4890CCCAGACAACCAAAACAUA91.4811144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
254908CCCAGACAACCAAAACATATATGTTTTGGTTGTCTGGG0.986300.848500.948301.000001.000001.00000


Target Position: 5959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5959UUGUUUUUAGAUGUUAAUU63.56433769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9285977TTGTTTTTAGATGTTAATTAATTAACATCTAAAAACAA0.104100.069100.637900.500001.000001.00000


Target Position: 372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
372AGAUGACACCUCUCAACAA99.467815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
738390AGATGACACCTCTCAACAATTGTTGAGAGGTGTCATCT0.067500.042200.577600.750000.967400.62500


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319CUGUUUCCCCUUCUACUUC63.98183691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
992337CTGTTTCCCCTTCTACTTCGAAGTAGAAGGGGAAACAG0.605700.162900.612100.500001.000001.00000


Target Position: 1515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515CCCCCCUGCAAGUCAUCCU65.34133451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731533CCCCCCTGCAAGTCATCCTAGGATGACTTGCAGGGGGG0.042700.018100.646600.750001.000001.00000


Target Position: 5403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5403CAGCUCUACCAGUUCUCGU77.67771240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9085421CAGCTCTACCAGTTCTCGTACGAGAACTGGTAGAGCTG0.147700.023400.508600.500001.000001.00000


Target Position: 5872, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5872GUUAUGAAGCUUUCAAAGU74.20581791

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5870-5892TGGTTATGAAGCTTTCAAAGTAAACUUUGAAAGCUUCAUAACCAGUUAUGAAGCUUUCAAAGUAAU12.28.922


Target Position: 5947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5947UGAGUCUUUUCCUUGUUUU72.51582055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6095965TGAGTCTTTTCCTTGTTTTAAAACAAGGAAAAGACTCA0.736100.335900.724100.750001.000001.00000


Target Position: 5752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5752CUAGCAGAAAAAUGUGUUA88.7815252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9035770CTAGCAGAAAAATGTGTTATAACACATTTTTCTGCTAG0.070700.003100.637900.750001.000001.00000


Target Position: 6013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6013GCAGCAUUGUGGAGAACUU89.1783233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6606031GCAGCATTGTGGAGAACTTAAGTTCTCCACAATGCTGC0.086200.008800.715501.000001.000001.00000


Target Position: 2162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2162GGCAUCACCUUCUCCAUCC66.40323223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9332180GGCATCACCTTCTCCATCCGGATGGAGAAGGTGATGCC0.121600.081600.629300.500000.994600.62500


Target Position: 227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
227UGGAAUGUCACGUGGAAUA79.7017997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830245TGGAATGTCACGTGGAATATATTCCACGTGACATTCCA0.050500.012700.801700.750001.000001.00000


Target Position: 5809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5809UGAUUGAUUUUGUUCUUUU80.6273876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5025827TGATTGATTTTGTTCTTTTAAAAGAACAAAATCAATCA0.538200.229800.724100.750001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382UCUCAACAAAACCAAAACU67.34673039

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884400TCTCAACAAAACCAAAACTAGTTTTGGTTTTGTTGAGA0.156500.070100.517200.500001.000001.00000


Target Position: 3105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3105UCAGCAUCUUCCUUUUCAU79.7652989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7073123TCAGCATCTTCCTTTTCATATGAAAAGGAAGATGCTGA0.181900.121100.569000.750001.000001.00000


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246CCAGCAACCCCGACUUCAC70.81632381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
769264CCAGCAACCCCGACTTCACGTGAAGTCGGGGTTGCTGG0.286600.058700.551700.750000.918500.62500


Target Position: 6029, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6029CUUGAUAUUUAGUUACUGA94.282864

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6027-6049AACTTGATATTTAGTTACTGATGUCAGUAACUAAAUAUCAAGUUCUUGAUAUUUAGUUACUGAUGU19.08.733


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140GGCCCUACUUCCUCAUGAG80.5986880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561158GGCCCTACTTCCTCATGAGCTCATGAGGAAGTAGGGCC0.153600.050000.689700.750001.000001.00000


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460GUGGACGCUCAGAGGUUCA80.6418871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851478GTGGACGCTCAGAGGTTCATGAACCTCTGAGCGTCCAC0.079400.002100.569000.500001.000001.00000


Target Position: 3111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3111UCUUCCUUUUCAUGUGUAA79.20361074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7623129TCTTCCTTTTCATGTGTAATTACACATGAAAAGGAAGA0.061000.055900.689700.750001.000001.00000


Target Position: 1653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1653CCCACAUGAAGAGCAAAGA77.67811239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2921671CCCACATGAAGAGCAAAGATCTTTGCTCTTCATGTGGG0.425800.055400.767200.750001.000001.00000


Target Position: 2090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2090GGGGGCACGAACAGCAUCA82.1728715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272108GGGGGCACGAACAGCATCATGATGCTGTTCGTGCCCCC0.310700.004100.767200.750000.983701.00000


Target Position: 6053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6053UUCCAGGACACGAAAAGAA74.0281824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9896071TTCCAGGACACGAAAAGAATTCTTTTCGTGTCCTGGAA0.101600.042400.500000.500001.000001.00000


Target Position: 5946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5946UUGAGUCUUUUCCUUGUUU67.15573073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9255964TTGAGTCTTTTCCTTGTTTAAACAAGGAAAAGACTCAA0.688300.334200.646600.500001.000001.00000


Target Position: 4963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4963CCCAGGAGAGACAGAGAUG73.23171945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6184981CCCAGGAGAGACAGAGATGCATCTCTGTCTCTCCTGGG0.094800.066700.836200.750000.989100.62500


Target Position: 4614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4614CCGUCCUCACCAUCGCCCA74.3391750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9884632CCGTCCTCACCATCGCCCATGGGCGATGGTGAGGACGG0.052900.002000.569000.750001.000001.00000


Target Position: 2807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2807GCAGAGGAGAACGGGGUCA74.73881688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9352825GCAGAGGAGAACGGGGTCATGACCCCGTTCTCCTCTGC0.033500.003800.629300.750001.000001.00000


Target Position: 4103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4103CUCAGGCACAUCAAUGUCA83.697591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9994121CTCAGGCACATCAATGTCATGACATTGATGTGCCTGAG0.142300.001800.586200.500001.000001.00000


Target Position: 4985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4985ACCACCCAAAACACGCACA68.92792738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9625003ACCACCCAAAACACGCACATGTGCGTGTTTTGGGTGGT0.030200.018700.646600.500001.000001.00000


Target Position: 1198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1198CGGGCCGCAGAUCUUAAAG63.27943826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791216CGGGCCGCAGATCTTAAAGCTTTAAGATCTGCGGCCCG0.327800.005100.775900.750001.000001.00000


Target Position: 257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257GACUUCACCAAGUGCUUUC68.6222791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
924275GACTTCACCAAGTGCTTTCGAAAGCACTTGGTGAAGTC0.130600.059100.646600.500000.934800.62500


Target Position: 2844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2844GGAAGGAAGCAAAGCAAAU86.0776411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3272862GGAAGGAAGCAAAGCAAATATTTGCTTTGCTTCCTTCC0.277000.044100.862101.000001.000001.00000


Target Position: 4109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4109CACAUCAAUGUCACGAUCA86.5645372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7784127CACATCAATGTCACGATCATGATCGTGACATTGATGTG0.058400.047800.569000.500000.934800.62500


Target Position: 3484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3484UGCCUGCAUCGUUAUCCUG62.38124022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8233502TGCCTGCATCGTTATCCTGCAGGATAACGATGCAGGCA0.069500.028200.569000.500001.000001.00000


Target Position: 5399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5399GCGCCAGCUCUACCAGUUC67.97782915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5115417GCGCCAGCTCTACCAGTTCGAACTGGTAGAGCTGGCGC0.162800.018100.750000.750000.913000.75000


Target Position: 4111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4111CAUCAAUGUCACGAUCAAU91.2225151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8214129CATCAATGTCACGATCAATATTGATCGTGACATTGATG0.052600.031400.646600.750000.934800.62500


Target Position: 3930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3930CUGAAAUGGAAACCAACAU76.0061503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9543948CTGAAATGGAAACCAACATATGTTGGTTTCCATTTCAG0.031100.002800.629300.750000.983701.00000


Target Position: 4681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4681AGGAGAAAUCCAGGAGUAC67.7852951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9944699AGGAGAAATCCAGGAGTACGTACTCCTGGATTTCTCCT0.027800.001900.663800.500000.913000.62500


Target Position: 6255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6255GGAAGCAGCAUCUUUUAAA93.795573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2646273GGAAGCAGCATCTTTTAAATTTAAAAGATGCTGCTTCC0.341500.062100.870701.000001.000001.00000


Target Position: 2692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692CGUCAUGAGUGGCGGCAAG72.88512005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402710CGTCATGAGTGGCGGCAAGCTTGCCGCCACTCATGACG0.041500.002700.637900.750001.000001.00000


Target Position: 249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
249GCAACCCCGACUUCACCAA79.03421088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
298267GCAACCCCGACTTCACCAATTGGTGAAGTCGGGGTTGC0.220700.085500.706901.000001.000001.00000


Target Position: 3115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3115CCUUUUCAUGUGUAACCAU84.8685501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6803133CCTTTTCATGTGTAACCATATGGTTACACATGAAAAGG0.078700.028200.689701.000000.972800.62500


Target Position: 5807, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5807GUUGAUUGAUUUUGUUCUU80.4463897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9275825GTTGATTGATTTTGTTCTTAAGAACAAAATCAATCAAC0.541500.169900.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5805-5827GTGTTGATTGATTTTGTTCTTTTAAGAACAAAAUCAAUCAACACGUUGAUUGAUUUUGUUCUUUUU19.213.822


Target Position: 6233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6233CUGUGUUCCUGGAAGAAAA93.665377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7066251CTGTGTTCCTGGAAGAAAATTTTCTTCCAGGAACACAG0.500600.006900.784500.750000.989100.75000


Target Position: 5558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5558UCCCCACCCACCCCGACUC42.12936264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9465576TCCCCACCCACCCCGACTCGAGTCGGGGTGGGTGGGGA0.271700.154300.560300.500001.000001.00000


Target Position: 2161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2161UGGCAUCACCUUCUCCAUC60.30434406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062179TGGCATCACCTTCTCCATCGATGGAGAAGGTGATGCCA0.122500.082900.663800.500000.923900.62500


Target Position: 4293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4293UCCCCCAGGACCCUGUUUU53.4945387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7114311TCCCCCAGGACCCTGTTTTAAAACAGGGTCCTGGGGGA0.186400.006800.870700.750000.907601.00000


Target Position: 1655, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655CACAUGAAGAGCAAAGACA88.9674245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8691673CACATGAAGAGCAAAGACATGTCTTTGCTCTTCATGTG0.549400.103100.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1653-1675CCCACATGAAGAGCAAAGACAATUGUCUUUGCUCUUCAUGUGGGCACAUGAAGAGCAAAGACAAUU19.220.532


Target Position: 1646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646CAGGUGGCCCACAUGAAGA83.9575564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191664CAGGTGGCCCACATGAAGATCTTCATGTGGGCCACCTG0.083900.007700.560300.500000.923900.75000


Target Position: 5708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5708AGAGACUGAGAGUGAGCAA90.1617180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6665726AGAGACTGAGAGTGAGCAATTGCTCACTCTCAGTCTCT0.082800.040600.577600.750001.000001.00000


Target Position: 1780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1780GCUGAAGGUGCUGAAGAAG70.7952386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9921798GCTGAAGGTGCTGAAGAAGCTTCTTCAGCACCTTCAGC0.080400.001900.715500.750001.000001.00000


Target Position: 4121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4121ACGAUCAAUGGGGGAGAAA71.02052344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5464139ACGATCAATGGGGGAGAAATTTCTCCCCCATTGATCGT0.541900.049900.775900.750001.000001.00000


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722CUCAUUCAGCUCGUCUUGU67.38233034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
829740CTCATTCAGCTCGTCTTGTACAAGACGAGCTGAATGAG0.452800.378600.603400.500001.000001.00000


Target Position: 5801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5801UACAGUGUUGAUUGAUUUU73.40851915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7975819TACAGTGTTGATTGATTTTAAAATCAATCAACACTGTA0.250200.021700.681000.500001.000001.00000


Target Position: 6541, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6541CUAUAUAUUUUAUUUCUUU90.2971178

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6539-6561ATCTATATATTTTATTTCTTTCTAAAGAAAUAAAAUAUAUAGAUCUAUAUAUUUUAUUUCUUUCUU5.3-6.411


Target Position: 1406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1406ACCAAUUCAGCCAGAAAAU71.52662247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6641424ACCAATTCAGCCAGAAAATATTTTCTGGCTGAATTGGT0.082800.089200.844800.750001.000001.00000


Target Position: 3867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3867GCCUCUCAGUGUCUUACUC74.49641724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9943885GCCTCTCAGTGTCTTACTCGAGTAAGACACTGAGAGGC0.026900.008300.689700.750001.000001.00000


Target Position: 3096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3096UCUCCUUCCUCAGCAUCUU67.24623054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6413114TCTCCTTCCTCAGCATCTTAAGATGCTGAGGAAGGAGA0.596800.193000.586200.750001.000001.00000


Target Position: 5874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5874UAUGAAGCUUUCAAAGUAA88.9894243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9555892TATGAAGCTTTCAAAGTAATTACTTTGAAAGCTTCATA0.285600.027500.508600.500001.000001.00000


Target Position: 6366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6366UUACGCCGCCGACUUCAAA69.62272590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8256384TTACGCCGCCGACTTCAAATTTGAAGTCGGCGGCGTAA0.689100.124800.534500.500001.000001.00000


Target Position: 5837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5837CCUCUUUUCUUUCCCUCUC62.96223894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8365855CCTCTTTTCTTTCCCTCTCGAGAGGGAAAGAAAAGAGG0.349600.386100.534500.750001.000001.00000


Target Position: 6208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6208CCUGUGUUUGAAACCGUGU69.86012541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7666226CCTGTGTTTGAAACCGTGTACACGGTTTCAAACACAGG0.060500.025000.637900.750001.000001.00000


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720UACUCAUUCAGCUCGUCUU75.75531540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
795738TACTCATTCAGCTCGTCTTAAGACGAGCTGAATGAGTA0.488200.421300.543100.500000.951100.62500


Target Position: 5849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5849CCCUCUCAUGGUACCUGCU74.13161806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9365867CCCTCTCATGGTACCTGCTAGCAGGTACCATGAGAGGG0.047200.002700.637900.750000.945700.75000


Target Position: 3920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3920CGGAUGUCAUCUGAAAUGG66.02513298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9343938CGGATGTCATCTGAAATGGCCATTTCAGATGACATCCG0.033500.004700.569000.500000.994600.62500


Target Position: 4859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4859CCCACACUGAAACCAAAAC63.78313732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1394877CCCACACTGAAACCAAAACGTTTTGGTTTCAGTGTGGG0.889200.611400.844800.750001.000001.00000


Target Position: 6452, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6452CACAUUAGAUAAACUAAGU84.7035515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6450-6472TTCACATTAGATAAACTAAGTTTACUUAGUUUAUCUAAUGUGAACACAUUAGAUAAACUAAGUUUU9.811.622


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514GCCCCCCUGCAAGUCAUCC50.07315746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411532GCCCCCCTGCAAGTCATCCGGATGACTTGCAGGGGGGC0.048100.026500.629300.500001.000001.00000


Target Position: 2582, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2582GGAAAACACAUCUUUGAAA96.076842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7232600GGAAAACACATCTTTGAAATTTCAAAGATGTGTTTTCC0.857800.006300.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2580-2602TGGGAAAACACATCTTTGAAAATUUUCAAAGAUGUGUUUUCCCAGGAAAACACAUCUUUGAAAAUU12.214.923


Target Position: 3464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3464UCCCUGUUCAACGUCAUUG53.19935416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8683482TCCCTGTTCAACGTCATTGCAATGACGTTGAACAGGGA0.058700.029300.724100.500001.000001.00000


Target Position: 1319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319CACCAGUACUUCCACAUCU84.1115551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401337CACCAGTACTTCCACATCTAGATGTGGAAGTACTGGTG0.125300.024900.569000.500001.000001.00000


Target Position: 2341, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2341CCGAGAAAACAUCCUUUUU79.05591086

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5234119CCGAGAAAACATCCTTTTT1/1/0/094.96ABCC1NM_004996.3+NM_019900.2+NM_019898.2+NM_019899.2+NM_019862.21+1+1+0+0NANANA16:16177273..16177291(+)00ABCC1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2339-2361CTCCGAGAAAACATCCTTTTTGGAAAAAGGAUGUUUUCUCGGAGCCGAGAAAACAUCCUUUUUGGU18.721.022


Target Position: 261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261UCACCAAGUGCUUUCAGAA86.4449381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
790279TCACCAAGTGCTTTCAGAATTCTGAAAGCACTTGGTGA0.093200.013700.551700.750000.989100.62500


Target Position: 4990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4990CCAAAACACGCACACCCUG66.36083233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7915008CCAAAACACGCACACCCTGCAGGGTGTGCGTGTTTTGG0.057200.024300.560300.750000.967400.62500


Target Position: 5583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5583UUCCCUUUUUUCUUUUGUU64.87653525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8475601TTCCCTTTTTTCTTTTGTTAACAAAAGAAAAAAGGGAA0.434900.281500.525900.500001.000001.00000


Target Position: 1779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779AGCUGAAGGUGCUGAAGAA97.634827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9761797AGCTGAAGGTGCTGAAGAATTCTTCAGCACCTTCAGCT0.036700.002200.681000.750000.956500.62500


Target Position: 5212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5212UCCCAUCACCUCUAACAUC62.74793933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7055230TCCCATCACCTCTAACATCGATGTTAGAGGTGATGGGA0.323000.176600.689700.500001.000001.00000


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785GACCCUAAUCCCUGCCCAG71.82572203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
918803GACCCTAATCCCTGCCCAGCTGGGCAGGGATTAGGGTC0.148400.134800.534500.500001.000001.00000


Target Position: 1627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1627GAUGAAGACCAAGACGUAU87.7552303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411645GATGAAGACCAAGACGTATATACGTCTTGGTCTTCATC0.120000.026800.637900.750001.000001.00000


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763CCUGUUCUCGGAAACCAUC65.91133323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
863781CCTGTTCTCGGAAACCATCGATGGTTTCCGAGAACAGG0.101100.003500.663800.750000.978300.87500


Target Position: 3080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3080GCCAUCGGACUCUUCAUCU75.79951530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4973098GCCATCGGACTCTTCATCTAGATGAAGAGTCCGATGGC0.172200.018900.775900.750001.000001.00000


Target Position: 4865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4865CUGAAACCAAAACAUAAAA84.176544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4764883CTGAAACCAAAACATAAAATTTTATGTTTTGGTTTCAG0.989300.812900.784500.750001.000001.00000


Target Position: 5656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5656GGGGUAAAUAUUAAGGAGA86.7441360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5075674GGGGTAAATATTAAGGAGATCTCCTTAATATTTACCCC0.130300.048300.767200.750001.000001.00000


Target Position: 4123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4123GAUCAAUGGGGGAGAAAAG76.95271351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8014141GATCAATGGGGGAGAAAAGCTTTTCTCCCCCATTGATC0.473600.084300.543100.500001.000001.00000


Target Position: 3106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3106CAGCAUCUUCCUUUUCAUG74.91231669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8783124CAGCATCTTCCTTTTCATGCATGAAAAGGAAGATGCTG0.107400.094000.629300.500001.000001.00000


Target Position: 5240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5240GUCUACCAGGAACGCUUCA75.52231573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9865258GTCTACCAGGAACGCTTCATGAAGCGTTCCTGGTAGAC0.231800.003400.594800.500001.000001.00000


Target Position: 2590, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590CAUCUUUGAAAAUGUGAUU81.1551825

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2588-2610CACATCTTTGAAAATGTGATTGGAAUCACAUUUUCAAAGAUGUGCAUCUUUGAAAAUGUGAUUGGU20.512.022


