siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 185   188   252   311   312   314   432   438   440   462   473   557   603   604   675   698   699   701   719   771  
837   843   844   876   877   878   889   931   970   982   1027   1028   1030   1031   1034   1035   1037   1192   1193   1196  
1329   1334   1335   1336   1337   1368   1390   1392   1393   1413   1420   1428   1520   1521   1561   1618   1619   1620   1624   1628  
1632   1684   1687   1688   1690   1959   2026   2027   2030   2032   2058   2102   2106   2134   2137   2138   2139   2140   2144   2158  
2179   2183   2321   2361   2363   2367   2369   2394   2437   2438   2439   2440   2441   2442   2445   2463   2464   2528   2548   2549  
2578   2579   2605   2626   2632   2633   2634   2635   2704   2705   2762   2829   2830   2831   2877   2878   2880   2881   2884   3015  
3016   3018   3182   3185   3267   3268   3301   3467   3468   3536   3540   3541   3550   3551   3558   3559   3594   3614   3723   3743  
3837   3861   4087   4088   4099   4112   4113   4114   4123   4124   4176   4216   4217   4279   4280   4281   4282   4283   4345   4407  
4420   4461   4465   4524   4558   4662   4717   4747   4803   4804   4806   4847   4848   4849   4946   4965   4980   4992   5172   5173  
5175   5227   5229   5258   5260   5262   5336   5386   5390   5447   5620   5622   5623   5624   5628   5715   5716   5717   5718   5723  
5737  
Biltr, Sidirect 251   258   282   431   441   452   463   475   482   484   560   585   588   596   599   619   657   682   683   712  
713   723   729   734   740   744   746   748   756   763   790   799   802   811   819   821   883   884   922   942  
952   954   981   983   995   997   1041   1049   1058   1070   1078   1112   1113   1122   1132   1136   1143   1170   1173   1180  
1241   1289   1340   1341   1422   1427   1429   1485   1511   1512   1534   1535   1538   1557   1570   1587   1625   1639   1652   1655  
1661   1663   1665   1715   1723   1771   1781   1837   1936   1940   1941   1950   1964   1981   2052   2056   2095   2097   2107   2146  
2184   2185   2204   2208   2274   2322   2325   2327   2331   2335   2354   2359   2362   2374   2388   2391   2414   2465   2514   2516  
2519   2612   2613   2660   2662   2697   2735   2756   2757   2758   2909   2913   2919   2956   2962   2992   2995   2996   3000   3023  
3183   3278   3287   3289   3300   3310   3421   3448   3473   3474   3516   3517   3533   3555   3563   3580   3583   3587   3595   3596  
3603   3606   3629   3638   3642   3649   3651   3670   3671   3673   3687   3696   3713   3715   3725   3804   3807   3808   3812   3819  
3840   3911   3956   3978   3980   3991   4021   4029   4030   4036   4041   4045   4049   4050   4056   4066   4092   4127   4128   4134  
4136   4143   4144   4147   4153   4195   4208   4220   4228   4257   4258   4295   4302   4305   4310   4346   4353   4383   4405   4411  
4426   4427   4443   4446   4451   4459   4476   4505   4511   4517   4520   4525   4533   4539   4544   4549   4552   4561   4591   4592  
4598   4599   4601   4640   4661   4673   4681   4685   4689   4710   4715   4724   4729   4731   4739   4750   4776   4783   4784   4785  
4791   4892   4901   4924   4927   4937   4940   4960   4961   4970   4971   4977   4984   4987   5006   5019   5028   5050   5066   5080  
5107   5141   5142   5149   5150   5152   5178   5187   5195   5225   5233   5269   5271   5272   5281   5304   5306   5308   5316   5318  
5327   5348   5349   5356   5357   5377   5416   5419   5423   5426   5468   5469   5477   5483   5499   5514   5531   5541   5542   5547  
5575   5629   5630   5633   5643   5658   5710   5724  
Biltr, Rnaxs, Sidirect 187   189   256   433   439   472   474   528   532   673   674   704   709   838   875   879   890   891   971   1036  
1038   1134   1369   1414   1415   1421   1562   1622   1623   1633   1691   1955   1960   1966   2028   2031   2033   2121   2145   2159  
2160   2180   2364   2368   2395   2443   2444   2450   2529   2604   2627   2663   2885   3019   3181   3302   3572   3722   3724   3730  
3744   4089   4090   4100   4168   4218   4343   4344   4355   4416   4421   4431   4462   4466   4669   4795   4807   5014   5015   5174  
5176   5228   5230   5261   5391   5476   5521   5522   5719  
Biltr, Ernai, Rnaxs, Sidirect 186  
Biltr, Ernai, Sidirect 2298   3628   3758  
Biltr, Ernai, Rnaxs 245   4086  
Biltr, Ernai 2879   3552   3693   3943  