Target Position: 5702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5702AGAAAUAGAGACUGAGAGU81.4246790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8835720AGAAATAGAGACTGAGAGTACTCTCAGTCTCTATTTCT0.119700.053700.517200.500001.000001.00000


Target Position: 3870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3870UCUCAGUGUCUUACUCAUU75.32791606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8743888TCTCAGTGTCTTACTCATTAATGAGTAAGACACTGAGA0.042700.003800.715500.750001.000001.00000


Target Position: 5943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5943CCCUUGAGUCUUUUCCUUG69.91932529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3095961CCCTTGAGTCTTTTCCTTGCAAGGAAAAGACTCAAGGG0.684400.154500.844800.750001.000001.00000


Target Position: 4380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4380CCCUGGAGCUGGCCCACCU70.02122510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9664398CCCTGGAGCTGGCCCACCTAGGTGGGCCAGCTCCAGGG0.029800.003600.646600.750000.907600.75000


Target Position: 2542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2542CCUCUUCGAUGAUCCCCUC68.41672828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8422560CCTCTTCGATGATCCCCTCGAGGGGATCATCGAAGAGG0.141700.056300.534500.750001.000001.00000


Target Position: 5895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5895AACACGAAAUACCUCCCAA87.4877321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9635913AACACGAAATACCTCCCAATTGGGAGGTATTTCGTGTT0.177500.118200.500000.500000.978300.75000


Target Position: 1933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1933GGCCUUGUUCAACAUCCUC69.95362524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3991951GGCCTTGTTCAACATCCTCGAGGATGTTGAACAAGGCC0.502900.031500.689700.750001.000001.00000


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681UGUUUCGUGACAUCACUUU69.09652703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
661699TGTTTCGTGACATCACTTTAAAGTGATGTCACGAAACA0.132500.008800.706900.750000.913000.87500


Target Position: 2618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2618GGGAUGCUGAAGAACAAGA86.5768370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182636GGGATGCTGAAGAACAAGATCTTGTTCTTCAGCATCCC0.135100.017500.767200.750001.000001.00000


Target Position: 4671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4671UCUUGGACAAAGGAGAAAU69.57642604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9464689TCTTGGACAAAGGAGAAATATTTCTCCTTTGTCCAAGA0.070800.002600.715500.750001.000001.00000


Target Position: 705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
705UCUACUUUUCCCUCUUACU69.70622574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
909723TCTACTTTTCCCTCTTACTAGTAAGAGGGAAAAGTAGA0.946800.423100.517200.500001.000001.00000


Target Position: 1407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1407CCAAUUCAGCCAGAAAAUC62.67893955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621425CCAATTCAGCCAGAAAATCGATTTTCTGGCTGAATTGG0.082900.073400.663800.750001.000001.00000


Target Position: 5942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5942CCCCUUGAGUCUUUUCCUU75.14651635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1455960CCCCTTGAGTCTTTTCCTTAAGGAAAAGACTCAAGGGG0.645900.134900.853401.000001.000001.00000


Target Position: 5694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5694CCUUGACUAGAAAUAGAGA91.9939124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5735712CCTTGACTAGAAATAGAGATCTCTATTTCTAGTCAAGG0.196600.041700.620700.750001.000001.00000


Target Position: 5877, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5877GAAGCUUUCAAAGUAAAGA84.0671556

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5875-5897ATGAAGCTTTCAAAGTAAAGAACUCUUUACUUUGAAAGCUUCAUGAAGCUUUCAAAGUAAAGAACU9.817.022


Target Position: 1177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177CCACGACCUGAUGAUGUUU79.64621008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251195CCACGACCTGATGATGTTTAAACATCATCAGGTCGTGG0.275800.017000.844801.000001.000001.00000


Target Position: 3345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3345UGCGGUCACCCAUGAGCUU68.4012832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8863363TGCGGTCACCCATGAGCTTAAGCTCATGGGTGACCGCA0.156900.003300.715500.750000.907600.87500


Target Position: 4108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4108GCACAUCAAUGUCACGAUC76.40311448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7674126GCACATCAATGTCACGATCGATCGTGACATTGATGTGC0.060300.053100.672400.750000.934800.62500


Target Position: 1884, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884CCAUUGACGAGAACAACAU82.8915656

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1882-1904GACCATTGACGAGAACAACATCCAUGUUGUUCUCGUCAAUGGUCCCAUUGACGAGAACAACAUCCU19.320.533


Target Position: 3511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3511GCCCAUCGCCGCCAUCAUC64.4073605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5093529GCCCATCGCCGCCATCATCGATGATGGCGGCGATGGGC0.150900.054800.819000.750000.983700.75000


Target Position: 4821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4821GCCCAGGGAGGAGUCAGUA81.68764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8924839GCCCAGGGAGGAGTCAGTATACTGACTCCTCCCTGGGC0.246300.003200.819001.000000.923900.62500


Target Position: 5556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5556CCUCCCCACCCACCCCGAC49.79245771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8505574CCTCCCCACCCACCCCGACGTCGGGGTGGGTGGGGAGG0.283700.168500.525900.750001.000001.00000


Target Position: 2693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2693GUCAUGAGUGGCGGCAAGA75.53541569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8282711GTCATGAGTGGCGGCAAGATCTTGCCGCCACTCATGAC0.052000.004100.594800.500001.000001.00000


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380CCUCUCAACAAAACCAAAA82.2566706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400398CCTCTCAACAAAACCAAAATTTTGGTTTTGTTGAGAGG0.306700.029700.844801.000001.000001.00000


Target Position: 2842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2842AGGGAAGGAAGCAAAGCAA84.5912519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5172860AGGGAAGGAAGCAAAGCAATTGCTTTGCTTCCTTCCCT0.161300.078100.698300.750001.000001.00000


Target Position: 2843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2843GGGAAGGAAGCAAAGCAAA87.7518304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2362861GGGAAGGAAGCAAAGCAAATTTGCTTTGCTTCCTTCCC0.318700.075600.991401.000001.000001.00000


Target Position: 5808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5808UUGAUUGAUUUUGUUCUUU62.41234015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9645826TTGATTGATTTTGTTCTTTAAAGAACAAAATCAATCAA0.541500.187900.646600.500001.000001.00000


Target Position: 3921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3921GGAUGUCAUCUGAAAUGGA97.886825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613939GGATGTCATCTGAAATGGATCCATTTCAGATGACATCC0.036900.004000.500000.750000.994600.75000


Target Position: 4852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4852CAAGCCUCCCACACUGAAA88.5331265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4334870CAAGCCTCCCACACTGAAATTTCAGTGTGGGAGGCTTG0.647800.128000.646600.750001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776ACCAUCCACGACCCUAAUC53.08655434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
864794ACCATCCACGACCCTAATCGATTAGGGTCGTGGATGGT0.471700.306900.672400.500000.994600.62500


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729AGCUCGUCUUGUCCUGUUU76.90891359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574747AGCTCGTCTTGTCCTGTTTAAACAGGACAAGACGAGCT0.147300.015600.853400.750001.000001.00000


Target Position: 5269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5269GCUGCAGUUUUGUGGUUGA88.1414283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5275287GCTGCAGTTTTGTGGTTGATCAACCACAAAACTGCAGC0.139700.018100.629300.750001.000001.00000


Target Position: 6455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6455AUUAGAUAAACUAAGUUUU75.31681611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9166473ATTAGATAAACTAAGTTTTAAAACTTAGTTTATCTAAT0.058300.005700.508600.500000.972800.62500


Target Position: 254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
254CCCGACUUCACCAAGUGCU66.41573220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
610272CCCGACTTCACCAAGTGCTAGCACTTGGTGAAGTCGGG0.098700.029700.637900.750000.934800.87500


Target Position: 4504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4504CCUGCUGAGGAAGACGAAG64.91053518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7944522CCTGCTGAGGAAGACGAAGCTTCGTCTTCCTCAGCAGG0.766700.004700.706900.750001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625GCGAUGAAGACCAAGACGU73.72911853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341643GCGATGAAGACCAAGACGTACGTCTTGGTCTTCATCGC0.210100.033300.646600.750001.000001.00000


Target Position: 6207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6207CCCUGUGUUUGAAACCGUG71.73272217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7266225CCCTGTGTTTGAAACCGTGCACGGTTTCAAACACAGGG0.069600.025400.698300.750001.000001.00000


Target Position: 704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704GUCUACUUUUCCCUCUUAC69.22422683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
995722GTCTACTTTTCCCTCTTACGTAAGAGGGAAAAGTAGAC0.943400.394700.637900.500001.000001.00000


Target Position: 6197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6197GAGAAGCUCGCCCUGUGUU78.90051106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7706215GAGAAGCTCGCCCTGTGTTAACACAGGGCGAGCTTCTC0.163200.005300.663800.750001.000001.00000


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920CCUUCGUGUCUUUGGCCUU75.10111648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9051938CCTTCGTGTCTTTGGCCTTAAGGCCAAAGACACGAAGG0.045100.003100.706901.000001.000001.00000


Target Position: 3619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3619CUCCCCGGUCUAUUCCCAU69.60842593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4203637CTCCCCGGTCTATTCCCATATGGGAATAGACCGGGGAG0.382200.030700.655200.750000.929300.75000


Target Position: 5400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5400CGCCAGCUCUACCAGUUCU80.6005879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4935418CGCCAGCTCTACCAGTTCTAGAACTGGTAGAGCTGGCG0.160700.019200.698300.750000.913000.75000


Target Position: 2764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2764UGAGUUCCUGCGUACCUAU78.20011174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5782782TGAGTTCCTGCGTACCTATATAGGTACGCAGGAACTCA0.171000.012000.681000.750000.994600.62500


Target Position: 3194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3194GGGACUCAGGAGCACACGA86.4268383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6443212GGGACTCAGGAGCACACGATCGTGTGCTCCTGAGTCCC0.115800.009200.698300.750001.000001.00000


Target Position: 5476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5476GGUUGGACUAACGGCUAAC70.76742391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8605494GGTTGGACTAACGGCTAACGTTAGCCGTTAGTCCAACC0.045900.004000.706900.750001.000001.00000


Target Position: 2588, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2588CACAUCUUUGAAAAUGUGA80.1328939

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2586-2608AACACATCTTTGAAAATGTGATTUCACAUUUUCAAAGAUGUGUUCACAUCUUUGAAAAUGUGAUUU12.119.222


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317GCCUGUUUCCCCUUCUACU79.4741034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
124335GCCTGTTTCCCCTTCTACTAGTAGAAGGGGAAACAGGC0.464800.188300.793100.750001.000001.00000


Target Position: 3544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3544CCUCAUCUACUUCUUCGUC69.42644

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553562CCTCATCTACTTCTTCGTCGACGAAGAAGTAGATGAGG0.223500.164300.525900.750001.000001.00000


Target Position: 2320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2320CUGGAUUCAGAAUGAUUCU77.06851333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7982338CTGGATTCAGAATGATTCTAGAATCATTCTGAATCCAG0.067500.005700.560300.500000.989100.62500


Target Position: 2523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2523ACUCCAACGCUGACAUUUA88.5118267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8562541ACTCCAACGCTGACATTTATAAATGTCAGCGTTGGAGT0.186200.003700.672400.750001.000001.00000


Target Position: 5866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5866CUCAUGGUUAUGAAGCUUU74.51151722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9875884CTCATGGTTATGAAGCTTTAAAGCTTCATAACCATGAG0.034300.002000.810300.750000.956500.62500


Target Position: 2312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2312CAGCAGGCCUGGAUUCAGA88.2016278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8172330CAGCAGGCCTGGATTCAGATCTGAATCCAGGCCTGCTG0.074700.004300.560300.500000.913000.62500


Target Position: 6071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6071ACCCAUCUUUGAAUAUCAA87.8445298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8096089ACCCATCTTTGAATATCAATTGATATTCAAAGATGGGT0.071200.004400.706900.750001.000001.00000


Target Position: 3481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3481UGGUGCCUGCAUCGUUAUC56.16974995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7543499TGGTGCCTGCATCGTTATCGATAACGATGCAGGCACCA0.713900.007000.663800.500001.000001.00000


Target Position: 4424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4424GACAAGCUAGACCAUGAAU86.1506403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4784442GACAAGCTAGACCATGAATATTCATGGTCTAGCTTGTC0.143800.020400.810300.750001.000001.00000


Target Position: 3114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3114UCCUUUUCAUGUGUAACCA72.40682075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9673132TCCTTTTCATGTGTAACCATGGTTACACATGAAAAGGA0.065700.032800.525900.500001.000001.00000


Target Position: 2765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2765GAGUUCCUGCGUACCUAUG71.17312310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7152783GAGTTCCTGCGTACCTATGCATAGGTACGCAGGAACTC0.151700.006700.655200.500000.994600.62500


Target Position: 3866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3866GGCCUCUCAGUGUCUUACU77.91221213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553884GGCCTCTCAGTGTCTTACTAGTAAGACACTGAGAGGCC0.030900.009000.793100.750001.000001.00000


Target Position: 5624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5624GCUGUUAUUACUGUUCCCA80.9691846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9175642GCTGTTATTACTGTTCCCATGGGAACAGTAATAACAGC0.059700.019700.508600.750001.000001.00000


Target Position: 6469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6469GUUUUGGGGGAUCCUUUUG59.374547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9776487GTTTTGGGGGATCCTTTTGCAAAAGGATCCCCCAAAAC0.122900.002800.500000.500000.967401.00000


Target Position: 6091, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6091GAUUUUUUUUUUUUAAGUA93.502181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9806109GATTTTTTTTTTTTAAGTATACTTAAAAAAAAAAAATC0.169500.117900.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6089-6111ATGATTTTTTTTTTTTAAGTACTUACUUAAAAAAAAAAAAUCAUGAUUUUUUUUUUUUAAGUACUU4.9-12.011


Target Position: 946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
946GGUAAAGAACUGGAAGAAG76.4221446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916964GGTAAAGAACTGGAAGAAGCTTCTTCCAGTTCTTTACC0.036800.015400.715500.750001.000001.00000


Target Position: 6160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6160AGUGUUGGGCUGAGAAGUA87.3529330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9636178AGTGTTGGGCTGAGAAGTATACTTCTCAGCCCAACACT0.036800.002400.525900.750001.000001.00000


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207GAUCUUAAAGUUGCUCAUC70.08932502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9711225GATCTTAAAGTTGCTCATCGATGAGCAACTTTAAGATC0.113200.076100.500000.500001.000001.00000


Target Position: 6521, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6521GUAAAAAAAUAUAUAUAUA104.2972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4866539GTAAAAAAATATATATATATATATATATATTTTTTTAC0.236000.234200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6519-6541CAGTAAAAAAATATATATATATCUAUAUAUAUAUUUUUUUACUGGUAAAAAAAUAUAUAUAUAUCU-6.4-9.110


Target Position: 5635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5635UGUUCCCACCAUGAUUGAU69.96552521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9985653TGTTCCCACCATGATTGATATCAATCATGGTGGGAACA0.093600.001800.525900.750001.000001.00000


Target Position: 4187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4187CUGGGCUUAUUUCGGAUCA74.09181812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9964205CTGGGCTTATTTCGGATCATGATCCGAAATAAGCCCAG0.030300.003400.560300.500001.000001.00000


Target Position: 2522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2522UACUCCAACGCUGACAUUU65.62793391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422540TACTCCAACGCTGACATTTAAATGTCAGCGTTGGAGTA0.155000.003100.681000.500001.000001.00000


Target Position: 4416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4416CCCUUCCUGACAAGCUAGA71.10292322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8654434CCCTTCCTGACAAGCTAGATCTAGCTTGTCAGGAAGGG0.045000.006200.767200.750000.972800.75000


Target Position: 6014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6014CAGCAUUGUGGAGAACUUG72.322099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6956032CAGCATTGTGGAGAACTTGCAAGTTCTCCACAATGCTG0.087100.008000.637900.500001.000001.00000


Target Position: 4560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4560UGGAAACGGACGACCUCAU70.96762355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7974578TGGAAACGGACGACCTCATATGAGGTCGTCCGTTTCCA0.278700.004700.689700.750000.962001.00000


Target Position: 306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
306UUUACCUCUGGGCCUGUUU55.34985122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
969324TTTACCTCTGGGCCTGTTTAAACAGGCCCAGAGGTAAA0.045700.009100.500000.500000.902200.87500


Target Position: 4502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4502GCCCUGCUGAGGAAGACGA76.89941361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9414520GCCCTGCTGAGGAAGACGATCGTCTTCCTCAGCAGGGC0.073200.002700.706900.750000.913000.62500


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318GCACCAGUACUUCCACAUC75.01941657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321336GCACCAGTACTTCCACATCGATGTGGAAGTACTGGTGC0.172300.025000.672400.750001.000001.00000


Target Position: 1516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1516CCCCCUGCAAGUCAUCCUU69.28672665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021534CCCCCTGCAAGTCATCCTTAAGGATGACTTGCAGGGGG0.038400.009600.853401.000001.000001.00000


Target Position: 3218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3218CGGCUGAGCGUCUAUGGAG75.77111535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9093236CGGCTGAGCGTCTATGGAGCTCCATAGACGCTCAGCCG0.045900.003000.603400.750001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642AAAUUAUGACAGCCUUAAA92.0943122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
983660AAATTATGACAGCCTTAAATTTAAGGCTGTCATAATTT0.162500.166000.500000.500001.000001.00000


Target Position: 3195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3195GGACUCAGGAGCACACGAA94.226966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6963213GGACTCAGGAGCACACGAATTCGTGTGCTCCTGAGTCC0.131200.007600.698301.000001.000001.00000


Target Position: 3102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3102UCCUCAGCAUCUUCCUUUU72.20752126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2693120TCCTCAGCATCTTCCTTTTAAAAGGAAGATGCTGAGGA0.895800.469000.870700.750001.000001.00000


Target Position: 1678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678GAUCAAGCUGAUGAACGAA94.658759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111696GATCAAGCTGATGAACGAATTCGTTCATCAGCTTGATC0.129100.009100.508600.750000.967400.75000


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542ACCUCCUGUGGCUGAAUCU69.46812631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881560ACCTCCTGTGGCTGAATCTAGATTCAGCCACAGGAGGT0.117700.006200.629300.500000.907600.62500


Target Position: 3865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3865GGGCCUCUCAGUGUCUUAC70.16052484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593883GGGCCTCTCAGTGTCTTACGTAAGACACTGAGAGGCCC0.030400.010400.810300.750001.000001.00000


Target Position: 3480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3480UUGGUGCCUGCAUCGUUAU63.14153862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8043498TTGGTGCCTGCATCGTTATATAACGATGCAGGCACCAA0.250200.005700.603400.500001.000001.00000


Target Position: 6254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6254GGGAAGCAGCAUCUUUUAA90.9557157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2676272GGGAAGCAGCATCTTTTAATTAAAAGATGCTGCTTCCC0.345800.061500.956901.000001.000001.00000


Target Position: 6478, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6478GAUCCUUUUGUAAUGACUU85.2567463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7986496GATCCTTTTGTAATGACTTAAGTCATTACAAAAGGATC0.082300.032600.543100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6476-6498GGGATCCTTTTGTAATGACTTACAAGUCAUUACAAAAGGAUCCCGAUCCUUUUGUAAUGACUUACU19.218.722


Target Position: 527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
527CUGCUUGCUACCUUUUUAA84.7814511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517545CTGCTTGCTACCTTTTTAATTAAAAAGGTAGCAAGCAG0.126800.064700.750000.750001.000001.00000


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687GUGACAUCACUUUCUACGU78.4181153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
891705GTGACATCACTTTCTACGTACGTAGAAAGTGATGTCAC0.202100.026800.517200.500000.978300.62500


Target Position: 4870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4870ACCAAAACAUAAAAACCAA86.6711364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2214888ACCAAAACATAAAAACCAATTGGTTTTTATGTTTTGGT0.984600.902300.706900.750001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742CUGUUUCUCAGAUCGCUCA82.91655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867760CTGTTTCTCAGATCGCTCATGAGCGATCTGAGAAACAG0.069500.004400.560300.500001.000001.00000


Target Position: 2315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2315CAGGCCUGGAUUCAGAAUG62.77283925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7862333CAGGCCTGGATTCAGAATGCATTCTGAATCCAGGCCTG0.169900.004900.629300.500000.902200.87500


Target Position: 1151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1151CUCAUGAGCUUCUUCUUCA89.6402208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581169CTCATGAGCTTCTTCTTCATGAAGAAGAAGCTCATGAG0.532900.123800.586200.500001.000001.00000


Target Position: 5939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5939UGUCCCCUUGAGUCUUUUC58.04444764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9205957TGTCCCCTTGAGTCTTTTCGAAAAGACTCAAGGGGACA0.409400.097600.534500.500001.000001.00000


Target Position: 3460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3460GGGCUCCCUGUUCAACGUC61.85424148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5563478GGGCTCCCTGTTCAACGTCGACGTTGAACAGGGAGCCC0.177900.014000.672400.750000.989100.62500


Target Position: 1112, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1112CUGUUUAAGGUGUUAUACA89.4641218

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1110-1132CTCTGTTTAAGGTGTTATACAAGUGUAUAACACCUUAAACAGAGCUGUUUAAGGUGUUAUACAAGU9.57.222


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405UGGGAUUUUUGCUGUGGAU74.08691813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
938423TGGGATTTTTGCTGTGGATATCCACAGCAAAAATCCCA0.033100.004400.663800.750001.000001.00000


Target Position: 1881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881UGACCAUUGACGAGAACAA86.4773377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961899TGACCATTGACGAGAACAATTGTTCTCGTCAATGGTCA0.075600.016600.577600.750001.000001.00000


Target Position: 2806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2806UGCAGAGGAGAACGGGGUC53.83335341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8892824TGCAGAGGAGAACGGGGTCGACCCCGTTCTCCTCTGCA0.040300.003300.534500.500001.000001.00000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204GCAGAUCUUAAAGUUGCUC64.9023520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7921222GCAGATCTTAAAGTTGCTCGAGCAACTTTAAGATCTGC0.111400.036800.543100.750001.000001.00000


Target Position: 1316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1316CUGCACCAGUACUUCCACA85.8039426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7831334CTGCACCAGTACTTCCACATGTGGAAGTACTGGTGCAG0.138100.008200.577600.500001.000001.00000


Target Position: 3046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3046GGUCAAGCUUUCCGUGUAC75.59061560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6983064GGTCAAGCTTTCCGTGTACGTACACGGAAAGCTTGACC0.075300.009100.672400.750001.000001.00000


Target Position: 5211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5211CUCCCAUCACCUCUAACAU81.3525805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5545229CTCCCATCACCTCTAACATATGTTAGAGGTGATGGGAG0.335300.188600.655200.750001.000001.00000


Target Position: 1021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1021UGCCCAGCCGAAAGAGAGU62.21534058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8821039TGCCCAGCCGAAAGAGAGTACTCTCTTTCGGCTGGGCA0.272500.003300.646600.500000.962000.62500


Target Position: 525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
525UGCUGCUUGCUACCUUUUU63.99043688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435543TGCTGCTTGCTACCTTTTTAAAAAGGTAGCAAGCAGCA0.263600.024600.853400.750000.962000.75000


Target Position: 327, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327CCUUCUACUUCCUCUAUCU87.925295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
602345CCTTCTACTTCCTCTATCTAGATAGAGGAAGTAGAAGG0.408900.391700.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
325-347CCCCTTCTACTTCCTCTATCTCTAGAUAGAGGAAGUAGAAGGGGCCUUCUACUUCCUCUAUCUCUU20.218.922


Target Position: 3818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3818GCCCUGUUUGCGGUGAUCU68.23762870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8263836GCCCTGTTTGCGGTGATCTAGATCACCGCAAACAGGGC0.060800.004200.775900.750000.929300.75000


Target Position: 3718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3718GGUGGACGAGAACCAGAAG77.48641269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7013736GGTGGACGAGAACCAGAAGCTTCTGGTTCTCGTCCACC0.147400.007200.715500.750000.934800.75000


Target Position: 4894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4894GACAACCAAAACAUAUUCA86.3306388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7594912GACAACCAAAACATATTCATGAATATGTTTTGGTTGTC0.913400.894100.594800.500001.000001.00000


Target Position: 3796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3796CAACUGCAUCGUUCUGUUU83.3847617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8803814CAACTGCATCGTTCTGTTTAAACAGAACGATGCAGTTG0.084300.003400.646600.750000.962000.62500


Target Position: 4273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4273CCGCUUCAAGAUCACCAUC65.82893340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4404291CCGCTTCAAGATCACCATCGATGGTGATCTTGAAGCGG0.314600.132100.732800.750000.967400.62500


Target Position: 6077, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6077CUUUGAAUAUCAAUGAUUU89.312228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5316095CTTTGAATATCAATGATTTAAATCATTGATATTCAAAG0.122500.022800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6075-6097ATCTTTGAATATCAATGATTTTTAAAUCAUUGAUAUUCAAAGAUCUUUGAAUAUCAAUGAUUUUUU7.27.422


Target Position: 5851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5851CUCUCAUGGUACCUGCUCA91.1777152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9955869CTCTCATGGTACCTGCTCATGAGCAGGTACCATGAGAG0.053300.001900.586200.500001.000001.00000


Target Position: 2318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2318GCCUGGAUUCAGAAUGAUU87.9706292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6482336GCCTGGATTCAGAATGATTAATCATTCTGAATCCAGGC0.085200.009400.991401.000000.902200.62500


Target Position: 3898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3898CACGUACUUGAACUGGCUG69.23112680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9433916CACGTACTTGAACTGGCTGCAGCCAGTTCAAGTACGTG0.040000.033200.508600.500001.000001.00000


Target Position: 4503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4503CCCUGCUGAGGAAGACGAA84.0932554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8814521CCCTGCTGAGGAAGACGAATTCGTCTTCCTCAGCAGGG0.301500.003400.819001.000000.923900.62500


Target Position: 2529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2529ACGCUGACAUUUACCUCUU75.08381650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5452547ACGCTGACATTTACCTCTTAAGAGGTAAATGTCAGCGT0.295200.015400.637900.750001.000001.00000


Target Position: 4961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4961GACCCAGGAGAGACAGAGA91.7307131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9034979GACCCAGGAGAGACAGAGATCTCTGTCTCTCCTGGGTC0.252700.116800.594800.500000.956500.75000


Target Position: 6388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6388AGAGAGCAUCUUUCUUUUA89.0404242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6056406AGAGAGCATCTTTCTTTTATAAAAGAAAGATGCTCTCT0.099900.015200.689700.750001.000001.00000


Target Position: 4558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4558CCUGGAAACGGACGACCUC65.56063406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9134576CCTGGAAACGGACGACCTCGAGGTCGTCCGTTTCCAGG0.036900.003900.534500.750000.962000.75000


Target Position: 4118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4118GUCACGAUCAAUGGGGGAG58.1244749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9224136GTCACGATCAATGGGGGAGCTCCCCCATTGATCGTGAC0.323100.024200.508600.500001.000001.00000


Target Position: 528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
528UGCUUGCUACCUUUUUAAU73.22091948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
537546TGCTTGCTACCTTTTTAATATTAAAAAGGTAGCAAGCA0.121700.070200.844800.750001.000001.00000


Target Position: 4635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4635GGCUCAACACCAUCAUGGA93.253987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8864653GGCTCAACACCATCATGGATCCATGATGGTGTTGAGCC0.040600.031900.629300.750000.945700.62500


Target Position: 3795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3795GCAACUGCAUCGUUCUGUU87.8578297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9103813GCAACTGCATCGTTCTGTTAACAGAACGATGCAGTTGC0.237700.003000.706901.000000.962000.75000


Target Position: 5684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5684GGGAAUUUGACCUUGACUA90.5633173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9015702GGGAATTTGACCTTGACTATAGTCAAGGTCAAATTCCC0.038500.007000.819001.000001.000001.00000


Target Position: 4506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4506UGCUGAGGAAGACGAAGAU75.88451517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9484524TGCTGAGGAAGACGAAGATATCTTCGTCTTCCTCAGCA0.163900.002600.672400.750001.000001.00000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679CCUGUUUCGUGACAUCACU79.1161084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
904697CCTGTTTCGTGACATCACTAGTGATGTCACGAAACAGG0.044200.003100.637900.750000.913000.62500


Target Position: 1114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1114GUUUAAGGUGUUAUACAAG78.15861179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9141132GTTTAAGGTGTTATACAAGCTTGTATAACACCTTAAAC0.113500.008000.508600.500001.000001.00000


Target Position: 1925, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925GUGUCUUUGGCCUUGUUCA85.2375466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131943GTGTCTTTGGCCTTGTTCATGAACAAGGCCAAAGACAC0.054600.004500.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1923-1945TCGTGTCTTTGGCCTTGTTCAACUGAACAAGGCCAAAGACACGAGUGUCUUUGGCCUUGUUCAACU19.219.222


Target Position: 5937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5937AAUGUCCCCUUGAGUCUUU72.04262164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9035955AATGTCCCCTTGAGTCTTTAAAGACTCAAGGGGACATT0.200200.075700.508600.500001.000001.00000


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295GGUGCCUUGUUUUUACCUC69.46362632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
813313GGTGCCTTGTTTTTACCTCGAGGTAAAAACAAGGCACC0.419000.007600.543100.750001.000001.00000


Target Position: 4381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4381CCUGGAGCUGGCCCACCUG63.00423887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7364399CCTGGAGCTGGCCCACCTGCAGGTGGGCCAGCTCCAGG0.109800.006200.560300.750000.907600.62500


Target Position: 638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
638UCCAAAAUUAUGACAGCCU64.1873653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
846656TCCAAAATTATGACAGCCTAGGCTGTCATAATTTTGGA0.190500.194900.525900.500001.000001.00000


Target Position: 3350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3350UCACCCAUGAGCUUCUUUG59.03164592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6873368TCACCCATGAGCTTCTTTGCAAAGAAGCTCATGGGTGA0.103400.020000.577600.500001.000001.00000


Target Position: 448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448CUCUUUCUGGGAAAGAAGU68.59542797

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
446-468TACTCTTTCTGGGAAAGAAGTCGACUUCUUUCCCAGAAAGAGUACUCUUUCUGGGAAAGAAGUCGU10.319.122


Target Position: 5108, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5108GAGGAAUUGGUUGUAUAGA85.6998433

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5106-5128TGGAGGAATTGGTTGTATAGAAGUCUAUACAACCAAUUCCUCCAGAGGAAUUGGUUGUAUAGAAGU13.118.733


Target Position: 5605, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5605CAUUGUAAGAACAAUCAAU92.2523114

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5603-5625AACATTGTAAGAACAATCAATGCAUUGAUUGUUCUUACAAUGUUCAUUGUAAGAACAAUCAAUGCU13.86.923


Target Position: 6161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6161GUGUUGGGCUGAGAAGUAA89.614210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9646179GTGTTGGGCTGAGAAGTAATTACTTCTCAGCCCAACAC0.080100.002400.758600.750001.000001.00000


Target Position: 5383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5383GGGAACCAGCAUCUCAGCG62.85673907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9995401GGGAACCAGCATCTCAGCGCGCTGAGATGCTGGTTCCC0.026400.010200.569000.500000.918500.75000


Target Position: 4420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4420UCCUGACAAGCUAGACCAU74.23351785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7394438TCCTGACAAGCTAGACCATATGGTCTAGCTTGTCAGGA0.614500.006200.715500.750001.000001.00000


Target Position: 4986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4986CCACCCAAAACACGCACAC60.03564440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9515004CCACCCAAAACACGCACACGTGTGCGTGTTTTGGGTGG0.031300.020300.551700.750001.000001.00000


Target Position: 4608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4608ACUGCACCGUCCUCACCAU80.3441908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7844626ACTGCACCGTCCTCACCATATGGTGAGGACGGTGCAGT0.145800.051500.551700.750000.940200.62500


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973CCCAUGGUCAUCAGCAGCA78.02951195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6851991CCCATGGTCATCAGCAGCATGCTGCTGATGACCATGGG0.077500.024300.637900.750001.000001.00000


Target Position: 4156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4156GCGGACGGGAGCUGGGAAG56.08185008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9694174GCGGACGGGAGCTGGGAAGCTTCCCAGCTCCCGTCCGC0.031700.002300.784500.750001.000001.00000


Target Position: 1958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1958CCCCUGAACAUUCUCCCCA72.93731997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6881976CCCCTGAACATTCTCCCCATGGGGAGAATGTTCAGGGG0.219400.007700.646600.750001.000001.00000


Target Position: 2845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845GAAGGAAGCAAAGCAAAUG73.17421957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8902863GAAGGAAGCAAAGCAAATGCATTTGCTTTGCTTCCTTC0.271500.046300.517200.500001.000001.00000


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711CAAAGUGCUAAAGCUUUAU78.48651146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6131729CAAAGTGCTAAAGCTTTATATAAAGCTTTAGCACTTTG0.098300.010400.603400.750000.983701.00000


Target Position: 6202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6202GCUCGCCCUGUGUUUGAAA84.9294493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4346220GCTCGCCCTGTGTTTGAAATTTCAAACACAGGGCGAGC0.198700.024800.853401.000001.000001.00000


Target Position: 325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
325CCCCUUCUACUUCCUCUAU76.7571385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
123343CCCCTTCTACTTCCTCTATATAGAGGAAGTAGAAGGGG0.464900.230500.948301.000001.000001.00000


Target Position: 5839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5839UCUUUUCUUUCCCUCUCAU72.31472101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7105857TCTTTTCTTTCCCTCTCATATGAGAGGGAAAGAAAAGA0.129600.139400.569000.750001.000001.00000


Target Position: 4295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4295CCCCAGGACCCUGUUUUGU61.29234252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7964313CCCCAGGACCCTGTTTTGTACAAAACAGGGTCCTGGGG0.214400.004700.784500.750000.907600.87500


Target Position: 3919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3919UCGGAUGUCAUCUGAAAUG60.9024299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8973937TCGGATGTCATCTGAAATGCATTTCAGATGACATCCGA0.038900.003700.637900.500001.000001.00000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195UUCCGGGCCGCAGAUCUUA62.38124021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771213TTCCGGGCCGCAGATCTTATAAGATCTGCGGCCCGGAA0.441900.003900.637900.500000.934800.62500


Target Position: 4425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4425ACAAGCUAGACCAUGAAUG63.65253752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7744443ACAAGCTAGACCATGAATGCATTCATGGTCTAGCTTGT0.133700.043000.551700.500001.000001.00000


Target Position: 4110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4110ACAUCAAUGUCACGAUCAA93.50880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7264128ACATCAATGTCACGATCAATTGATCGTGACATTGATGT0.104300.040500.560300.750000.934800.62500


Target Position: 4822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4822CCCAGGGAGGAGUCAGUAC67.46933008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9804840CCCAGGGAGGAGTCAGTACGTACTGACTCCTCCCTGGG0.058200.002100.810300.750000.934800.75000


Target Position: 1200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1200GGCCGCAGAUCUUAAAGUU85.1398471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241218GGCCGCAGATCTTAAAGTTAACTTTAAGATCTGCGGCC0.249500.017100.853401.000001.000001.00000


Target Position: 1263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1263GCUACUUCUACACCGUGCU73.26351937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541281GCTACTTCTACACCGTGCTAGCACGGTGTAGAAGTAGC0.040800.019700.500000.750001.000001.00000


Target Position: 1482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482ACUUGGCCACGUACAUUAA86.4889376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9441500ACTTGGCCACGTACATTAATTAATGTACGTGGCCAAGT0.140200.002700.672400.750001.000001.00000


Target Position: 3622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3622CCCGGUCUAUUCCCAUUUC64.20733649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4543640CCCGGTCTATTCCCATTTCGAAATGGGAATAGACCGGG0.496600.023000.819000.750000.929300.87500


Target Position: 4264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4264GCACGACCUCCGCUUCAAG75.54111567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5214282GCACGACCTCCGCTTCAAGCTTGAAGCGGAGGTCGTGC0.125000.045500.715500.750000.962000.75000


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960CCUGAACAUUCUCCCCAUG69.96862519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411978CCTGAACATTCTCCCCATGCATGGGGAGAATGTTCAGG0.147200.006100.689700.750001.000001.00000


Target Position: 5958, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5958CUUGUUUUUAGAUGUUAAU77.44941276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6335976CTTGTTTTTAGATGTTAATATTAACATCTAAAAACAAG0.091700.074000.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5956-5978TCCTTGTTTTTAGATGTTAATTCAUUAACAUCUAAAAACAAGGACUUGUUUUUAGAUGUUAAUUCU6.95.621


Target Position: 2619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2619GGAUGCUGAAGAACAAGAC76.63761402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7682637GGATGCTGAAGAACAAGACGTCTTGTTCTTCAGCATCC0.131500.014600.551700.750001.000001.00000


Target Position: 5888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5888AGUAAAGAACACGAAAUAC71.74592213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9295906AGTAAAGAACACGAAATACGTATTTCGTGTTCTTTACT0.242000.140500.525900.500001.000001.00000


Target Position: 6442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6442ACCAUUCUUUCACAUUAGA77.16831320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8576460ACCATTCTTTCACATTAGATCTAATGTGAAAGAATGGT0.069200.018800.629300.500001.000001.00000


Target Position: 5802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5802ACAGUGUUGAUUGAUUUUG58.42314698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7845820ACAGTGTTGATTGATTTTGCAAAATCAATCAACACTGT0.251900.024500.560300.500001.000001.00000


Target Position: 715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715CCUCUUACUCAUUCAGCUC71.66132231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831733CCTCTTACTCATTCAGCTCGAGCTGAATGAGTAAGAGG0.511300.474100.534500.750000.951100.75000


Target Position: 5830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5830CUUACCACCUCUUUUCUUU77.04151341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4935848CTTACCACCTCTTTTCTTTAAAGAAAAGAGGTGGTAAG0.810400.424500.637900.750001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680UCAAGCUGAUGAACGAAAU72.50262057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5381698TCAAGCTGATGAACGAAATATTTCGTTCATCAGCTTGA0.285800.016000.715500.750001.000001.00000


Target Position: 2364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364GUCAGCUGGAGGAACCAUA84.3642529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672382GTCAGCTGGAGGAACCATATATGGTTCCTCCAGCTGAC0.183300.021900.775900.750000.913000.75000


Target Position: 3349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3349GUCACCCAUGAGCUUCUUU74.42941736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2463367GTCACCCATGAGCTTCTTTAAAGAAGCTCATGGGTGAC0.300800.090800.819000.750001.000001.00000


Target Position: 4432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4432AGACCAUGAAUGUGCAGAA93.695276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7804450AGACCATGAATGTGCAGAATTCTGCACATTCATGGTCT0.067600.027200.551700.750001.000001.00000


Target Position: 2317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2317GGCCUGGAUUCAGAAUGAU83.4933608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6132335GGCCTGGATTCAGAATGATATCATTCTGAATCCAGGCC0.151600.010100.819001.000000.902200.75000


Target Position: 3922, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3922GAUGUCAUCUGAAAUGGAA96.943435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9153940GATGTCATCTGAAATGGAATTCCATTTCAGATGACATC0.041500.003500.508600.750000.994600.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3920-3942CGGATGTCATCTGAAATGGAAACUUCCAUUUCAGAUGACAUCCGGAUGUCAUCUGAAAUGGAAACU20.120.522


Target Position: 2616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2616AGGGGAUGCUGAAGAACAA92.4621106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322634AGGGGATGCTGAAGAACAATTGTTCTTCAGCATCCCCT0.117500.004100.698300.750001.000001.00000


Target Position: 4637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4637CUCAACACCAUCAUGGACU69.03782719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9574655CTCAACACCATCATGGACTAGTCCATGATGGTGTTGAG0.038100.026400.603400.500000.989100.87500