Target Position: 1058, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1058CUUACCAAUUGUGAAUGUU75.51512606

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1056-1078TTCTTACCAATTGTGAATGTTGGAACAUUCACAAUUGGUAAGAACUUACCAAUUGUGAAUGUUGGU20.520.033


Target Position: 5015, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5015GAAUGUAUUUUAACUAUUU94.8214178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7505033GAATGTATTTTAACTATTTAAATAGTTAAAATACATTC0.254600.047600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5013-5035TGGAATGTATTTTAACTATTTTTAAAUAGUUAAAAUACAUUCCAGAAUGUAUUUUAACUAUUUUUU4.66.722


Target Position: 4459, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4459CUUCAAACAGUAUAUAACU83.57371274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4457-4479TTCTTCAAACAGTATATAACTTTAGUUAUAUACUGUUUGAAGAACUUCAAACAGUAUAUAACUUUU1.114.923


Target Position: 1557, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557GAAAAGAUUUUAACAAGUA97.664387

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1555-1577TTGAAAAGATTTTAACAAGTATAUACUUGUUAAAAUCUUUUCAAGAAAAGAUUUUAACAAGUAUAU17.85.321


Target Position: 2450, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2450CUGUAAAUUUUUAACCUAU88.457650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7832468CTGTAAATTTTTAACCTATATAGGTTAAAAATTTACAG0.351200.138800.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2448-2470ATCTGTAAATTTTTAACCTATGTAUAGGUUAAAAAUUUACAGAUCUGUAAAUUUUUAACCUAUGUU19.86.923


Target Position: 2878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2878AGUGGAAGGAGAAUUUAAU84.54161144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8132896AGTGGAAGGAGAATTTAATATTAAATTCTCCTTCCACT0.503900.041600.698300.750001.000001.00000


Target Position: 1143, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1143GGAUUAAUUACUAAUUUCA97.2885103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1141-1163ATGGATTAATTACTAATTTCAGTUGAAAUUAGUAAUUAAUCCAUGGAUUAAUUACUAAUUUCAGUU2.11.823


Target Position: 5306, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5306GACUAUGAGUGUGUAUUUA97.843984

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5304-5326GTGACTATGAGTGTGTATTTATTUAAAUACACACUCAUAGUCACGACUAUGAGUGUGUAUUUAUUU6.920.3


Target Position: 1335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335CUCUCCCCAAAAUAUUAUA83.24671327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891353CTCTCCCCAAAATATTATATATAATATTTTGGGGAGAG0.659300.475700.767200.750001.000001.00000


Target Position: 4127, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4127CCUUAAAGACAAAAAUCCU83.52661280

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4125-4147AGCCTTAAAGACAAAAATCCTTGAGGAUUUUUGUCUUUAAGGCUCCUUAAAGACAAAAAUCCUUGU14.21.322


Target Position: 5349, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5349CCGAAAUGGAUAUGGAAUA85.37391017

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5347-5369CCCCGAAATGGATATGGAATACTUAUUCCAUAUCCAUUUCGGGGCCGAAAUGGAUAUGGAAUACUU20.114.1


Target Position: 3517, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3517CUCUAUAAUUGUUUUGCUA92.6783287

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3515-3537AGCTCTATAATTGTTTTGCTACGUAGCAAAACAAUUAUAGAGCUCUCUAUAAUUGUUUUGCUACGU18.68.422


Target Position: 2913, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2913GAAUUCCUUAGGUAAUCUA94.7912180

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2911-2933AAGAATTCCTTAGGTAATCTATAUAGAUUACCUAAGGAAUUCUUGAAUUCCUUAGGUAAUCUAUAU14.518.722


Target Position: 5499, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5499GAAGUAGAUGCAAAACAAA98.99758

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5497-5519TAGAAGTAGATGCAAAACAAATCUUUGUUUUGCAUCUACUUCUAGAAGUAGAUGCAAAACAAAUCU5.618.9


Target Position: 3804, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3804CAAGGAAACUUCUAUGUAA105.2957

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3802-3824GACAAGGAAACTTCTATGTAAAAUUACAUAGAAGUUUCCUUGUCCAAGGAAACUUCUAUGUAAAAU13.118.732


Target Position: 1027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1027UGGUGCAUGCAGUUGAUUA86.4997871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241045TGGTGCATGCAGTTGATTATAATCAACTGCATGCACCA0.184700.044800.810300.750001.000001.00000


Target Position: 4451, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4451CAUUUUUUCUUCAAACAGU81.8941535

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4449-4471AACATTTTTTCTTCAAACAGTATACUGUUUGAAGAAAAAAUGUUCAUUUUUUCUUCAAACAGUAUU16.7-12.022


Target Position: 2992, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2992CAUGCAAUGAAAAAUACUU85.8569957

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2990-3012TTCATGCAATGAAAAATACTTTAAAGUAUUUUUCAUUGCAUGAACAUGCAAUGAAAAAUACUUUAU4.619.921


Target Position: 2327, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2327CUUACUAUCCAUUUCUUCA89.7746515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2325-2347CACTTACTATCCATTTCTTCATGUGAAGAAAUGGAUAGUAAGUGCUUACUAUCCAUUUCUUCAUGU14.86.321


Target Position: 2884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2884AGGAGAAUUUAAUAAAGAU92.5417297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7002902AGGAGAATTTAATAAAGATATCTTTATTAAATTCTCCT0.213700.144000.663800.750001.000001.00000


Target Position: 1655, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655CAACUUGAGUCUUUGAAGA89.4948538

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1653-1675TTCAACTTGAGTCTTTGAAGATAUCUUCAAAGACUCAAGUUGAACAACUUGAGUCUUUGAAGAUAU12.219.232


Target Position: 5628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5628AGCAACAUUAAUAAUGGAA81.72391565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7475646AGCAACATTAATAATGGAATTCCATTATTAATGTTGCT0.227400.108600.681000.750001.000001.00000


Target Position: 2632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2632UCCCCUAACCAUAAGAUUU70.90083389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4922650TCCCCTAACCATAAGATTTAAATCTTATGGTTAGGGGA0.309200.257200.870700.750000.934800.62500


Target Position: 2704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2704GCCCUACAUCUUAUUUCCU78.25382129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962722GCCCTACATCTTATTTCCTAGGAAATAAGATGTAGGGC0.781300.034700.655200.750001.000001.00000


Target Position: 1049, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CUUAUUUUUCUUACCAAUU74.87622732

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1047-1069TTCTTATTTTTCTTACCAATTGTAAUUGGUAAGAAAAAUAAGAACUUAUUUUUCUUACCAAUUGUU20.0-9.722


Target Position: 2322, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2322CAUCACUUACUAUCCAUUU83.4341294

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2320-2342GACATCACTTACTATCCATTTCTAAAUGGAUAGUAAGUGAUGUCCAUCACUUACUAUCCAUUUCUU20.119.233


Target Position: 2359, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2359CAUCUCAAACUCUUAGUUU85.47621004

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2357-2379GTCATCTCAAACTCTTAGTTTTTAAACUAAGAGUUUGAGAUGACCAUCUCAAACUCUUAGUUUUUU9.820.432


Target Position: 3267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3267CCCACCUUGGCCUCAUAAA78.85692025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6973285CCCACCTTGGCCTCATAAATTTATGAGGCCAAGGTGGG0.611200.052200.991401.000000.951100.62500


Target Position: 983, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
983GUGAAAAAGAAACUGAAUA87.7442727

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
981-1003CTGTGAAAAAGAAACTGAATACCUAUUCAGUUUCUUUUUCACAGGUGAAAAAGAAACUGAAUACCU19.27.722


Target Position: 1241, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241GCAUCAUGUCCUAUAGUUU93.1589252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1239-1261AGGCATCATGTCCTATAGTTTGTAAACUAUAGGACAUGAUGCCUGCAUCAUGUCCUAUAGUUUGUU6.319.432


Target Position: 1485, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485GUAUGAAAUGGGGAUUAUU85.7735966

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1483-1505CAGTATGAAATGGGGATTATTATAAUAAUCCCCAUUUCAUACUGGUAUGAAAUGGGGAUUAUUAUU15.48.932