Target Position: 5559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5559CCCCACCCACCCCGACUCC44.24536171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6525577CCCCACCCACCCCGACTCCGGAGTCGGGGTGGGTGGGG0.275900.165500.620700.500001.000001.00000


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176UCCACGACCUGAUGAUGUU73.61031872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151194TCCACGACCTGATGATGTTAACATCATCAGGTCGTGGA0.148700.018000.724100.750001.000001.00000


Target Position: 4820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4820CGCCCAGGGAGGAGUCAGU72.31662100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8254838CGCCCAGGGAGGAGTCAGTACTGACTCCTCCCTGGGCG0.222100.004200.715500.750000.923900.75000


Target Position: 5968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5968GAUGUUAAUUCUCUCCCUU87.0344344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7995986GATGTTAATTCTCTCCCTTAAGGGAGAGAATTAACATC0.055200.024200.543100.750001.000001.00000


Target Position: 2856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2856AGCAAAUGGAGAAUGGCAU74.29591761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8462874AGCAAATGGAGAATGGCATATGCCATTCTCCATTTGCT0.047700.039500.698300.750001.000001.00000


Target Position: 4636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4636GCUCAACACCAUCAUGGAC74.87361671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9054654GCTCAACACCATCATGGACGTCCATGATGGTGTTGAGC0.038000.028700.534500.750000.989100.75000


Target Position: 3522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3522CCAUCAUCAUCCCGCCCCU73.72051856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9503540CCATCATCATCCCGCCCCTAGGGGCGGGATGATGATGG0.586300.519300.500000.750001.000001.00000


Target Position: 1023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023CCCAGCCGAAAGAGAGUUC58.62794660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221041CCCAGCCGAAAGAGAGTTCGAACTCTCTTTCGGCTGGG0.135400.017300.819000.750000.983700.62500


Target Position: 626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
626GCCAUCCUGAGAUCCAAAA80.1429937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275644GCCATCCTGAGATCCAAAATTTTGGATCTCAGGATGGC0.636600.059601.000001.000000.972800.87500


Target Position: 6444, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6444CAUUCUUUCACAUUAGAUA96.373438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6456462CATTCTTTCACATTAGATATATCTAATGTGAAAGAATG0.086500.011800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6442-6464ACCATTCTTTCACATTAGATAAAUAUCUAAUGUGAAAGAAUGGUCAUUCUUUCACAUUAGAUAAAU6.65.322


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624GGCGAUGAAGACCAAGACG69.13822696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6271642GGCGATGAAGACCAAGACGCGTCTTGGTCTTCATCGCC0.139100.022100.724100.500001.000001.00000


Target Position: 5957, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5957CCUUGUUUUUAGAUGUUAA97.678526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6735975CCTTGTTTTTAGATGTTAATTAACATCTAAAAACAAGG0.080400.079900.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5955-5977TTCCTTGTTTTTAGATGTTAATTUUAACAUCUAAAAACAAGGAACCUUGUUUUUAGAUGUUAAUUU16.110.322


Target Position: 1077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1077UCGUCAAGUCCCCACAGAA85.6318438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661095TCGTCAAGTCCCCACAGAATTCTGTGGGGACTTGACGA0.044800.012700.620700.750000.989100.62500


Target Position: 5210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5210GCUCCCAUCACCUCUAACA85.0787481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4365228GCTCCCATCACCTCTAACATGTTAGAGGTGATGGGAGC0.341100.196200.646600.750001.000001.00000


Target Position: 3107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3107AGCAUCUUCCUUUUCAUGU66.78193149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7663125AGCATCTTCCTTTTCATGTACATGAAAAGGAAGATGCT0.089200.082300.646600.500001.000001.00000


Target Position: 6203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6203CUCGCCCUGUGUUUGAAAC61.58024202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8586221CTCGCCCTGTGTTTGAAACGTTTCAAACACAGGGCGAG0.199800.032700.663800.500001.000001.00000


Target Position: 6519, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6519CAGUAAAAAAAUAUAUAUA102.0667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5966537CAGTAAAAAAATATATATATATATATATTTTTTTACTG0.288300.030300.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6517-6539TGCAGTAAAAAAATATATATATAUAUAUAUAUUUUUUUACUGCACAGUAAAAAAAUAUAUAUAUAU-6.44.921


Target Position: 2054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2054CCUGACAGCAUCGAGCGAC61.94884119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8782072CCTGACAGCATCGAGCGACGTCGCTCGATGCTGTCAGG0.045100.003400.525900.750000.934800.87500


Target Position: 4856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4856CCUCCCACACUGAAACCAA88.0198288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2744874CCTCCCACACTGAAACCAATTGGTTTCAGTGTGGGAGG0.647400.202100.698301.000001.000001.00000


Target Position: 6084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6084UAUCAAUGAUUUUUUUUUU76.4391441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8006102TATCAATGATTTTTTTTTTAAAAAAAAAATCATTGATA0.225100.084300.543100.500001.000001.00000


Target Position: 1068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068AGGCUUUGAUCGUCAAGUC71.49832253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071086AGGCTTTGATCGTCAAGTCGACTTGACGATCAAAGCCT0.075800.003000.525900.500000.994600.62500


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206AGAUCUUAAAGUUGCUCAU82.2557707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6911224AGATCTTAAAGTTGCTCATATGAGCAACTTTAAGATCT0.114600.054000.569000.750001.000001.00000


Target Position: 1150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1150CCUCAUGAGCUUCUUCUUC68.0552900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471168CCTCATGAGCTTCTTCTTCGAAGAAGAAGCTCATGAGG0.246300.130600.672400.750001.000001.00000


Target Position: 5850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5850CCUCUCAUGGUACCUGCUC59.21644568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9655868CCTCTCATGGTACCTGCTCGAGCAGGTACCATGAGAGG0.033900.002300.534500.750001.000001.00000


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693UCACUUUCUACGUCUACUU71.85112200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
656711TCACTTTCTACGTCTACTTAAGTAGACGTAGAAAGTGA0.256100.121700.586200.750001.000001.00000


Target Position: 5658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5658GGUAAAUAUUAAGGAGAUG77.92021210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5945676GGTAAATATTAAGGAGATGCATCTCCTTAATATTTACC0.103900.103500.698300.750001.000001.00000


Target Position: 5401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5401GCCAGCUCUACCAGUUCUC62.47014001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4465419GCCAGCTCTACCAGTTCTCGAGAACTGGTAGAGCTGGC0.180800.023700.689700.750000.913000.62500


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772GGAAACCAUCCACGACCCU71.03132341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
856790GGAAACCATCCACGACCCTAGGGTCGTGGATGGTTTCC0.484600.098700.525900.750000.934800.62500


Target Position: 5593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5593UCUUUUGUUCAACAUUGUA79.5331025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7935611TCTTTTGTTCAACATTGTATACAATGTTGAACAAAAGA0.347400.043100.543100.750001.000001.00000


Target Position: 6266, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6266CUUUUAAAGCCUGUUCUUU74.5911709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9786284CTTTTAAAGCCTGTTCTTTAAAGAACAGGCTTTAAAAG0.028800.026400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6264-6286ATCTTTTAAAGCCTGTTCTTTAAAAAGAACAGGCUUUAAAAGAUCUUUUAAAGCCUGUUCUUUAAU19.2-9.112


Target Position: 6074, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6074CAUCUUUGAAUAUCAAUGA88.2024277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6072-6094CCCATCTTTGAATATCAATGATTUCAUUGAUAUUCAAAGAUGGGCAUCUUUGAAUAUCAAUGAUUU13.612.022


Target Position: 4638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4638UCAACACCAUCAUGGACUA84.2979531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8794656TCAACACCATCATGGACTATAGTCCATGATGGTGTTGA0.041800.024000.551700.750000.989101.00000


Target Position: 703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
703CGUCUACUUUUCCCUCUUA94.784456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
166721CGTCTACTTTTCCCTCTTATAAGAGGGAAAAGTAGACG0.956400.342200.741401.000001.000001.00000


Target Position: 571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
571UCAGUCUUCAGGGAUCAUG55.01925180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828589TCAGTCTTCAGGGATCATGCATGATCCCTGAAGACTGA0.050700.005600.569000.500001.000001.00000


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731CUCGUCUUGUCCUGUUUCU70.92082369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805749CTCGTCTTGTCCTGTTTCTAGAAACAGGACAAGACGAG0.087200.012000.586200.500001.000001.00000


Target Position: 5209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5209GGCUCCCAUCACCUCUAAC72.15482140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5105227GGCTCCCATCACCTCTAACGTTAGAGGTGATGGGAGCC0.348000.209400.853400.750000.951100.62500


Target Position: 5794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5794GGUUGCUUACAGUGUUGAU89.8332202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8995812GGTTGCTTACAGTGTTGATATCAACACTGTAAGCAACC0.038600.004300.672401.000001.000001.00000


Target Position: 1149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1149UCCUCAUGAGCUUCUUCUU72.36262081

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3091167TCCTCATGAGCTTCTTCTTAAGAAGAAGCTCATGAGGA0.210700.129600.732800.750001.000001.00000


Target Position: 6418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6418AUAUAUUUAUUUUUUGUAA88.6543260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9746436ATATATTTATTTTTTGTAATTACAAAAAATAAATATAT0.104700.048200.508600.500001.000001.00000


Target Position: 5685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5685GGAAUUUGACCUUGACUAG79.7423992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6715703GGAATTTGACCTTGACTAGCTAGTCAAGGTCAAATTCC0.080500.008500.698300.750001.000001.00000


Target Position: 4263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4263UGCACGACCUCCGCUUCAA76.56251413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4854281TGCACGACCTCCGCTTCAATTGAAGCGGAGGTCGTGCA0.184400.068800.706900.750000.923900.62500


Target Position: 4866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4866UGAAACCAAAACAUAAAAA78.61561137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1844884TGAAACCAAAACATAAAAATTTTTATGTTTTGGTTTCA0.989500.884300.724100.750001.000001.00000


Target Position: 3972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3972AGUAUUCAGAGACUGAGAA87.1271341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8233990AGTATTCAGAGACTGAGAATTCTCAGTCTCTGAATACT0.158200.021100.534500.750000.907600.87500


Target Position: 6336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6336GGCUGCCCCAAGACUCAGA80.1656936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7146354GGCTGCCCCAAGACTCAGATCTGAGTCTTGGGGCAGCC0.282500.006800.775900.750000.951101.00000


Target Position: 5896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5896ACACGAAAUACCUCCCAAG70.4752443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6915914ACACGAAATACCTCCCAAGCTTGGGAGGTATTTCGTGT0.167600.104400.569000.500000.978300.87500


Target Position: 529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529GCUUGCUACCUUUUUAAUU79.6886999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579547GCTTGCTACCTTTTTAATTAATTAAAAAGGTAGCAAGC0.109400.064500.844801.000001.000001.00000


Target Position: 3893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3893GUCACCACGUACUUGAACU78.7811115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723911GTCACCACGTACTTGAACTAGTTCAAGTACGTGGTGAC0.112300.016600.612100.500001.000001.00000


Target Position: 1323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1323AGUACUUCCACAUCUGCUU75.86311519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7151341AGTACTTCCACATCTGCTTAAGCAGATGTGGAAGTACT0.139600.054600.569000.750001.000001.00000


Target Position: 3346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3346GCGGUCACCCAUGAGCUUC59.79654480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6943364GCGGTCACCCATGAGCTTCGAAGCTCATGGGTGACCGC0.207800.007600.750000.750000.907600.75000


Target Position: 6412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6412AAACGCAUAUAUUUAUUUU82.0727725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9886430AAACGCATATATTTATTTTAAAATAAATATATGCGTTT0.179300.092000.500000.500001.000001.00000


Target Position: 2785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2785CAGCACAGAGCAGGAGCAG65.64193388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9842803CAGCACAGAGCAGGAGCAGCTGCTCCTGCTCTGTGCTG0.028800.003500.500000.500000.940200.75000


Target Position: 2345, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2345GAAAACAUCCUUUUUGGAU80.9884842

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2343-2365GAGAAAACATCCTTTTTGGATGTAUCCAAAAAGGAUGUUUUCUCGAAAACAUCCUUUUUGGAUGUU20.15.323


Target Position: 4054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4054GGAAUUCCGGAACUACUGC63.48693783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9754072GGAATTCCGGAACTACTGCGCAGTAGTTCCGGAATTCC0.029000.006800.517200.500001.000001.00000


Target Position: 6481, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6481CCUUUUGUAAUGACUUACA85.2076467

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6479-6501ATCCTTTTGTAATGACTTACACTUGUAAGUCAUUACAAAAGGAUCCUUUUGUAAUGACUUACACUU21.410.312


Target Position: 2581, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2581GGGAAAACACAUCUUUGAA96.121141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9492599GGGAAAACACATCTTTGAATTCAAAGATGTGTTTTCCC0.194600.002600.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2579-2601GTGGGAAAACACATCTTTGAAAAUUCAAAGAUGUGUUUUCCCACGGGAAAACACAUCUUUGAAAAU20.421.223


Target Position: 3868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3868CCUCUCAGUGUCUUACUCA90.1555181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913886CCTCTCAGTGTCTTACTCATGAGTAAGACACTGAGAGG0.027600.006600.620700.750001.000001.00000


Target Position: 6454, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6454CAUUAGAUAAACUAAGUUU90.6393168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7156472CATTAGATAAACTAAGTTTAAACTTAGTTTATCTAATG0.072000.009500.655200.750000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6452-6474CACATTAGATAAACTAAGTTTTGAAACUUAGUUUAUCUAAUGUGCAUUAGAUAAACUAAGUUUUGU9.86.622


Target Position: 6016, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6016GCAUUGUGGAGAACUUGAU84.2284538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6306034GCATTGTGGAGAACTTGATATCAAGTTCTCCACAATGC0.092100.047700.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6014-6036CAGCATTGTGGAGAACTTGATATAUCAAGUUCUCCACAAUGCUGGCAUUGUGGAGAACUUGAUAUU19.218.132


Target Position: 4857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4857CUCCCACACUGAAACCAAA91.629135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4494875CTCCCACACTGAAACCAAATTTGGTTTCAGTGTGGGAG0.831200.220400.810300.750001.000001.00000


Target Position: 574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
574GUCUUCAGGGAUCAUGCUC62.63733966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906592GTCTTCAGGGATCATGCTCGAGCATGATCCCTGAAGAC0.082500.008700.508600.500001.000001.00000


Target Position: 5880, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5880GCUUUCAAAGUAAAGAACA83.703590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4605898GCTTTCAAAGTAAAGAACATGTTCTTTACTTTGAAAGC0.443700.193000.646600.750000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5878-5900AAGCTTTCAAAGTAAAGAACACGUGUUCUUUACUUUGAAAGCUUGCUUUCAAAGUAAAGAACACGU13.312.222


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640CAAAAUUAUGACAGCCUUA93.116491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579658CAAAATTATGACAGCCTTATAAGGCTGTCATAATTTTG0.174500.180800.612100.750001.000001.00000


Target Position: 5885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5885CAAAGUAAAGAACACGAAA93.18289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4535903CAAAGTAAAGAACACGAAATTTCGTGTTCTTTACTTTG0.256800.116600.646600.750001.000001.00000


Target Position: 5561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5561CCACCCACCCCGACUCCAG62.50343997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7405579CCACCCACCCCGACTCCAGCTGGAGTCGGGGTGGGTGG0.067300.055900.560300.750000.962000.62500


Target Position: 6370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6370GCCGCCGACUUCAAACCCA77.93261207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5496388GCCGCCGACTTCAAACCCATGGGTTTGAAGTCGGCGGC0.197400.072600.655200.750001.000001.00000


Target Position: 6031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6031UGAUAUUUAGUUACUGAUG68.65412783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9806049TGATATTTAGTTACTGATGCATCAGTAACTAAATATCA0.028700.009500.569000.500001.000001.00000


Target Position: 4294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4294CCCCCAGGACCCUGUUUUG63.89793707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7904312CCCCCAGGACCCTGTTTTGCAAAACAGGGTCCTGGGGG0.077000.004800.844800.750000.907601.00000


Target Position: 6201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6201AGCUCGCCCUGUGUUUGAA82.275700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5006219AGCTCGCCCTGTGTTTGAATTCAAACACAGGGCGAGCT0.262600.023800.681000.750001.000001.00000


Target Position: 6198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6198AGAAGCUCGCCCUGUGUUU71.14962316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6556216AGAAGCTCGCCCTGTGTTTAAACACAGGGCGAGCTTCT0.171900.009000.724100.750001.000001.00000


Target Position: 6447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6447UCUUUCACAUUAGAUAAAC58.72374646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8346465TCTTTCACATTAGATAAACGTTTATCTAATGTGAAAGA0.124000.030700.577600.500001.000001.00000


Target Position: 2314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2314GCAGGCCUGGAUUCAGAAU77.34981288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002332GCAGGCCTGGATTCAGAATATTCTGAATCCAGGCCTGC0.145700.004600.844801.000000.902200.75000


Target Position: 6086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6086UCAAUGAUUUUUUUUUUUU68.47042818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5726104TCAATGATTTTTTTTTTTTAAAAAAAAAAAATCATTGA0.156500.050200.724100.750001.000001.00000


Target Position: 5633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5633ACUGUUCCCACCAUGAUUG62.2464056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9795651ACTGTTCCCACCATGATTGCAATCATGGTGGGAACAGT0.077600.002100.560300.500001.000001.00000


Target Position: 2521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2521GUACUCCAACGCUGACAUU80.7204862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922539GTACTCCAACGCTGACATTAATGTCAGCGTTGGAGTAC0.027100.003300.672400.750001.000001.00000


Target Position: 708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
708ACUUUUCCCUCUUACUCAU78.96381099

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
779726ACTTTTCCCTCTTACTCATATGAGTAAGAGGGAAAAGT0.919900.659000.551700.750001.000001.00000


Target Position: 1953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1953GGUUUCCCCUGAACAUUCU78.19221176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741971GGTTTCCCCTGAACATTCTAGAATGTTCAGGGGAAACC0.058700.012200.629300.750000.983700.75000


Target Position: 5814, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5814GAUUUUGUUCUUUUUUCUU82.3549697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8125832GATTTTGTTCTTTTTTCTTAAGAAAAAAGAACAAAATC0.599000.348400.543100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5812-5834TTGATTTTGTTCTTTTTTCTTACAAGAAAAAAGAACAAAAUCAAGAUUUUGUUCUUUUUUCUUACU5.55.311


Target Position: 522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
522CCAUGCUGCUUGCUACCUU81.3729800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463540CCATGCTGCTTGCTACCTTAAGGTAGCAAGCAGCATGG0.199100.022200.706901.000000.962001.00000


Target Position: 1657, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1657CAUGAAGAGCAAAGACAAU89.0822241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451675CATGAAGAGCAAAGACAATATTGTCTTTGCTCTTCATG0.347900.070700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1655-1677CACATGAAGAGCAAAGACAATCGAUUGUCUUUGCUCUUCAUGUGCAUGAAGAGCAAAGACAAUCGU19.220.421


Target Position: 6467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6467AAGUUUUGGGGGAUCCUUU72.50162058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9126485AAGTTTTGGGGGATCCTTTAAAGGATCCCCCAAAACTT0.053700.003400.637900.500000.967400.87500


Target Position: 3890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3890CAGGUCACCACGUACUUGA83.5081606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723908CAGGTCACCACGTACTTGATCAAGTACGTGGTGACCTG0.167800.003400.560300.500001.000001.00000


Target Position: 3086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3086GGACUCUUCAUCUCCUUCC66.10683284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793104GGACTCTTCATCTCCTTCCGGAAGGAGATGAAGAGTCC0.364000.074700.500000.500000.967400.62500


Target Position: 1939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1939GUUCAACAUCCUCCGGUUU74.23861783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6251957GTTCAACATCCTCCGGTTTAAACCGGAGGATGTTGAAC0.192600.016500.646600.750001.000001.00000