Target Position: 1940, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1940GCUUUUGUUUCUUAAGAAA92.9676267

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1938-1960TTGCTTTTGTTTCTTAAGAAAACUUUCUUAAGAAACAAAAGCAAGCUUUUGUUUCUUAAGAAAACU7.110.322


Target Position: 2995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2995GCAAUGAAAAAUACUUUAA90.2806471

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2993-3015ATGCAATGAAAAATACTTTAATTUUAAAGUAUUUUUCAUUGCAUGCAAUGAAAAAUACUUUAAUUU6.613.822


Target Position: 4539, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4539GUAAUGAUUUCUUGAUAAU88.5204642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4537-4559AAGTAATGATTTCTTGATAATTGAUUAUCAAGAAAUCAUUACUUGUAAUGAUUUCUUGAUAAUUGU8.98.722


Target Position: 5447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5447UGCUGUGGAUAUUAUGUAA93.0459262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8955465TGCTGTGGATATTATGTAATTACATAATATCCACAGCA0.169100.094800.819000.750001.000001.00000


Target Position: 1665, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665CUUUGAAGAUAGUUUUAAU95.1533164

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1663-1685GTCTTTGAAGATAGTTTTAATTCAUUAAAACUAUCUUCAAAGACCUUUGAAGAUAGUUUUAAUUCU0.012.212


Target Position: 3019, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3019GAAGCUUACUUUUUUUUUU85.31361028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5823037GAAGCTTACTTTTTTTTTTAAAAAAAAAAGTAAGCTTC0.566800.130900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3017-3039ATGAAGCTTACTTTTTTTTTTTGAAAAAAAAAAGUAAGCUUCAUGAAGCUUACUUUUUUUUUUUGU-11.318.311


Target Position: 4355, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4355CCUAAUAUAUACAUAGAAA104.1329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3824373CCTAATATATACATAGAAATTTCTATGTATATATTAGG0.319000.142300.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4353-4375GTCCTAATATATACATAGAAACTUUUCUAUGUAUAUAUUAGGACCCUAAUAUAUACAUAGAAACUU13.4-2.722


Target Position: 5152, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5152CAUAUCAAACAUUAAAAAU86.0763920

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5150-5172GTCATATCAAACATTAAAAATGAAUUUUUAAUGUUUGAUAUGACCAUAUCAAACAUUAAAAAUGAU-9.18.721


Target Position: 3743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3743ACUUAAAAAUUAAUAGUUU83.27631320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9833761ACTTAAAAATTAATAGTTTAAACTATTAATTTTTAAGT0.196500.029700.706900.750001.000001.00000


Target Position: 5377, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5377CCAUAGACACUAUAGUAUA101.89624

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5375-5397AGCCATAGACACTATAGTATACCUAUACUAUAGUGUCUAUGGCUCCAUAGACACUAUAGUAUACCU6.120.3


Target Position: 2183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2183UCCUUUUGAUAAAUUUAAA82.13411499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632201TCCTTTTGATAAATTTAAATTTAAATTTATCAAAAGGA0.324000.131900.870700.750001.000001.00000


Target Position: 5174, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5174CACUCUUUUAAUUGAAAUU81.79661550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9535192CACTCTTTTAATTGAAATTAATTTCAATTAAAAGAGTG0.256100.100400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5172-5194ACCACTCTTTTAATTGAAATTAAAAUUUCAAUUAAAAGAGUGGUCACUCUUUUAAUUGAAAUUAAU7.417.722


Target Position: 890, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890CCUUAAAUGCUUAUUUUAA93.6658228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
557908CCTTAAATGCTTATTTTAATTAAAATAAGCATTTAAGG0.508700.072400.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
888-910TACCTTAAATGCTTATTTTAAAAUUAAAAUAAGCAUUUAAGGUACCUUAAAUGCUUAUUUUAAAAU-7.5-4.312


Target Position: 2180, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180CAAUCCUUUUGAUAAAUUU86.7378840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112198CAATCCTTTTGATAAATTTAAATTTATCAAAAGGATTG0.276800.135900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2178-2200AACAATCCTTTTGATAAATTTAAAAAUUUAUCAAAAGGAUUGUUCAAUCCUUUUGAUAAAUUUAAU-10.318.731