Target Position: 1531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1531CCUUGCUCUCUACCUCCUG64.75273547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7421549CCTTGCTCTCTACCTCCTGCAGGAGGTAGAGAGCAAGG0.147800.013400.560300.750001.000001.00000


Target Position: 6209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6209CUGUGUUUGAAACCGUGUU72.73642022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8256227CTGTGTTTGAAACCGTGTTAACACGGTTTCAAACACAG0.050800.024000.637900.750001.000001.00000


Target Position: 4886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4886CAAACCCAGACAACCAAAA82.0084735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5224904CAAACCCAGACAACCAAAATTTTGGTTGTCTGGGTTTG0.977100.837500.646600.750001.000001.00000


Target Position: 6362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6362AGAAUUACGCCGCCGACUU69.92162528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6576380AGAATTACGCCGCCGACTTAAGTCGGCGGCGTAATTCT0.193800.146900.586200.750001.000001.00000


Target Position: 1952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1952CGGUUUCCCCUGAACAUUC69.65122583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681970CGGTTTCCCCTGAACATTCGAATGTTCAGGGGAAACCG0.029700.011400.741400.750000.902200.75000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324GUACUUCCACAUCUGCUUC69.87172538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9041342GTACTTCCACATCTGCTTCGAAGCAGATGTGGAAGTAC0.146400.059300.508600.500001.000001.00000


Target Position: 4885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4885CCAAACCCAGACAACCAAA83.553600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
914903CCAAACCCAGACAACCAAATTTGGTTGTCTGGGTTTGG0.976300.833700.844801.000001.000001.00000


Target Position: 6389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6389GAGAGCAUCUUUCUUUUAG76.86511369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8876407GAGAGCATCTTTCTTTTAGCTAAAAGAAAGATGCTCTC0.102700.019800.637900.500001.000001.00000


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518AUCACCAUGCUGCUUGCUA74.63311704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925536ATCACCATGCTGCTTGCTATAGCAAGCAGCATGGTGAT0.059000.009900.508600.500000.962000.75000


Target Position: 3543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3543GCCUCAUCUACUUCUUCGU76.1831482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943561GCCTCATCTACTTCTTCGTACGAAGAAGTAGATGAGGC0.224500.167300.724100.750001.000001.00000


Target Position: 2612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2612CCCAAGGGGAUGCUGAAGA70.70722403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422630CCCAAGGGGATGCTGAAGATCTTCAGCATCCCCTTGGG0.046500.002700.767200.750000.929300.62500


Target Position: 5810, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5810GAUUGAUUUUGUUCUUUUU90.7509165

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3581019GATTGATTTTGTTCTTTTT1/1/0/096.22ABCC1NM_019899.2+NM_004996.3+NM_019900.2+NM_019862.2+NM_019898.21+1+1+1+1NANANANA00ABCC1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3085828GATTGATTTTGTTCTTTTTAAAAAGAACAAAATCAATC0.566200.237100.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5808-5830TTGATTGATTTTGTTCTTTTTTCAAAAAGAACAAAAUCAAUCAAGAUUGAUUUUGUUCUUUUUUCU5.57.222


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626CGAUGAAGACCAAGACGUA102.3776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831644CGATGAAGACCAAGACGTATACGTCTTGGTCTTCATCG0.231900.040100.612101.000001.000001.00000


Target Position: 4989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4989CCCAAAACACGCACACCCU74.49711723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9365007CCCAAAACACGCACACCCTAGGGTGTGCGTGTTTTGGG0.033500.023600.646600.750001.000001.00000


Target Position: 2938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2938UGGGGACAUCAGCAGGCAC62.97543892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9532956TGGGGACATCAGCAGGCACGTGCCTGCTGATGTCCCCA0.031100.003200.551700.500001.000001.00000


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245ACCAGCAACCCCGACUUCA69.0962704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
764263ACCAGCAACCCCGACTTCATGAAGTCGGGGTTGCTGGT0.283800.049700.629300.500000.913000.62500


Target Position: 1926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1926UGUCUUUGGCCUUGUUCAA78.7441119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7371944TGTCTTTGGCCTTGTTCAATTGAACAAGGCCAAAGACA0.074000.006300.560300.750001.000001.00000


Target Position: 2448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2448GGACAGAGAUUGGCGAGAA95.846545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962466GGACAGAGATTGGCGAGAATTCTCGCCAATCTCTGTCC0.038900.011400.698301.000001.000001.00000


Target Position: 4783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4783GGCAUAUCUGGUCAGAACU81.3826797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5354801GGCATATCTGGTCAGAACTAGTTCTGACCAGATATGCC0.120600.028600.793100.750001.000001.00000


Target Position: 3196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3196GACUCAGGAGCACACGAAA95.991744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5693214GACTCAGGAGCACACGAAATTTCGTGTGCTCCTGAGTC0.121900.012900.819000.750001.000001.00000


Target Position: 963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
963AGGAAUGCGCCAAGACUAG66.06723292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
997981AGGAATGCGCCAAGACTAGCTAGTCTTGGCGCATTCCT0.040300.001800.672400.500001.000001.00000


Target Position: 4893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4893AGACAACCAAAACAUAUUC68.74652770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9664911AGACAACCAAAACATATTCGAATATGTTTTGGTTGTCT0.913900.893300.551700.500001.000001.00000


Target Position: 3347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3347CGGUCACCCAUGAGCUUCU79.28281062

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4793365CGGTCACCCATGAGCTTCTAGAAGCTCATGGGTGACCG0.232700.020400.689700.750000.907600.75000


Target Position: 3892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3892GGUCACCACGUACUUGAAC69.22822682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7093910GGTCACCACGTACTTGAACGTTCAAGTACGTGGTGACC0.164500.006900.706900.750001.000001.00000


Target Position: 6106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6106AGUACUGUUCCGGGGAGAA79.53911024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8446124AGTACTGTTCCGGGGAGAATTCTCCCCGGAACAGTACT0.245900.016000.534500.750001.000001.00000


Target Position: 4429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4429GCUAGACCAUGAAUGUGCA94.614261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9464447GCTAGACCATGAATGTGCATGCACATTCATGGTCTAGC0.074700.026100.500000.750001.000001.00000


Target Position: 709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
709CUUUUCCCUCUUACUCAUU72.5282054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536727CTTTTCCCTCTTACTCATTAATGAGTAAGAGGGAAAAG0.924400.896200.629300.750001.000001.00000


Target Position: 1197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1197CCGGGCCGCAGAUCUUAAA77.06931332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8061215CCGGGCCGCAGATCTTAAATTTAAGATCTGCGGCCCGG0.647800.004500.913801.000001.000001.00000


Target Position: 2543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2543CUCUUCGAUGAUCCCCUCU65.80123348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932561CTCTTCGATGATCCCCTCTAGAGGGGATCATCGAAGAG0.065200.031700.586200.500001.000001.00000


Target Position: 6443, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6443CCAUUCUUUCACAUUAGAU85.7837429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6706461CCATTCTTTCACATTAGATATCTAATGTGAAAGAATGG0.080600.015400.663801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6441-6463TACCATTCTTTCACATTAGATAAAUCUAAUGUGAAAGAAUGGUACCAUUCUUUCACAUUAGAUAAU13.412.022


Target Position: 4119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4119UCACGAUCAAUGGGGGAGA64.61373572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9874137TCACGATCAATGGGGGAGATCTCCCCCATTGATCGTGA0.422900.025500.500000.500001.000001.00000


Target Position: 1146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1146ACUUCCUCAUGAGCUUCUU69.77732561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7141164ACTTCCTCATGAGCTTCTTAAGAAGCTCATGAGGAAGT0.166400.132400.569000.750001.000001.00000


Target Position: 5217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5217UCACCUCUAACAUCCUUGU65.37993441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8875235TCACCTCTAACATCCTTGTACAAGGATGTTAGAGGTGA0.124200.098700.517200.500001.000001.00000


Target Position: 4862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4862ACACUGAAACCAAAACAUA88.8364251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3834880ACACTGAAACCAAAACATATATGTTTTGGTTTCAGTGT0.914800.602900.663800.750001.000001.00000


Target Position: 2848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2848GGAAGCAAAGCAAAUGGAG72.04052166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462866GGAAGCAAAGCAAATGGAGCTCCATTTGCTTTGCTTCC0.417200.077300.560300.750001.000001.00000


Target Position: 5906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5906CCUCCCAAGUAUUACCAGU76.21751475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9065924CCTCCCAAGTATTACCAGTACTGGTAATACTTGGGAGG0.038000.022800.637900.750001.000001.00000


Target Position: 4643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4643ACCAUCAUGGACUACACAA83.5883597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4664661ACCATCATGGACTACACAATTGTGTAGTCCATGATGGT0.169200.022000.706900.750000.989100.62500


Target Position: 6520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6520AGUAAAAAAAUAUAUAUAU89.1685234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5816538AGTAAAAAAATATATATATATATATATATTTTTTTACT0.263000.261100.663800.750001.000001.00000


Target Position: 262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262CACCAAGUGCUUUCAGAAC71.8642198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786280CACCAAGTGCTTTCAGAACGTTCTGAAAGCACTTGGTG0.057800.008300.646600.500001.000001.00000


Target Position: 4507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4507GCUGAGGAAGACGAAGAUC68.60172796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9704525GCTGAGGAAGACGAAGATCGATCTTCGTCTTCCTCAGC0.054900.002300.672400.750001.000001.00000


Target Position: 2333, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2333GAUUCUCUCCGAGAAAACA90.3087177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2331-2353ATGATTCTCTCCGAGAAAACATCUGUUUUCUCGGAGAGAAUCAUGAUUCUCUCCGAGAAAACAUCU13.319.123


Target Position: 6176, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6176GUAACAUUCCCAGGAAAUA86.7878358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6174-6196AAGTAACATTCCCAGGAAATAGTUAUUUCCUGGGAAUGUUACUUGUAACAUUCCCAGGAAAUAGUU18.76.922


Target Position: 3079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3079GGCCAUCGGACUCUUCAUC67.36743038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5273097GGCCATCGGACTCTTCATCGATGAAGAGTCCGATGGCC0.253800.017200.819000.750000.989100.62500


Target Position: 5405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5405GCUCUACCAGUUCUCGUUU79.23071069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4075423GCTCTACCAGTTCTCGTTTAAACGAGAACTGGTAGAGC0.165500.051800.853401.000001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381CUCUCAACAAAACCAAAAC66.94913116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760399CTCTCAACAAAACCAAAACGTTTTGGTTTTGTTGAGAG0.209400.086500.663800.500001.000001.00000


Target Position: 3043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3043GCAGGUCAAGCUUUCCGUG71.03092342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9733061GCAGGTCAAGCTTTCCGTGCACGGAAAGCTTGACCTGC0.036200.002200.560300.750001.000001.00000


Target Position: 4896, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4896CAACCAAAACAUAUUCAAA100.35411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5934914CAACCAAAACATATTCAAATTTGAATATGTTTTGGTTG0.911800.889600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4894-4916GACAACCAAAACATATTCAAAGCUUUGAAUAUGUUUUGGUUGUCCAACCAAAACAUAUUCAAAGCU8.918.822


Target Position: 6473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6473UGGGGGAUCCUUUUGUAAU73.0531979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7536491TGGGGGATCCTTTTGTAATATTACAAAAGGATCCCCCA0.153500.005700.836200.750000.967400.75000


Target Position: 2617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2617GGGGAUGCUGAAGAACAAG71.82412204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7772635GGGGATGCTGAAGAACAAGCTTGTTCTTCAGCATCCCC0.141500.005100.853400.750001.000001.00000


Target Position: 5793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5793UGGUUGCUUACAGUGUUGA69.91332531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9415811TGGTTGCTTACAGTGTTGATCAACACTGTAAGCAACCA0.033000.003600.620700.500001.000001.00000


Target Position: 3463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3463CUCCCUGUUCAACGUCAUU74.81431675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4193481CTCCCTGTTCAACGTCATTAATGACGTTGAACAGGGAG0.161300.033600.801700.750001.000001.00000


Target Position: 6023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6023GGAGAACUUGAUAUUUAGU87.011346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8096041GGAGAACTTGATATTTAGTACTAAATATCAAGTTCTCC0.054300.018100.663800.750001.000001.00000


Target Position: 5836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5836ACCUCUUUUCUUUCCCUCU68.67942782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9005854ACCTCTTTTCTTTCCCTCTAGAGGGAAAGAAAAGAGGT0.442200.475900.629300.500001.000001.00000


Target Position: 4120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4120CACGAUCAAUGGGGGAGAA85.0271483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5684138CACGATCAATGGGGGAGAATTCTCCCCCATTGATCGTG0.393600.038200.620700.750001.000001.00000


Target Position: 4052, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4052GUGGAAUUCCGGAACUACU80.5117889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9944070GTGGAATTCCGGAACTACTAGTAGTTCCGGAATTCCAC0.059900.011200.586200.500000.962000.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4050-4072GAGTGGAATTCCGGAACTACTGCAGUAGUUCCGGAAUUCCACUCGUGGAAUUCCGGAACUACUGCU21.420.132


Target Position: 521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
521ACCAUGCUGCUUGCUACCU59.05484585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
924539ACCATGCTGCTTGCTACCTAGGTAGCAAGCAGCATGGT0.093000.010800.508600.500000.962001.00000


Target Position: 256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256CGACUUCACCAAGUGCUUU80.0219955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522274CGACTTCACCAAGTGCTTTAAAGCACTTGGTGAAGTCG0.124700.060400.793101.000000.934800.75000


Target Position: 1704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1704AUGGGAUCAAAGUGCUAAA83.4477614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8771722ATGGGATCAAAGTGCTAAATTTAGCACTTTGATCCCAT0.042300.005800.655200.500001.000001.00000


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681CAAGCUGAUGAACGAAAUU82.055728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451699CAAGCTGATGAACGAAATTAATTTCGTTCATCAGCTTG0.119100.005900.637900.750001.000001.00000


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685UCGUGACAUCACUUUCUAC73.28921932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
629703TCGTGACATCACTTTCTACGTAGAAAGTGATGTCACGA0.182200.010800.612100.500000.913000.75000


Target Position: 406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
406GGGAUUUUUGCUGUGGAUC62.06314088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
983424GGGATTTTTGCTGTGGATCGATCCACAGCAAAAATCCC0.028600.004100.810300.750001.000001.00000


Target Position: 361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
361AGGCUACAUUCAGAUGACA85.9557420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672379AGGCTACATTCAGATGACATGTCATCTGAATGTAGCCT0.192800.145900.637900.500001.000001.00000


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367AGCUGGAGGAACCAUAUUA89.0871240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6622385AGCTGGAGGAACCATATTATAATATGGTTCCTCCAGCT0.140400.008700.819000.750000.913000.87500


Target Position: 2852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2852GCAAAGCAAAUGGAGAAUG64.64873564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2512870GCAAAGCAAATGGAGAATGCATTCTCCATTTGCTTTGC0.420400.202800.698300.750001.000001.00000


Target Position: 5884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5884UCAAAGUAAAGAACACGAA78.74951118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7785902TCAAAGTAAAGAACACGAATTCGTGTTCTTTACTTTGA0.286400.137200.551700.750001.000001.00000


Target Position: 1179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1179ACGACCUGAUGAUGUUUUC63.35433808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8741197ACGACCTGATGATGTTTTCGAAAACATCATCAGGTCGT0.217800.018500.603400.500001.000001.00000


Target Position: 3625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3625GGUCUAUUCCCAUUUCAAC79.17431079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2273643GGTCTATTCCCATTTCAACGTTGAAATGGGAATAGACC0.751300.080600.706900.750001.000001.00000


Target Position: 6064, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6064GAAAAGAACCCAUCUUUGA88.2187275

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6062-6084ACGAAAAGAACCCATCTTTGAATUCAAAGAUGGGUUCUUUUCGUGAAAAGAACCCAUCUUUGAAUU12.05.532


Target Position: 4383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4383UGGAGCUGGCCCACCUGAA73.98521828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8524401TGGAGCTGGCCCACCTGAATTCAGGTGGGCCAGCTCCA0.156100.003800.672400.750000.907600.75000


Target Position: 1139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139GGGCCCUACUUCCUCAUGA83.9342568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221157GGGCCCTACTTCCTCATGATCATGAGGAAGTAGGGCCC0.202600.025700.767200.750000.994600.75000


Target Position: 5867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5867UCAUGGUUAUGAAGCUUUC64.76233544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9615885TCATGGTTATGAAGCTTTCGAAAGCTTCATAACCATGA0.042700.002400.551700.500001.000001.00000


Target Position: 842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
842UGGAUCACAGGGUUGAUUG61.49474216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
973860TGGATCACAGGGTTGATTGCAATCAACCCTGTGATCCA0.120600.002600.698300.500000.962000.62500


Target Position: 6121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6121AGAAAAACAGUCUCAAAAC73.19761954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7546139AGAAAAACAGTCTCAAAACGTTTTGAGACTGTTTTTCT0.062200.022600.577600.500001.000001.00000


Target Position: 6518, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6518GCAGUAAAAAAAUAUAUAU92.31113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6516-6538TTGCAGTAAAAAAATATATATATAUAUAUAUUUUUUUACUGCAAGCAGUAAAAAAAUAUAUAUAUU-6.411.821


Target Position: 4962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4962ACCCAGGAGAGACAGAGAU71.39122276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4504980ACCCAGGAGAGACAGAGATATCTCTGTCTCTCCTGGGT0.150800.089000.672400.750000.956500.62500


Target Position: 3512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3512CCCAUCGCCGCCAUCAUCA72.7352023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3103530CCCATCGCCGCCATCATCATGATGATGGCGGCGATGGG0.210600.053500.767200.750001.000001.00000


Target Position: 4807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4807GCCUAUAUGCCAGCGCCCA74.24421781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5884825GCCTATATGCCAGCGCCCATGGGCGCTGGCATATAGGC0.137100.030200.655200.750000.913000.87500


Target Position: 4106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4106AGGCACAUCAAUGUCACGA73.57041881

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7774124AGGCACATCAATGTCACGATCGTGACATTGATGTGCCT0.077500.006300.551700.500001.000001.00000


Target Position: 379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
379ACCUCUCAACAAAACCAAA85.4423446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515397ACCTCTCAACAAAACCAAATTTGGTTTTGTTGAGAGGT0.306400.027600.853400.750001.000001.00000


Target Position: 4421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4421CCUGACAAGCUAGACCAUG64.97493508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7084439CCTGACAAGCTAGACCATGCATGGTCTAGCTTGTCAGG0.142200.006900.689700.750001.000001.00000


Target Position: 5979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5979UCUCCCUUGGCAUCCGGUU55.2635134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7375997TCTCCCTTGGCATCCGGTTAACCGGATGCCAAGGGAGA0.072200.006200.577600.750000.956500.75000


Target Position: 1152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1152UCAUGAGCUUCUUCUUCAA88.0873285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6761170TCATGAGCTTCTTCTTCAATTGAAGAAGAAGCTCATGA0.252300.112700.577600.750001.000001.00000


Target Position: 1708, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708GAUCAAAGUGCUAAAGCUU88.5554264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111726GATCAAAGTGCTAAAGCTTAAGCTTTAGCACTTTGATC0.056200.005100.543100.750000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1706-1728GGGATCAAAGTGCTAAAGCTTTAAAGCUUUAGCACUUUGAUCCCGAUCAAAGUGCUAAAGCUUUAU18.312.022


Target Position: 6019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6019UUGUGGAGAACUUGAUAUU71.69512225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9166037TTGTGGAGAACTTGATATTAATATCAAGTTCTCCACAA0.128600.033100.637900.500001.000001.00000


Target Position: 4609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4609CUGCACCGUCCUCACCAUC60.90494298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7534627CTGCACCGTCCTCACCATCGATGGTGAGGACGGTGCAG0.188200.053400.603400.500000.913000.75000


Target Position: 624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
624UAGCCAUCCUGAGAUCCAA83.8654573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923642TAGCCATCCTGAGATCCAATTGGATCTCAGGATGGCTA0.486800.013200.525900.500000.972801.00000