Target Position: 484, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
484GAACAAAUUAAAAGAGUUA95.9746136

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
482-504GAGAACAAATTAAAAGAGTTAAGUAACUCUUUUAAUUUGUUCUCGAACAAAUUAAAAGAGUUAAGU17.75.321


Target Position: 4465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4465ACAGUAUAUAACUUUUUUU81.14321664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9724483ACAGTATATAACTTTTTTTAAAAAAAGTTATATACTGT0.155500.100500.706900.750000.994600.75000


Target Position: 4029, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4029CCUUUAUGUGAACUUUGAA92.3419304

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4027-4049TACCTTTATGTGAACTTTGAATGUUCAAAGUUCACAUAAAGGUACCUUUAUGUGAACUUUGAAUGU19.23.523


Target Position: 3468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3468ACGAUGCGUAUUUUAGUUU70.09343515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9913486ACGATGCGTATTTTAGTTTAAACTAAAATACGCATCGT0.451400.028800.775900.750001.000001.00000


Target Position: 2391, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2391CUAUGUAAUUUAUAUUCCA93.8092224

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2389-2411AACTATGTAATTTATATTCCATTUGGAAUAUAAAUUACAUAGUUCUAUGUAAUUUAUAUUCCAUUU15.48.522


Target Position: 5225, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5225GAAGUGAUCUAAAAUUUGU87.117798

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5223-5245GTGAAGTGATCTAAAATTTGTAAACAAAUUUUAGAUCACUUCACGAAGUGAUCUAAAAUUUGUAAU-3.319.222


Target Position: 2660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2660GUGGAUAUCUCCAUGAAGU83.02961362

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2658-2680CTGTGGATATCTCCATGAAGTTTACUUCAUGGAGAUAUCCACAGGUGGAUAUCUCCAUGAAGUUUU18.121.222


Target Position: 4045, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4045GAAUGGUUUAACAAAAGAU91.5424367

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4043-4065TTGAATGGTTTAACAAAAGATTTAUCUUUUGUUAAACCAUUCAAGAAUGGUUUAACAAAAGAUUUU12.218.822


Target Position: 5269, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5269CUCCUAAUUAUUGUAAUGU71.45133293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5267-5289TACTCCTAATTATTGTAATGTAAACAUUACAAUAAUUAGGAGUACUCCUAAUUAUUGUAAUGUAAU13.519.923


Target Position: 5260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5260ACUGUACUACUCCUAAUUA91.5181370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8275278ACTGTACTACTCCTAATTATAATTAGGAGTAGTACAGT0.238000.146100.672400.750001.000001.00000


Target Position: 1289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1289GUUCACAAAGGUUUUGUCU73.35442961

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1287-1309CTGTTCACAAAGGTTTTGTCTCCAGACAAAACCUUUGUGAACAGGUUCACAAAGGUUUUGUCUCCU14.920.523


Target Position: 5228, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5228GUGAUCUAAAAUUUGUAAU76.88742373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7585246GTGATCTAAAATTTGTAATATTACAAATTTTAGATCAC0.201800.087700.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5226-5248AAGTGATCTAAAATTTGTAATATAUUACAAAUUUUAGAUCACUUGUGAUCUAAAAUUUGUAAUAUU7.221.422


Target Position: 3725, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3725CAUAAGUAAUUAAAAUAUA100.22141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3723-3745TGCATAAGTAATTAAAATATACTUAUAUUUUAAUUACUUAUGCACAUAAGUAAUUAAAAUAUACUU-10.36.322


Target Position: 4505, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4505CAAAAACUAUCUGAAGAUU84.96191078

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4503-4525AGCAAAAACTATCTGAAGATTTCAAUCUUCAGAUAGUUUUUGCUCAAAAACUAUCUGAAGAUUUCU20.43.222


Target Position: 4228, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4228GUAUCAUUUGAGUGAAUGU85.9745934

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4226-4248TTGTATCATTTGAGTGAATGTTCACAUUCACUCAAAUGAUACAAGUAUCAUUUGAGUGAAUGUUCU20.58.722


Target Position: 5336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5336UGAACUGUUUGCCCCGAAA79.20541974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8165354TGAACTGTTTGCCCCGAAATTTCGGGGCAAACAGTTCA0.215500.130800.724100.750000.907600.62500