Target Position: 6108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6108UACUGUUCCGGGGAGAAAA74.78171681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8126126TACTGTTCCGGGGAGAAAATTTTCTCCCCGGAACAGTA0.053800.008600.681000.500000.994600.75000


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008CCUCCAAGGAUCCUGCCCA78.00831198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531026CCTCCAAGGATCCTGCCCATGGGCAGGATCCTTGGAGG0.034000.002800.500000.750000.956501.00000


Target Position: 6021, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6021GUGGAGAACUUGAUAUUUA98.025823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4876039GTGGAGAACTTGATATTTATAAATATCAAGTTCTCCAC0.139400.030400.758600.750001.000001.00000


Target Position: 5555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5555CCCUCCCCACCCACCCCGA60.72754338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5665573CCCTCCCCACCCACCCCGATCGGGGTGGGTGGGGAGGG0.418100.277100.698300.750001.000001.00000


Target Position: 1692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1692ACGAAAUUCUCAAUGGGAU76.93271355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171710ACGAAATTCTCAATGGGATATCCCATTGAGAATTTCGT0.071400.007900.594800.750001.000001.00000


Target Position: 1642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1642GUAUCAGGUGGCCCACAUG75.13421637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911660GTATCAGGTGGCCCACATGCATGTGGGCCACCTGATAC0.058100.003200.525900.500000.923901.00000


Target Position: 5688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5688AUUUGACCUUGACUAGAAA88.8936248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9205706ATTTGACCTTGACTAGAAATTTCTAGTCAAGGTCAAAT0.151000.018900.508600.500001.000001.00000


Target Position: 6416, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6416GCAUAUAUUUAUUUUUUGU85.8588425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6116434GCATATATTTATTTTTTGTACAAAAAATAAATATATGC0.098700.059400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6414-6436ACGCATATATTTATTTTTTGTAAACAAAAAAUAAAUAUAUGCGUGCAUAUAUUUAUUUUUUGUAAU-2.9-0.322


Target Position: 5691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5691UGACCUUGACUAGAAAUAG69.57272605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7705709TGACCTTGACTAGAAATAGCTATTTCTAGTCAAGGTCA0.321800.031900.551700.500001.000001.00000


Target Position: 3103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3103CCUCAGCAUCUUCCUUUUC64.27933634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3373121CCTCAGCATCTTCCTTTTCGAAAAGGAAGATGCTGAGG0.297100.173400.672400.750001.000001.00000


Target Position: 1856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1856GCCUUGUGCACAUUUGCCG60.82354314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211874GCCTTGTGCACATTTGCCGCGGCAAATGTGCACAAGGC0.118900.004200.586200.500000.913000.75000


Target Position: 1111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1111UCUGUUUAAGGUGUUAUAC57.77024802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441129TCTGTTTAAGGTGTTATACGTATAACACCTTAAACAGA0.054300.010600.543100.500001.000001.00000


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099GUGGAACCCCUCUCUGUUU78.40671156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241117GTGGAACCCCTCTCTGTTTAAACAGAGAGGGGTTCCAC0.050900.005300.793100.750000.962000.75000


Target Position: 6142, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6142GAACUUCUUGGGAAUAGAA97.46231

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6140-6162TTGAACTTCTTGGGAATAGAAGTUUCUAUUCCCAAGAAGUUCAAGAACUUCUUGGGAAUAGAAGUU16.017.713


Target Position: 1647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1647AGGUGGCCCACAUGAAGAG66.42663217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621665AGGTGGCCCACATGAAGAGCTCTTCATGTGGGCCACCT0.135900.011500.534500.500000.923900.75000


Target Position: 5406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5406CUCUACCAGUUCUCGUUUU75.32441607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6295424CTCTACCAGTTCTCGTTTTAAAACGAGAACTGGTAGAG0.092300.065300.810300.750001.000001.00000


Target Position: 4215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4215CCGAAGGAGAGAUCAUCAU79.9891961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6014233CCGAAGGAGAGATCATCATATGATGATCTCTCCTTCGG0.124200.010600.758601.000001.000001.00000


Target Position: 228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
228GGAAUGUCACGUGGAAUAC72.18082134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884246GGAATGTCACGTGGAATACGTATTCCACGTGACATTCC0.040800.007900.689700.750001.000001.00000


Target Position: 5791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5791GUUGGUUGCUUACAGUGUU81.8803751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9855809GTTGGTTGCTTACAGTGTTAACACTGTAAGCAACCAAC0.046300.004000.500000.750001.000001.00000


Target Position: 3871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3871CUCAGUGUCUUACUCAUUG72.92641998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9443889CTCAGTGTCTTACTCATTGCAATGAGTAAGACACTGAG0.032700.002900.663800.500001.000001.00000


Target Position: 6078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6078UUUGAAUAUCAAUGAUUUU72.3352092

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9556096TTTGAATATCAATGATTTTAAAATCATTGATATTCAAA0.138100.033300.500000.500001.000001.00000


Target Position: 5613, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5613GAACAAUCAAUGCUGUUAU88.7611253

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8561319GAACAATCAATGCTGTTAT1/1/0/094.96ABCC1NM_019899.2+NM_004996.3+NM_019862.2+NM_019900.2+NM_019898.21+1+1+1+1NANANA16:16235980..16235998(+)00ABCC1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6385631GAACAATCAATGCTGTTATATAACAGCATTGATTGTTC0.149800.009400.629300.750000.956500.62500


Target Position: 3099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3099CCUUCCUCAGCAUCUUCCU70.64662410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9923117CCTTCCTCAGCATCTTCCTAGGAAGATGCTGAGGAAGG0.771400.289200.500000.750001.000001.00000


Target Position: 3215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3215GUCCGGCUGAGCGUCUAUG62.59323977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753233GTCCGGCTGAGCGTCTATGCATAGACGCTCAGCCGGAC0.322300.002200.663800.500001.000001.00000


Target Position: 1121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1121GUGUUAUACAAGACCUUUG74.77541682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251139GTGTTATACAAGACCTTTGCAAAGGTCTTGTATAACAC0.055100.010100.646600.500001.000001.00000


Target Position: 6087, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6087CAAUGAUUUUUUUUUUUUA95.557847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5826105CAATGATTTTTTTTTTTTATAAAAAAAAAAAATCATTG0.156400.061900.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6085-6107ATCAATGATTTTTTTTTTTTAAGUAAAAAAAAAAAAUCAUUGAUCAAUGAUUUUUUUUUUUUAAGU-11.37.210


Target Position: 4505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4505CUGCUGAGGAAGACGAAGA80.3648906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9604523CTGCTGAGGAAGACGAAGATCTTCGTCTTCCTCAGCAG0.664000.002400.560300.500001.000001.00000


Target Position: 4049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4049CGAGUGGAAUUCCGGAACU76.34681451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7684067CGAGTGGAATTCCGGAACTAGTTCCGGAATTCCACTCG0.064300.005400.586200.750000.962001.00000


Target Position: 4297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4297CCAGGACCCUGUUUUGUUU82.2291710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674315CCAGGACCCTGTTTTGTTTAAACAAAACAGGGTCCTGG0.406100.002300.844801.000000.907600.62500


Target Position: 5925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5925GGGUACCAAAAAAAUGUCC61.99034105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8175943GGGTACCAAAAAAATGTCCGGACATTTTTTTGGTACCC0.122700.039800.620700.500001.000001.00000


Target Position: 1924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1924CGUGUCUUUGGCCUUGUUC63.31133817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541942CGTGTCTTTGGCCTTGTTCGAACAAGGCCAAAGACACG0.034200.002500.603400.750001.000001.00000


Target Position: 3738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3738CCUAUUACCCCAGCAUCGU65.97943310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7023756CCTATTACCCCAGCATCGTACGATGCTGGGGTAATAGG0.149300.161900.569000.750000.994600.62500


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045GGUGGAUGCGAAUGAGGAG78.95941100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8161063GGTGGATGCGAATGAGGAGCTCCTCATTCGCATCCACC0.430800.017500.543100.750001.000001.00000


Target Position: 3348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3348GGUCACCCAUGAGCUUCUU76.6991396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2723366GGTCACCCATGAGCTTCTTAAGAAGCTCATGGGTGACC0.321800.060300.715501.000000.989100.75000


Target Position: 318, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318CCUGUUUCCCCUUCUACUU75.02321655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
237336CCTGTTTCCCCTTCTACTTAAGTAGAAGGGGAAACAGG0.922400.233800.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
316-338GGCCTGTTTCCCCTTCTACTTCCAAGUAGAAGGGGAAACAGGCCCCUGUUUCCCCUUCUACUUCCU18.919.222


Target Position: 6020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6020UGUGGAGAACUUGAUAUUU75.56411565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6246038TGTGGAGAACTTGATATTTAAATATCAAGTTCTCCACA0.812300.028800.706900.750001.000001.00000


Target Position: 5693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5693ACCUUGACUAGAAAUAGAG69.532617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8105711ACCTTGACTAGAAATAGAGCTCTATTTCTAGTCAAGGT0.239800.040600.543100.500001.000001.00000


Target Position: 1705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1705UGGGAUCAAAGUGCUAAAG56.76224926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131723TGGGATCAAAGTGCTAAAGCTTTAGCACTTTGATCCCA0.053800.004800.706900.500001.000001.00000


Target Position: 5799, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5799CUUACAGUGUUGAUUGAUU85.4486445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5405817CTTACAGTGTTGATTGATTAATCAATCAACACTGTAAG0.189200.018800.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5797-5819TGCTTACAGTGTTGATTGATTTTAAUCAAUCAACACUGUAAGCACUUACAGUGUUGAUUGAUUUUU16.219.032


Target Position: 4272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4272UCCGCUUCAAGAUCACCAU67.67012981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2754290TCCGCTTCAAGATCACCATATGGTGATCTTGAAGCGGA0.303300.114300.715500.750001.000001.00000


Target Position: 5955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5955UUCCUUGUUUUUAGAUGUU64.6973557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8755973TTCCTTGTTTTTAGATGTTAACATCTAAAAACAAGGAA0.096200.096500.525900.500001.000001.00000


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684UUCGUGACAUCACUUUCUA77.46341273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958702TTCGTGACATCACTTTCTATAGAAAGTGATGTCACGAA0.167500.007600.500000.500000.913000.87500


Target Position: 6090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6090UGAUUUUUUUUUUUUAAGU67.84752945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8896108TGATTTTTTTTTTTTAAGTACTTAAAAAAAAAAAATCA0.152100.081000.517200.500001.000001.00000


Target Position: 1113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113UGUUUAAGGUGUUAUACAA93.514479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7351131TGTTTAAGGTGTTATACAATTGTATAACACCTTAAACA0.109000.007700.560300.750001.000001.00000


Target Position: 2703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2703GCGGCAAGAUCUCUGAGAU89.4055220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852721GCGGCAAGATCTCTGAGATATCTCAGAGATCTTGCCGC0.058000.005100.741401.000001.000001.00000


Target Position: 4981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4981GCGAACCACCCAAAACACG60.49724376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7894999GCGAACCACCCAAAACACGCGTGTTTTGGGTGGTTCGC0.057600.020300.646600.500001.000001.00000


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461UGGACGCUCAGAGGUUCAU65.71783367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6541479TGGACGCTCAGAGGTTCATATGAACCTCTGAGCGTCCA0.089800.009000.689700.750001.000001.00000


Target Position: 5599, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5599GUUCAACAUUGUAAGAACA92.3707110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5597-5619TTGTTCAACATTGTAAGAACAATUGUUCUUACAAUGUUGAACAAGUUCAACAUUGUAAGAACAAUU14.620.522


Target Position: 3620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3620UCCCCGGUCUAUUCCCAUU64.80193538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4093638TCCCCGGTCTATTCCCATTAATGGGAATAGACCGGGGA0.393300.028100.862100.750000.929300.87500


Target Position: 2987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2987GAGGCCAAGAAGGAGGAGA74.59361708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6313005GAGGCCAAGAAGGAGGAGATCTCCTCCTTCTTGGCCTC0.168400.021800.586200.500000.978300.87500


Target Position: 2416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2416CCCAGACCUGGAAAUCCUG66.8723135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622434CCCAGACCTGGAAATCCTGCAGGATTTCCAGGTCTGGG0.632400.002400.706900.750000.902200.62500


Target Position: 5268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5268GGCUGCAGUUUUGUGGUUG68.05452901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5895286GGCTGCAGTTTTGTGGTTGCAACCACAAAACTGCAGCC0.136600.011500.853400.750001.000001.00000


Target Position: 6415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6415CGCAUAUAUUUAUUUUUUG76.45231437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6076433CGCATATATTTATTTTTTGCAAAAAATAAATATATGCG0.099400.071600.775900.750001.000001.00000


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581GGGAUCAUGCUCACUUUCU79.51051030

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
742599GGGATCATGCTCACTTTCTAGAAAGTGAGCATGATCCC0.066800.008900.767200.750001.000001.00000


Target Position: 4191, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4191GCUUAUUUCGGAUCAACGA83.971563

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4189-4211GGGCTTATTTCGGATCAACGAGTUCGUUGAUCCGAAAUAAGCCCGCUUAUUUCGGAUCAACGAGUU21.1-4.333


Target Position: 5950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5950GUCUUUUCCUUGUUUUUAG73.18721955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8845968GTCTTTTCCTTGTTTTTAGCTAAAAACAAGGAAAAGAC0.164700.148200.646600.500001.000001.00000


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891CGAGAACAACAUCCUGGAU86.3054392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5901909CGAGAACAACATCCTGGATATCCAGGATGTTGTTCTCG0.113700.030000.612101.000000.972800.75000


Target Position: 6385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6385CCCAGAGAGCAUCUUUCUU79.17961077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7986403CCCAGAGAGCATCTTTCTTAAGAAAGATGCTCTCTGGG0.074400.004700.853401.000001.000001.00000


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378CACCUCUCAACAAAACCAA83.7546583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451396CACCTCTCAACAAAACCAATTGGTTTTGTTGAGAGGTG0.288500.027400.646600.750001.000001.00000


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664AGCAAAGACAAUCGGAUCA77.44181279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431682AGCAAAGACAATCGGATCATGATCCGATTGTCTTTGCT0.049200.052700.629300.500001.000001.00000


Target Position: 2319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319CCUGGAUUCAGAAUGAUUC72.14842143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6402337CCTGGATTCAGAATGATTCGAATCATTCTGAATCCAGG0.127500.009300.672400.750000.913000.62500


Target Position: 4892, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4892CAGACAACCAAAACAUAUU86.0454415

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7489219CAGACAACCAAAACATATT1/1/0/094.96ABCC1NM_004996.3+NM_019899.2+NM_019900.2+NM_019862.2+NM_019898.21+1+1+1+1NANANA16:16235259..16235277(+)|X:65192316..65192334(+)00ABCC1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4664910CAGACAACCAAAACATATTAATATGTTTTGGTTGTCTG0.920900.900300.775900.750001.000001.00000


Target Position: 526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
526GCUGCUUGCUACCUUUUUA93.454184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455544GCTGCTTGCTACCTTTTTATAAAAAGGTAGCAAGCAGC0.246600.023000.819001.000001.000001.00000


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879CGUGACCAUUGACGAGAAC70.13912491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051897CGTGACCATTGACGAGAACGTTCTCGTCAATGGTCACG0.054700.009300.629300.750001.000001.00000


Target Position: 1880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880GUGACCAUUGACGAGAACA81.2678812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511898GTGACCATTGACGAGAACATGTTCTCGTCAATGGTCAC0.062000.012800.586200.500001.000001.00000


Target Position: 6132, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6132CUCAAAACUUGAACUUCUU80.5822883

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6130-6152GTCTCAAAACTTGAACTTCTTGGAAGAAGUUCAAGUUUUGAGACCUCAAAACUUGAACUUCUUGGU17.714.922


Target Position: 6474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6474GGGGGAUCCUUUUGUAAUG75.66241551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7106492GGGGGATCCTTTTGTAATGCATTACAAAAGGATCCCCC0.105500.006800.836200.750000.989100.75000


Target Position: 6262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6262GCAUCUUUUAAAGCCUGUU75.36611602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7076280GCATCTTTTAAAGCCTGTTAACAGGCTTTAAAAGATGC0.073600.057600.706901.000001.000001.00000


Target Position: 3621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3621CCCCGGUCUAUUCCCAUUU66.17273271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4283639CCCCGGTCTATTCCCATTTAAATGGGAATAGACCGGGG0.404200.025400.991401.000000.929301.00000


Target Position: 6408, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6408GCGAAAACGCAUAUAUUUA93.250788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3486426GCGAAAACGCATATATTTATAAATATATGCGTTTTCGC0.192500.141300.887901.000000.902200.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6406-6428AGGCGAAAACGCATATATTTATTUAAAUAUAUGCGUUUUCGCCUGCGAAAACGCAUAUAUUUAUUU-8.015.321


Target Position: 6468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6468AGUUUUGGGGGAUCCUUUU70.74722394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8716486AGTTTTGGGGGATCCTTTTAAAAGGATCCCCCAAAACT0.076100.003400.706900.750000.967401.00000


Target Position: 5586, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5586CCUUUUUUCUUUUGUUCAA85.791428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2785604CCTTTTTTCTTTTGTTCAATTGAACAAAAGAAAAAAGG0.260900.204900.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5584-5606TCCCTTTTTTCTTTTGTTCAACAUUGAACAAAAGAAAAAAGGGACCUUUUUUCUUUUGUUCAACAU20.5-5.921


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631CCUGAGAUCCAAAAUUAUG75.40941595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
284649CCTGAGATCCAAAATTATGCATAATTTTGGATCTCAGG0.572200.319300.689700.750001.000001.00000


Target Position: 1110, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110CUCUGUUUAAGGUGUUAUA89.8243203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9301128CTCTGTTTAAGGTGTTATATATAACACCTTAAACAGAG0.060800.002800.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1108-1130CTCTCTGTTTAAGGTGTTATACAUAUAACACCUUAAACAGAGAGCUCUGUUUAAGGUGUUAUACAU14.619.222


Target Position: 2143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2143CGACCCUCCCACACUGAAU81.7559759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4722161CGACCCTCCCACACTGAATATTCAGTGTGGGAGGGTCG0.144100.024200.784501.000001.000001.00000


Target Position: 6475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6475GGGGAUCCUUUUGUAAUGA83.526602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6316493GGGGATCCTTTTGTAATGATCATTACAAAAGGATCCCC0.093600.009600.767200.750001.000001.00000


Target Position: 4417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4417CCUUCCUGACAAGCUAGAC65.49943421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8714435CCTTCCTGACAAGCTAGACGTCTAGCTTGTCAGGAAGG0.127900.005600.525900.750000.972800.62500


Target Position: 374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374AUGACACCUCUCAACAAAA87.4929320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
765392ATGACACCTCTCAACAAAATTTTGTTGAGAGGTGTCAT0.269200.050900.655200.500000.972800.62500


Target Position: 4214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4214GCCGAAGGAGAGAUCAUCA91.603137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6344232GCCGAAGGAGAGATCATCATGATGATCTCTCCTTCGGC0.146800.009500.775900.750001.000001.00000


Target Position: 1977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1977UGGUCAUCAGCAGCAUCGU66.56213197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8781995TGGTCATCAGCAGCATCGTACGATGCTGCTGATGACCA0.041900.023200.569000.500001.000001.00000


Target Position: 5594, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5594CUUUUGUUCAACAUUGUAA87.9273294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6105612CTTTTGTTCAACATTGTAATTACAATGTTGAACAAAAG0.335800.030200.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5592-5614TTCTTTTGTTCAACATTGTAAGAUUACAAUGUUGAACAAAAGAACUUUUGUUCAACAUUGUAAGAU13.55.603


Target Position: 3523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3523CAUCAUCAUCCCGCCCCUU72.28342113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8853541CATCATCATCCCGCCCCTTAAGGGGCGGGATGATGATG0.274000.178600.517200.750001.000001.00000


Target Position: 6195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6195GUGAGAAGCUCGCCCUGUG74.33351752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9586213GTGAGAAGCTCGCCCTGTGCACAGGGCGAGCTTCTCAC0.047400.002400.500000.500000.967400.75000


Target Position: 5798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5798GCUUACAGUGUUGAUUGAU80.4805891

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6985816GCTTACAGTGTTGATTGATATCAATCAACACTGTAAGC0.088700.007500.672401.000001.000001.00000


Target Position: 5924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5924UGGGUACCAAAAAAAUGUC59.23944564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8455942TGGGTACCAAAAAAATGTCGACATTTTTTTGGTACCCA0.140800.021000.525900.500001.000001.00000


Target Position: 3089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3089CUCUUCAUCUCCUUCCUCA86.3066391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7773107CTCTTCATCTCCTTCCTCATGAGGAAGGAGATGAAGAG0.279600.093000.586200.500001.000001.00000


Target Position: 3193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3193CGGGACUCAGGAGCACACG58.62114663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9893211CGGGACTCAGGAGCACACGCGTGTGCTCCTGAGTCCCG0.115400.009800.637900.500001.000001.00000


Target Position: 2360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2360GGAUGUCAGCUGGAGGAAC74.03641822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392378GGATGTCAGCTGGAGGAACGTTCCTCCAGCTGACATCC0.033100.005900.724100.750001.000001.00000


Target Position: 6122, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6122GAAAAACAGUCUCAAAACU85.2981460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6120-6142GAGAAAAACAGTCTCAAAACTTGAGUUUUGAGACUGUUUUUCUCGAAAAACAGUCUCAAAACUUGU14.95.622


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296GUGCCUUGUUUUUACCUCU79.6901998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
744314GTGCCTTGTTTTTACCTCTAGAGGTAAAAACAAGGCAC0.510500.021000.569000.500001.000001.00000


Target Position: 5647, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5647GAUUGAUGUGGGGUAAAUA98.459422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8335665GATTGATGTGGGGTAAATATATTTACCCCACATCAATC0.062000.004100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5645-5667ATGATTGATGTGGGGTAAATATTUAUUUACCCCACAUCAAUCAUGAUUGAUGUGGGGUAAAUAUUU13.913.633


Target Position: 6472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6472UUGGGGGAUCCUUUUGUAA72.7112028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8596490TTGGGGGATCCTTTTGTAATTACAAAAGGATCCCCCAA0.117500.003600.612100.500000.967400.75000


Target Position: 1855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855GGCCUUGUGCACAUUUGCC66.14163278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781873GGCCTTGTGCACATTTGCCGGCAAATGTGCACAAGGCC0.177700.004200.500000.500000.913000.62500


Target Position: 5241, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5241UCUACCAGGAACGCUUCAU61.75044175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8895259TCTACCAGGAACGCTTCATATGAAGCGTTCCTGGTAGA0.430400.003200.569000.750001.000001.00000


Target Position: 5215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5215CAUCACCUCUAACAUCCUU82.9832649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8885233CATCACCTCTAACATCCTTAAGGATGTTAGAGGTGATG0.269300.187900.517200.750001.000001.00000


Target Position: 5887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5887AAGUAAAGAACACGAAAUA87.5636312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9345905AAGTAAAGAACACGAAATATATTTCGTGTTCTTTACTT0.250800.104300.594800.500001.000001.00000


Target Position: 6265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6265UCUUUUAAAGCCUGUUCUU68.92262740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9076283TCTTTTAAAGCCTGTTCTTAAGAACAGGCTTTAAAAGA0.037800.027400.586200.750001.000001.00000


Target Position: 5876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5876UGAAGCUUUCAAAGUAAAG62.91513900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6285894TGAAGCTTTCAAAGTAAAGCTTTACTTTGAAAGCTTCA0.347900.073100.586200.500001.000001.00000


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512CAGCCCCCCUGCAAGUCAU77.27461300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8851530CAGCCCCCCTGCAAGTCATATGACTTGCAGGGGGGCTG0.040600.043500.629300.750000.951100.62500


Target Position: 6409, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6409CGAAAACGCAUAUAUUUAU87.5866311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3676427CGAAAACGCATATATTTATATAAATATATGCGTTTTCG0.179700.128500.750001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6407-6429GGCGAAAACGCATATATTTATTTAUAAAUAUAUGCGUUUUCGCCCGAAAACGCAUAUAUUUAUUUU-8.015.332


Target Position: 5805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5805GUGUUGAUUGAUUUUGUUC70.74472395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6695823GTGTTGATTGATTTTGTTCGAACAAAATCAATCAACAC0.501600.052000.620700.500001.000001.00000


Target Position: 3819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3819CCCUGUUUGCGGUGAUCUC67.91172929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8313837CCCTGTTTGCGGTGATCTCGAGATCACCGCAAACAGGG0.049900.009800.681000.750000.934800.75000


Target Position: 3093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3093UCAUCUCCUUCCUCAGCAU77.84291222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7113111TCATCTCCTTCCTCAGCATATGCTGAGGAAGGAGATGA0.324100.141500.569000.750001.000001.00000


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878ACGUGACCAUUGACGAGAA91.3257148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8521896ACGTGACCATTGACGAGAATTCTCGTCAATGGTCACGT0.047100.006300.603400.750001.000001.00000


Target Position: 6165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6165UGGGCUGAGAAGUAACAUU76.20481479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9746183TGGGCTGAGAAGTAACATTAATGTTACTTCTCAGCCCA0.029400.002200.836200.750001.000001.00000


Target Position: 4864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4864ACUGAAACCAAAACAUAAA85.3756455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2184882ACTGAAACCAAAACATAAATTTATGTTTTGGTTTCAGT0.987500.611800.706900.750001.000001.00000


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282GCUGUUUGUCACUGCCUGC66.95563115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681300GCTGTTTGTCACTGCCTGCGCAGGCAGTGACAAACAGC0.146400.011700.500000.500000.972800.62500


Target Position: 5615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5615ACAAUCAAUGCUGUUAUUA77.96321204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4995633ACAATCAATGCTGTTATTATAATAACAGCATTGATTGT0.152200.039600.672400.750001.000001.00000


Target Position: 5111, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5111GAAUUGGUUGUAUAGAAGA91.1757153

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5109-5131AGGAATTGGTTGTATAGAAGATCUCUUCUAUACAACCAAUUCCUGAAUUGGUUGUAUAGAAGAUCU11.618.823


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665GCAAAGACAAUCGGAUCAA84.9818488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901683GCAAAGACAATCGGATCAATTGATCCGATTGTCTTTGC0.040000.043000.706901.000001.000001.00000


Target Position: 5580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5580GCUUUCCCUUUUUUCUUUU73.2531941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1145598GCTTTCCCTTTTTTCTTTTAAAAGAAAAAAGGGAAAGC0.486400.309200.853401.000001.000001.00000


Target Position: 2851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2851AGCAAAGCAAAUGGAGAAU68.64782784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4722869AGCAAAGCAAATGGAGAATATTCTCCATTTGCTTTGCT0.418700.201400.844800.750001.000001.00000


Target Position: 5797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5797UGCUUACAGUGUUGAUUGA82.2414708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8915815TGCTTACAGTGTTGATTGATCAATCAACACTGTAAGCA0.057700.005000.629300.500001.000001.00000


Target Position: 1041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041CCAAGGUGGAUGCGAAUGA78.22071171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651059CCAAGGTGGATGCGAATGATCATTCGCATCCACCTTGG0.180900.021500.620700.750001.000001.00000


Target Position: 6407, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6407GGCGAAAACGCAUAUAUUU85.6642436

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2640719GGCGAAAACGCATATATTT1/1/0/097.75ABCC1NM_019899.2+NM_004996.3+NM_019900.2+NM_019862.2+NM_019898.21+1+1+1+1NANANA16:16236774..16236792(+)00ABCC1(0.002)


Target Position: 6206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6206GCCCUGUGUUUGAAACCGU75.22661624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5646224GCCCTGTGTTTGAAACCGTACGGTTTCAAACACAGGGC0.112700.047000.724100.750001.000001.00000


Target Position: 4296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4296CCCAGGACCCUGUUUUGUU76.78791384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7894314CCCAGGACCCTGTTTTGTTAACAAAACAGGGTCCTGGG0.217600.004800.844801.000000.907600.75000


Target Position: 3081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3081CCAUCGGACUCUUCAUCUC74.98041660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8283099CCATCGGACTCTTCATCTCGAGATGAAGAGTCCGATGG0.170900.018200.534500.750000.989100.62500


Target Position: 721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
721ACUCAUUCAGCUCGUCUUG62.43444011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
993739ACTCATTCAGCTCGTCTTGCAAGACGAGCTGAATGAGT0.453300.383300.560300.500000.989100.62500


Target Position: 5584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5584UCCCUUUUUUCUUUUGUUC53.19625417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9505602TCCCTTTTTTCTTTTGTTCGAACAAAAGAAAAAAGGGA0.481000.285600.698300.500001.000001.00000


Target Position: 4889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4889ACCCAGACAACCAAAACAU74.33661751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3494907ACCCAGACAACCAAAACATATGTTTTGGTTGTCTGGGT0.975800.845100.698300.750001.000001.00000


Target Position: 3104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3104CUCAGCAUCUUCCUUUUCA81.848755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8093122CTCAGCATCTTCCTTTTCATGAAAAGGAAGATGCTGAG0.205300.140000.586200.500001.000001.00000


Target Position: 4275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4275GCUUCAAGAUCACCAUCAU93.060594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2504293GCTTCAAGATCACCATCATATGATGGTGATCTTGAAGC0.543400.202500.698301.000000.967400.75000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951AGAACUGGAAGAAGGAAUG66.75453152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
909969AGAACTGGAAGAAGGAATGCATTCCTTCTTCCAGTTCT0.037500.009200.569000.500001.000001.00000


Target Position: 3965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3965CUCAAGGAGUAUUCAGAGA83.4577612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7793983CTCAAGGAGTATTCAGAGATCTCTGAATACTCCTTGAG0.073700.011400.586200.500001.000001.00000


Target Position: 4050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4050GAGUGGAAUUCCGGAACUA93.893471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7274068GAGTGGAATTCCGGAACTATAGTTCCGGAATTCCACTC0.069600.007600.637900.750000.962001.00000


Target Position: 3869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3869CUCUCAGUGUCUUACUCAU89.3946223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9193887CTCTCAGTGTCTTACTCATATGAGTAAGACACTGAGAG0.036500.005400.655200.750001.000001.00000


Target Position: 2313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2313AGCAGGCCUGGAUUCAGAA84.281532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232331AGCAGGCCTGGATTCAGAATTCTGAATCCAGGCCTGCT0.102100.004200.681000.750000.902200.62500


Target Position: 6296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6296UUAGAGCCCAAAGUGGAAU58.39064707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9296314TTAGAGCCCAAAGTGGAATATTCCACTTTGGGCTCTAA0.106400.002800.525900.500000.934800.75000


Target Position: 3097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3097CUCCUUCCUCAGCAUCUUC66.01013301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7923115CTCCTTCCTCAGCATCTTCGAAGATGCTGAGGAAGGAG0.594200.205300.637900.500001.000001.00000


Target Position: 4884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4884ACCAAACCCAGACAACCAA77.29591294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5454902ACCAAACCCAGACAACCAATTGGTTGTCTGGGTTTGGT0.969500.828500.706900.750001.000001.00000


Target Position: 375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
375UGACACCUCUCAACAAAAC64.75823546

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982393TGACACCTCTCAACAAAACGTTTTGTTGAGAGGTGTCA0.207700.033500.577600.500001.000001.00000


Target Position: 1656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1656ACAUGAAGAGCAAAGACAA93.46383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601674ACATGAAGAGCAAAGACAATTGTCTTTGCTCTTCATGT0.437500.086800.560300.750001.000001.00000


Target Position: 1978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1978GGUCAUCAGCAGCAUCGUG79.28761060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9291996GGTCATCAGCAGCATCGTGCACGATGCTGCTGATGACC0.034300.025600.560300.750001.000001.00000


Target Position: 5620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5620CAAUGCUGUUAUUACUGUU90.1409183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9825638CAATGCTGTTATTACTGTTAACAGTAATAACAGCATTG0.152200.047800.500000.750001.000001.00000


Target Position: 3351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3351CACCCAUGAGCUUCUUUGA85.9886419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9783369CACCCATGAGCTTCTTTGATCAAAGAAGCTCATGGGTG0.059900.006200.569000.500001.000001.00000


Target Position: 5900, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5900GAAAUACCUCCCAAGUAUU88.237274

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9590019GAAATACCTCCCAAGTATT1/1/0/094.96ABCC1NM_004996.3+NM_019899.2+NM_019900.2+NM_019862.2+NM_019898.21+1+1+1+1NANANA20:51594558..51594576(+)00ABCC1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5898-5920ACGAAATACCTCCCAAGTATTACAAUACUUGGGAGGUAUUUCGUGAAAUACCUCCCAAGUAUUACU11.613.932


Target Position: 4274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4274CGCUUCAAGAUCACCAUCA84.1568547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4174292CGCTTCAAGATCACCATCATGATGGTGATCTTGAAGCG0.347000.234500.698300.750000.967400.62500


Target Position: 6082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6082AAUAUCAAUGAUUUUUUUU73.42211912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9216100AATATCAATGATTTTTTTTAAAAAAAATCATTGATATT0.209000.079600.508600.500001.000001.00000


Target Position: 3623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3623CCGGUCUAUUCCCAUUUCA79.7553990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3853641CCGGTCTATTCCCATTTCATGAAATGGGAATAGACCGG0.510800.031600.689700.750000.929300.75000


Target Position: 5923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5923GUGGGUACCAAAAAAAUGU73.90241841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6305941GTGGGTACCAAAAAAATGTACATTTTTTTGGTACCCAC0.246800.016100.586200.500000.989100.62500


Target Position: 5948, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5948GAGUCUUUUCCUUGUUUUU83.9515566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1075966GAGTCTTTTCCTTGTTTTTAAAAACAAGGAAAAGACTC0.725000.360200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5946-5968TTGAGTCTTTTCCTTGTTTTTAGAAAAACAAGGAAAAGACUCAAGAGUCUUUUCCUUGUUUUUAGU5.617.721


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950AAGAACUGGAAGAAGGAAU71.93742185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
840968AAGAACTGGAAGAAGGAATATTCCTTCTTCCAGTTCTT0.048200.010400.629300.500001.000001.00000


Target Position: 6510, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6510GAACAUUUGCAGUAAAAAA99.158217

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6508-6530GCGAACATTTGCAGTAAAAAAATUUUUUUACUGCAAAUGUUCGCGAACAUUUGCAGUAAAAAAAUU0.05.322


Target Position: 6448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6448CUUUCACAUUAGAUAAACU89.1459238

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6446-6468TTCTTTCACATTAGATAAACTAAAGUUUAUCUAAUGUGAAAGAACUUUCACAUUAGAUAAACUAAU10.020.523


Target Position: 6024, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6024GAGAACUUGAUAUUUAGUU81.1363826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8366042GAGAACTTGATATTTAGTTAACTAAATATCAAGTTCTC0.049200.013600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6022-6044TGGAGAACTTGATATTTAGTTACAACUAAAUAUCAAGUUCUCCAGAGAACUUGAUAUUUAGUUACU4.617.723


Target Position: 4260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4260GCCUGCACGACCUCCGCUU69.67572578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4424278GCCTGCACGACCTCCGCTTAAGCGGAGGTCGTGCAGGC0.152700.057500.862101.000000.923900.75000


Target Position: 3045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3045AGGUCAAGCUUUCCGUGUA89.1488237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7603063AGGTCAAGCTTTCCGTGTATACACGGAAAGCTTGACCT0.061200.006900.663800.750001.000001.00000


Target Position: 326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
326CCCUUCUACUUCCUCUAUC67.43013016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368344CCCTTCTACTTCCTCTATCGATAGAGGAAGTAGAAGGG0.437800.425800.810300.750001.000001.00000


Target Position: 1687, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687GAUGAACGAAAUUCUCAAU88.6325262

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1685-1707CTGATGAACGAAATTCTCAATGGAUUGAGAAUUUCGUUCAUCAGGAUGAACGAAAUUCUCAAUGGU20.421.133


Target Position: 6414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6414ACGCAUAUAUUUAUUUUUU78.2011173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5676432ACGCATATATTTATTTTTTAAAAAATAAATATATGCGT0.112200.068800.775900.750001.000001.00000


Target Position: 1274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1274ACCGUGCUGCUGUUUGUCA77.29151296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8181292ACCGTGCTGCTGTTTGTCATGACAAACAGCAGCACGGT0.075900.004300.629300.500001.000001.00000


Target Position: 6513, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6513CAUUUGCAGUAAAAAAAUA94.970152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6511-6533AACATTTGCAGTAAAAAAATATAUAUUUUUUUACUGCAAAUGUUCAUUUGCAGUAAAAAAAUAUAU-12.020.022


Target Position: 6080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6080UGAAUAUCAAUGAUUUUUU75.79261533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4116098TGAATATCAATGATTTTTTAAAAAATCATTGATATTCA0.163800.053300.724100.750001.000001.00000


Target Position: 6196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6196UGAGAAGCUCGCCCUGUGU67.6872973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8816214TGAGAAGCTCGCCCTGTGTACACAGGGCGAGCTTCTCA0.061100.003800.517200.500000.967400.62500


Target Position: 316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
316GGCCUGUUUCCCCUUCUAC69.29252663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
381334GGCCTGTTTCCCCTTCTACGTAGAAGGGGAAACAGGCC0.346100.119200.819000.750001.000001.00000


Target Position: 4863, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4863CACUGAAACCAAAACAUAA100.859

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6486319CACTGAAACCAAAACATAA1/1/0/094.96ABCC1NM_019899.2+NM_004996.3+NM_019862.2+NM_019900.2+NM_019898.21+1+1+1+1NANANA16:16235230..16235248(+)|14:34007604..34007622(+)00ABCC1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4154881CACTGAAACCAAAACATAATTATGTTTTGGTTTCAGTG0.986600.603700.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4861-4883CACACTGAAACCAAAACATAAAAUUAUGUUUUGGUUUCAGUGUGCACUGAAACCAAAACAUAAAAU6.919.212


Target Position: 4433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4433GACCAUGAAUGUGCAGAAG74.58821711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8304451GACCATGAATGTGCAGAAGCTTCTGCACATTCATGGTC0.057800.024400.681000.500001.000001.00000


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958GAAGAAGGAAUGCGCCAAG71.6022236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
948976GAAGAAGGAATGCGCCAAGCTTGGCGCATTCCTTCTTC0.032200.002900.534500.500001.000001.00000


Target Position: 4818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4818AGCGCCCAGGGAGGAGUCA62.66183961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9084836AGCGCCCAGGGAGGAGTCATGACTCCTCCCTGGGCGCT0.060200.006300.629300.500000.923901.00000


Target Position: 2943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2943ACAUCAGCAGGCACCACAA89.4949215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592961ACATCAGCAGGCACCACAATTGTGGTGCCTGCTGATGT0.145200.022500.560300.750000.994600.75000


Target Position: 5726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5726ACCAGCUGGAAGGUACUAU69.07262710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5745744ACCAGCTGGAAGGTACTATATAGTACCTTCCAGCTGGT0.171200.012500.810300.750000.902200.62500


Target Position: 2983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2983AGCUGAGGCCAAGAAGGAG67.23893056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9433001AGCTGAGGCCAAGAAGGAGCTCCTTCTTGGCCTCAGCT0.217700.002700.543100.500000.967400.62500


Target Position: 5612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5612AGAACAAUCAAUGCUGUUA85.3969451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6515630AGAACAATCAATGCTGTTATAACAGCATTGATTGTTCT0.166600.009100.689700.750000.956500.75000


Target Position: 632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
632CUGAGAUCCAAAAUUAUGA85.1088478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767650CTGAGATCCAAAATTATGATCATAATTTTGGATCTCAG0.568600.375100.560300.500001.000001.00000