Target Position: 5737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5737UCUAUAACUACAUUUAAAU77.84722198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3555755TCTATAACTACATTTAAATATTTAAATGTAGTTATAGA0.922000.793700.715500.750001.000001.00000


Target Position: 5230, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5230GAUCUAAAAUUUGUAAUAU92.7041285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9755248GATCTAAAATTTGTAATATATATTACAAATTTTAGATC0.154300.081800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5228-5250GTGATCTAAAATTTGTAATATTTAUAUUACAAAUUUUAGAUCACGAUCUAAAAUUUGUAAUAUUUU8.56.922


Target Position: 4036, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4036GUGAACUUUGAAUGGUUUA81.50741604

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4034-4056ATGTGAACTTTGAATGGTTTAACUAAACCAUUCAAAGUUCACAUGUGAACUUUGAAUGGUUUAACU18.819.222


Target Position: 474, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474CCAUUAUAGAGAACAAAUU85.13091051

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
272492CCATTATAGAGAACAAATTAATTTGTTCTCTATAATGG0.419600.302500.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
472-494CACCATTATAGAGAACAAATTAAAAUUUGUUCUCUAUAAUGGUGCCAUUAUAGAGAACAAAUUAAU5.30.022


Target Position: 879, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879GUUAGCUUUUACCUUAAAU81.6391582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
996897GTTAGCTTTTACCTTAAATATTTAAGGTAAAAGCTAAC0.162000.028300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
877-899CTGTTAGCTTTTACCTTAAATGCAUUUAAGGUAAAAGCUAACAGGUUAGCUUUUACCUUAAAUGCU11.018.322


Target Position: 4785, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4785GAUAAUGAUAGGUAAUUUA100.44338

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4783-4805GGGATAATGATAGGTAATTTAGAUAAAUUACCUAUCAUUAUCCCGAUAAUGAUAGGUAAUUUAGAU-0.38.722


Target Position: 2443, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2443GCACAAUCUGUAAAUUUUU84.58221137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4142461GCACAATCTGTAAATTTTTAAAAATTTACAGATTGTGC0.297200.100000.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2441-2463CAGCACAATCTGTAAATTTTTAAAAAAAUUUACAGAUUGUGCUGGCACAAUCUGUAAAUUUUUAAU-12.020.522


Target Position: 2298, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2298CUUUUAGGACUCUGAUUUU83.54771276

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4229819CTTTTAGGACTCTGATTTT1/1/0/097.75KRASNM_033360.2+NM_004985.31+1NANANA11:72320329..72320347(-)00KRAS(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2296-2318GTCTTTTAGGACTCTGATTTTGAAAAAUCAGAGUCCUAAAAGACCUUUUAGGACUCUGAUUUUGAU12.011.022


Target Position: 4977, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4977CUUACUAGUACUAUUUCUU83.54151277

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4975-4997TTCTTACTAGTACTATTTCTTAAAAGAAAUAGUACUAGUAAGAACUUACUAGUACUAUUUCUUAAU6.911.322


Target Position: 3722, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3722CUGCAUAAGUAAUUAAAAU88.6217628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9263740CTGCATAAGTAATTAAAATATTTTAATTACTTATGCAG0.641200.067800.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3720-3742CTCTGCATAAGTAATTAAAATATAUUUUAAUUACUUAUGCAGAGCUGCAUAAGUAAUUAAAAUAUU-9.721.121


Target Position: 5356, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5356GGAUAUGGAAUACUUUAUA98.703265

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5354-5376ATGGATATGGAATACTTTATAAGUAUAAAGUAUUCCAUAUCCAUGGAUAUGGAAUACUUUAUAAGU4.621.2


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578GCCUCCCUACCUUCCACAU75.11862685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1722596GCCTCCCTACCTTCCACATATGTGGAAGGTAGGGAGGC0.530100.542700.844801.000001.000001.00000


Target Position: 4136, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4136CAAAAAUCCUUGUUGAAGU81.81381546

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4134-4156GACAAAAATCCTTGTTGAAGTTTACUUCAACAAGGAUUUUUGUCCAAAAAUCCUUGUUGAAGUUUU19.20.422


Target Position: 2579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2579CCUCCCUACCUUCCACAUG62.68984570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452597CCTCCCTACCTTCCACATGCATGTGGAAGGTAGGGAGG0.158800.143200.689700.750001.000001.00000


Target Position: 1512, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512CAUUUUGGGGCUAUAUUUA90.3183466