Target Position: 5690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5690UUGACCUUGACUAGAAAUA70.13442493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6475708TTGACCTTGACTAGAAATATATTTCTAGTCAAGGTCAA0.283900.028700.603400.500001.000001.00000


Target Position: 680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
680CUGUUUCGUGACAUCACUU82.9559652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
669698CTGTTTCGTGACATCACTTAAGTGATGTCACGAAACAG0.084400.008500.646600.750000.913000.75000


Target Position: 2614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2614CAAGGGGAUGCUGAAGAAC67.02923105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422632CAAGGGGATGCTGAAGAACGTTCTTCAGCATCCCCTTG0.060700.003800.500000.500001.000001.00000


Target Position: 5404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5404AGCUCUACCAGUUCUCGUU78.70951124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4945422AGCTCTACCAGTTCTCGTTAACGAGAACTGGTAGAGCT0.480500.027500.706900.750001.000001.00000


Target Position: 1143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1143CCUACUUCCUCAUGAGCUU81.1873824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3771161CCTACTTCCTCATGAGCTTAAGCTCATGAGGAAGTAGG0.173300.145600.706901.000001.000001.00000


Target Position: 4423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4423UGACAAGCUAGACCAUGAA85.2948461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7854441TGACAAGCTAGACCATGAATTCATGGTCTAGCTTGTCA0.161400.007700.551700.750001.000001.00000


Target Position: 1677, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1677GGAUCAAGCUGAUGAACGA100.35312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681695GGATCAAGCTGATGAACGATCGTTCATCAGCTTGATCC0.098800.002300.577600.750000.967400.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1675-1697TCGGATCAAGCTGATGAACGAAAUCGUUCAUCAGCUUGAUCCGAGGAUCAAGCUGAUGAACGAAAU21.120.423


Target Position: 5578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5578AGGCUUUCCCUUUUUUCUU70.11412496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2425596AGGCTTTCCCTTTTTTCTTAAGAAAAAAGGGAAAGCCT0.757800.474400.706900.750000.907600.62500


Target Position: 6017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6017CAUUGUGGAGAACUUGAUA95.471448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5886035CATTGTGGAGAACTTGATATATCAAGTTCTCCACAATG0.107400.040700.612100.750001.000001.00000


Target Position: 5803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5803CAGUGUUGAUUGAUUUUGU86.9086349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8555821CAGTGTTGATTGATTTTGTACAAAATCAATCAACACTG0.259400.030800.577600.500001.000001.00000


Target Position: 1022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1022GCCCAGCCGAAAGAGAGUU66.92963121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351040GCCCAGCCGAAAGAGAGTTAACTCTCTTTCGGCTGGGC0.155500.016300.853401.000000.962000.62500


Target Position: 2984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2984GCUGAGGCCAAGAAGGAGG58.74724643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9263002GCTGAGGCCAAGAAGGAGGCCTCCTTCTTGGCCTCAGC0.197600.005500.508600.500000.983700.75000


Target Position: 938, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
938CCUGUUUUGGUAAAGAACU72.50392056

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
936-958TGCCTGTTTTGGTAAAGAACTGGAGUUCUUUACCAAAACAGGCACCUGUUUUGGUAAAGAACUGGU13.310.332


Target Position: 6386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6386CCAGAGAGCAUCUUUCUUU84.4658525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7876404CCAGAGAGCATCTTTCTTTAAAGAAAGATGCTCTCTGG0.084900.004900.844801.000001.000001.00000


Target Position: 1662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1662AGAGCAAAGACAAUCGGAU81.5302782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171680AGAGCAAAGACAATCGGATATCCGATTGTCTTTGCTCT0.070400.033700.543100.750001.000001.00000


Target Position: 3624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3624CGGUCUAUUCCCAUUUCAA96.972634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3623642CGGTCTATTCCCATTTCAATTGAAATGGGAATAGACCG0.511400.036000.767201.000000.929300.75000


Target Position: 5657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5657GGGUAAAUAUUAAGGAGAU94.245265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5595675GGGTAAATATTAAGGAGATATCTCCTTAATATTTACCC0.114100.068700.810301.000001.000001.00000


Target Position: 5949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5949AGUCUUUUCCUUGUUUUUA79.7916980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3395967AGTCTTTTCCTTGTTTTTATAAAAACAAGGAAAAGACT0.605600.458700.672400.750001.000001.00000


Target Position: 2704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2704CGGCAAGAUCUCUGAGAUG78.97681097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442722CGGCAAGATCTCTGAGATGCATCTCAGAGATCTTGCCG0.048000.006100.758600.750001.000001.00000


Target Position: 6022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6022UGGAGAACUUGAUAUUUAG77.44451278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7586040TGGAGAACTTGATATTTAGCTAAATATCAAGTTCTCCA0.061900.025100.672400.500001.000001.00000


Target Position: 4861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4861CACACUGAAACCAAAACAU83.7369586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4794879CACACTGAAACCAAAACATATGTTTTGGTTTCAGTGTG0.898300.606400.637900.750001.000001.00000


Target Position: 1741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1741GGCAUUCAAGGACAAGGUG68.90122746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8471759GGCATTCAAGGACAAGGTGCACCTTGTCCTTGAATGCC0.047700.009100.706900.750001.000001.00000


Target Position: 5242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5242CUACCAGGAACGCUUCAUU79.60341012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9375260CTACCAGGAACGCTTCATTAATGAAGCGTTCCTGGTAG0.206300.002700.663800.750001.000001.00000


Target Position: 1178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1178CACGACCUGAUGAUGUUUU75.58731563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5301196CACGACCTGATGATGTTTTAAAACATCATCAGGTCGTG0.165600.016600.793100.750001.000001.00000


Target Position: 359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
359CGAGGCUACAUUCAGAUGA82.5384678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
747377CGAGGCTACATTCAGATGATCATCTGAATGTAGCCTCG0.198800.005900.569000.750001.000001.00000


Target Position: 3542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3542GGCCUCAUCUACUUCUUCG73.98021829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7033560GGCCTCATCTACTTCTTCGCGAAGAAGTAGATGAGGCC0.226200.165300.706900.500001.000001.00000


Target Position: 6437, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6437GUUAUACCAUUCUUUCACA92.5052104

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6435-6457AAGTTATACCATTCTTTCACATTUGUGAAAGAAUGGUAUAACUUGUUAUACCAUUCUUUCACAUUU19.215.332


Target Position: 6256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6256GAAGCAGCAUCUUUUAAAG82.8505659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9156274GAAGCAGCATCTTTTAAAGCTTTAAAAGATGCTGCTTC0.225100.061500.534500.500001.000001.00000


Target Position: 6048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6048UGCUCUUCCAGGACACGAA82.5286680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5836066TGCTCTTCCAGGACACGAATTCGTGTCCTGGAAGAGCA0.108900.013900.681000.750000.972800.62500


Target Position: 695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
695ACUUUCUACGUCUACUUUU74.40781739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536713ACTTTCTACGTCTACTTTTAAAAGTAGACGTAGAAAGT0.318200.199500.706900.750001.000001.00000


Target Position: 5646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5646UGAUUGAUGUGGGGUAAAU76.32351455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9425664TGATTGATGTGGGGTAAATATTTACCCCACATCAATCA0.033000.003500.715500.750001.000001.00000


Target Position: 2625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2625UGAAGAACAAGACGCGGAU72.12942149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9252643TGAAGAACAAGACGCGGATATCCGCGTCTTGTTCTTCA0.108200.002900.543100.750001.000001.00000


Target Position: 5875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5875AUGAAGCUUUCAAAGUAAA82.4792684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9305893ATGAAGCTTTCAAAGTAAATTTACTTTGAAAGCTTCAT0.524900.035000.655200.500001.000001.00000


Target Position: 6351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6351CAGACUUGCUAAGAAUUAC76.981347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9996369CAGACTTGCTAAGAATTACGTAATTCTTAGCAAGTCTG0.644800.231300.603400.500001.000001.00000


Target Position: 1951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1951CCGGUUUCCCCUGAACAUU68.34412845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631969CCGGTTTCCCCTGAACATTAATGTTCAGGGGAAACCGG0.030200.007100.905201.000000.902200.75000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762CCCUGUUCUCGGAAACCAU82.2144711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
911780CCCTGTTCTCGGAAACCATATGGTTTCCGAGAACAGGG0.037100.003200.836201.000000.940200.75000


Target Position: 6508, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6508GCGAACAUUUGCAGUAAAA89.9846192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6506-6528ATGCGAACATTTGCAGTAAAAAAUUUUACUGCAAAUGUUCGCAUGCGAACAUUUGCAGUAAAAAAU11.821.132


Target Position: 6545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6545AUAUUUUAUUUCUUUCUAA91.3433147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9936563ATATTTTATTTCTTTCTAATTAGAAAGAAATAAAATAT0.974200.001900.508600.500001.000001.00000


Target Position: 4053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4053UGGAAUUCCGGAACUACUG59.24454561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8994071TGGAATTCCGGAACTACTGCAGTAGTTCCGGAATTCCA0.100300.009900.560300.500000.962000.75000


Target Position: 3970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3970GGAGUAUUCAGAGACUGAG78.92791105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7573988GGAGTATTCAGAGACTGAGCTCAGTCTCTGAATACTCC0.129800.008900.560300.750000.907600.62500


Target Position: 5944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5944CCUUGAGUCUUUUCCUUGU79.17121080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5085962CCTTGAGTCTTTTCCTTGTACAAGGAAAAGACTCAAGG0.689700.173400.637900.750001.000001.00000


Target Position: 625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625AGCCAUCCUGAGAUCCAAA87.5188315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
616643AGCCATCCTGAGATCCAAATTTGGATCTCAGGATGGCT0.528300.016900.853400.750000.972801.00000


Target Position: 2583, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2583GAAAACACAUCUUUGAAAA93.735474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382601GAAAACACATCTTTGAAAATTTTCAAAGATGTGTTTTC0.239600.006200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2581-2603GGGAAAACACATCTTTGAAAATGUUUUCAAAGAUGUGUUUUCCCGAAAACACAUCUUUGAAAAUGU7.713.322


Target Position: 5826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5826UUUUCUUACCACCUCUUUU68.79052764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9525844TTTTCTTACCACCTCTTTTAAAAGAGGTGGTAAGAAAA0.854800.513200.500000.500001.000001.00000


Target Position: 4968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4968GAGAGACAGAGAUGCGAAC76.58931408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7864986GAGAGACAGAGATGCGAACGTTCGCATCTCTGTCTCTC0.064700.045500.663800.500001.000001.00000


Target Position: 6120, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6120GAGAAAAACAGUCUCAAAA94.963553

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10612019GAGAAAAACAGTCTCAAAA1/1/0/094.96ABCC1NM_019899.2+NM_004996.3+NM_019862.2+NM_019900.2+NM_019898.21+1+1+1+1NANANA16:16236487..16236505(+)00ABCC1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6118-6140GGGAGAAAAACAGTCTCAAAACTUUUUGAGACUGUUUUUCUCCCGAGAAAAACAGUCUCAAAACUU20.45.513


Target Position: 5579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5579GGCUUUCCCUUUUUUCUUU79.46351035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
825597GGCTTTCCCTTTTTTCTTTAAAGAAAAAAGGGAAAGCC0.593000.370701.000001.000001.000001.00000


Target Position: 945, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
945UGGUAAAGAACUGGAAGAA80.4996890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
688963TGGTAAAGAACTGGAAGAATTCTTCCAGTTCTTTACCA0.076900.018900.672400.750001.000001.00000


Target Position: 6228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6228GGUCUCUGUGUUCCUGGAA86.0314416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9156246GGTCTCTGTGTTCCTGGAATTCCAGGAACACAGAGACC0.036900.007900.681001.000001.000001.00000


Target Position: 4967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4967GGAGAGACAGAGAUGCGAA101.4228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7044985GGAGAGACAGAGATGCGAATTCGCATCTCTGTCTCTCC0.074000.053700.698301.000001.000001.00000


Target Position: 5795, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5795GUUGCUUACAGUGUUGAUU75.11991639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8295813GTTGCTTACAGTGTTGATTAATCAACACTGTAAGCAAC0.050700.005000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5793-5815TGGTTGCTTACAGTGTTGATTGAAAUCAACACUGUAAGCAACCAGUUGCUUACAGUGUUGAUUGAU20.519.732


Target Position: 5869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5869AUGGUUAUGAAGCUUUCAA79.52131028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9295887ATGGTTATGAAGCTTTCAATTGAAAGCTTCATAACCAT0.110200.009100.508600.500001.000001.00000


Target Position: 4216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4216CGAAGGAGAGAUCAUCAUC79.19391075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7734234CGAAGGAGAGATCATCATCGATGATGATCTCTCCTTCG0.059000.008500.612100.750000.967400.62500


Target Position: 1481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1481GACUUGGCCACGUACAUUA92.5454103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111499GACTTGGCCACGTACATTATAATGTACGTGGCCAAGTC0.134600.003000.784500.750001.000001.00000


Target Position: 5585, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5585CCCUUUUUUCUUUUGUUCA79.0251090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5165603CCCTTTTTTCTTTTGTTCATGAACAAAAGAAAAAAGGG0.321200.210900.767200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5583-5605TTCCCTTTTTTCTTTTGTTCAACUGAACAAAAGAAAAAAGGGAACCCUUUUUUCUUUUGUUCAACU14.99.521


Target Position: 5870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5870UGGUUAUGAAGCUUUCAAA87.4429324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5025888TGGTTATGAAGCTTTCAAATTTGAAAGCTTCATAACCA0.167700.018700.844800.750001.000001.00000


Target Position: 6433, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6433GUAAGUUAUACCAUUCUUU85.257462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4216451GTAAGTTATACCATTCTTTAAAGAATGGTATAACTTAC0.161100.042900.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
6431-6453TTGTAAGTTATACCATTCTTTCAAAAGAAUGGUAUAACUUACAAGUAAGUUAUACCAUUCUUUCAU12.06.632


Target Position: 4860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4860CCACACUGAAACCAAAACA82.3687693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5014878CCACACTGAAACCAAAACATGTTTTGGTTTCAGTGTGG0.890700.609300.637900.750001.000001.00000


Target Position: 6291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6291UCUCGUUAGAGCCCAAAGU61.55114207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8906309TCTCGTTAGAGCCCAAAGTACTTTGGGCTCTAACGAGA0.049500.003200.517200.500000.913000.62500


Target Position: 6107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6107GUACUGUUCCGGGGAGAAA82.5829673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5806125GTACTGTTCCGGGGAGAAATTTCTCCCCGGAACAGTAC0.242200.011900.681000.750000.994600.62500


Target Position: 4867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4867GAAACCAAAACAUAAAAAC70.96452357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8834885GAAACCAAAACATAAAAACGTTTTTATGTTTTGGTTTC0.988600.883600.525900.500001.000001.00000


Target Position: 6410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6410GAAAACGCAUAUAUUUAUU84.8291504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4736428GAAAACGCATATATTTATTAATAAATATATGCGTTTTC0.180900.116800.663800.750001.000001.00000


Target Position: 1209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209UCUUAAAGUUGCUCAUCAA91.5909138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721227TCTTAAAGTTGCTCATCAATTGATGAGCAACTTTAAGA0.132500.082600.577600.750001.000001.00000


Target Position: 1317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1317UGCACCAGUACUUCCACAU70.23012479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491335TGCACCAGTACTTCCACATATGTGGAAGTACTGGTGCA0.226100.015100.698300.750001.000001.00000


Target Position: 3100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3100CUUCCUCAGCAUCUUCCUU76.35021450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9673118CTTCCTCAGCATCTTCCTTAAGGAAGATGCTGAGGAAG0.782400.302100.500000.750001.000001.00000


Target Position: 4051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4051AGUGGAAUUCCGGAACUAC71.06532333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9014069AGTGGAATTCCGGAACTACGTAGTTCCGGAATTCCACT0.110600.013700.525900.500000.962000.87500


Target Position: 3963, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3963GGCUCAAGGAGUAUUCAGA93.091792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8693981GGCTCAAGGAGTATTCAGATCTGAATACTCCTTGAGCC0.044000.010200.775900.750000.989100.75000


Target Position: 3891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3891AGGUCACCACGUACUUGAA92.25115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7663909AGGTCACCACGTACTTGAATTCAAGTACGTGGTGACCT0.172800.005400.672400.750001.000001.00000


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643AAUUAUGACAGCCUUAAAA86.9737348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
909661AATTATGACAGCCTTAAAATTTTAAGGCTGTCATAATT0.169800.158800.508600.500001.000001.00000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679AUCAAGCUGAUGAACGAAA77.18151316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7721697ATCAAGCTGATGAACGAAATTTCGTTCATCAGCTTGAT0.355200.019400.681000.500000.967400.62500


Target Position: 4730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4730GGUCUUUUCUACAGCAUGG73.72751854

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9284748GGTCTTTTCTACAGCATGGCCATGCTGTAGAAAAGACC0.125900.003900.508600.500001.000001.00000


Target Position: 714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714CCCUCUUACUCAUUCAGCU82.1642717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495732CCCTCTTACTCATTCAGCTAGCTGAATGAGTAAGAGGG0.523700.493000.637900.750000.951100.62500


Target Position: 2526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2526CCAACGCUGACAUUUACCU73.56221884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9982544CCAACGCTGACATTTACCTAGGTAAATGTCAGCGTTGG0.226700.005500.500000.750001.000001.00000


Target Position: 1641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1641CGUAUCAGGUGGCCCACAU80.5518885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9131659CGTATCAGGTGGCCCACATATGTGGGCCACCTGATACG0.039900.003000.620701.000000.923901.00000


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255CCGACUUCACCAAGUGCUU74.7921678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
556273CCGACTTCACCAAGTGCTTAAGCACTTGGTGAAGTCGG0.115100.039900.775901.000000.934800.87500


Target Position: 1938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938UGUUCAACAUCCUCCGGUU78.66731129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7651956TGTTCAACATCCTCCGGTTAACCGGAGGATGTTGAACA0.197900.014800.560300.750001.000001.00000


Target Position: 1959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1959CCCUGAACAUUCUCCCCAU85.1119477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281977CCCTGAACATTCTCCCCATATGGGGAGAATGTTCAGGG0.194800.009700.836201.000001.000001.00000


Target Position: 5952, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5952CUUUUCCUUGUUUUUAGAU73.25141943

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5950-5972GTCTTTTCCTTGTTTTTAGATGTAUCUAAAAACAAGGAAAAGACCUUUUCCUUGUUUUUAGAUGUU7.118.722


Target Position: 5560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5560CCCACCCACCCCGACUCCA64.51763589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4385578CCCACCCACCCCGACTCCATGGAGTCGGGGTGGGTGGG0.161700.085900.646600.750001.000001.00000


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690ACAUCACUUUCUACGUCUA91.804129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822708ACATCACTTTCTACGTCTATAGACGTAGAAAGTGATGT0.221600.079400.534500.750001.000001.00000


Target Position: 4872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4872CAAAACAUAAAAACCAAAC65.57113403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9494890CAAAACATAAAAACCAAACGTTTGGTTTTTATGTTTTG0.983800.972800.500000.500001.000001.00000


Target Position: 5961, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5961GUUUUUAGAUGUUAAUUCU86.2812393

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5959-5981TTGTTTTTAGATGTTAATTCTCTAGAAUUAACAUCUAAAAACAAGUUUUUAGAUGUUAAUUCUCUU2.1-3.822


Target Position: 2531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2531GCUGACAUUUACCUCUUCG70.29582472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482549GCTGACATTTACCTCTTCGCGAAGAGGTAAATGTCAGC0.192200.085300.560300.500001.000001.00000


Target Position: 1654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654CCACAUGAAGAGCAAAGAC74.25511773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8581672CCACATGAAGAGCAAAGACGTCTTTGCTCTTCATGTGG0.418500.058600.525900.750001.000001.00000


Target Position: 6083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6083AUAUCAAUGAUUUUUUUUU75.28351618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7996101ATATCAATGATTTTTTTTTAAAAAAAAATCATTGATAT0.242000.082500.543100.500001.000001.00000