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1510-1532ACCATTTTGGGGCTATATTTACAUAAAUAUAGCCCCAAAAUGGUCAUUUUGGGGCUAUAUUUACAU-8.011.322


Target Position: 3580, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3580CUUCAUUGUUUUAAAGGAA88.8223612

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3578-3600CACTTCATTGTTTTAAAGGAATAUUCCUUUAAAACAAUGAAGUGCUUCAUUGUUUUAAAGGAAUAU19.913.821


Target Position: 3807, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3807GGAAACUUCUAUGUAAAAA92.3047309

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3805-3827AAGGAAACTTCTATGTAAAAATCUUUUUACAUAGAAGUUUCCUUGGAAACUUCUAUGUAAAAAUCU7.213.322


Target Position: 4849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4849CCCAUCUCUCCCCCCACAC53.63125351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7274867CCCATCTCTCCCCCCACACGTGTGGGGGGAGAGATGGG0.328100.098900.698300.750001.000001.00000


Target Position: 2121, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2121GCAUAAACACUUUUCAAGU83.52981279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8282139GCATAAACACTTTTCAAGTACTTGAAAAGTGTTTATGC0.247000.177400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2119-2141TTGCATAAACACTTTTCAAGTCTACUUGAAAAGUGUUUAUGCAAGCAUAAACACUUUUCAAGUCUU12.26.922


Target Position: 5172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5172ACCACUCUUUUAAUUGAAA83.47781289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9375190ACCACTCTTTTAATTGAAATTTCAATTAAAAGAGTGGT0.209500.034200.853400.750001.000001.00000


Target Position: 3715, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3715GUUUUCUCUGCAUAAGUAA87.8913715

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3713-3735CAGTTTTCTCTGCATAAGTAATTUUACUUAUGCAGAGAAAACUGGUUUUCUCUGCAUAAGUAAUUU6.314.832


Target Position: 5173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5173CCACUCUUUUAAUUGAAAU82.0171515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6885191CCACTCTTTTAATTGAAATATTTCAATTAAAAGAGTGG0.217900.087200.836201.000001.000001.00000


Target Position: 5717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5717CUCCAUACAUAUUAUUUAU90.5875447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4985735CTCCATACATATTATTTATATAAATAATATGTATGGAG0.306900.279400.767200.750001.000001.00000


Target Position: 3724, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3724GCAUAAGUAAUUAAAAUAU90.793427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8193742GCATAAGTAATTAAAATATATATTTTAATTACTTATGC0.186000.047000.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3722-3744CTGCATAAGTAATTAAAATATACAUAUUUUAAUUACUUAUGCAGGCAUAAGUAAUUAAAAUAUACU-7.511.622


Target Position: 4218, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4218GACGUAUAUUGUAUCAUUU93.5082235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8424236GACGTATATTGTATCATTTAAATGATACAATATACGTC0.328600.066500.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4216-4238CAGACGTATATTGTATCATTTGAAAAUGAUACAAUAUACGUCUGGACGUAUAUUGUAUCAUUUGAU8.716.233


Target Position: 4305, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4305CCUAACUUUUAUAGGUUAU80.76471725

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4303-4325AACCTAACTTTTATAGGTTATCAAUAACCUAUAAAAGUUAGGUUCCUAACUUUUAUAGGUUAUCAU19.89.833


Target Position: 441, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441CAUAAAUAAUACUAAAUCA102.91915

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
439-461GCCATAAATAATACTAAATCATTUGAUUUAGUAUUAUUUAUGGCCAUAAAUAAUACUAAAUCAUUU6.9-8.022


Target Position: 954, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954GAGUUUUGGUUUUUGAACU81.56871593

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
952-974CAGAGTTTTGGTTTTTGAACTAGAGUUCAAAAACCAAAACUCUGGAGUUUUGGUUUUUGAACUAGU14.910.323


Target Position: 2439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439CUCAGCACAAUCUGUAAAU76.99892356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892457CTCAGCACAATCTGTAAATATTTACAGATTGTGCTGAG0.194500.082200.801700.750000.934800.75000


Target Position: 4520, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4520GAUUUCCAUUUGUCAAAAA93.3519243

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4518-4540AAGATTTCCATTTGTCAAAAAGTUUUUUGACAAAUGGAAAUCUUGAUUUCCAUUUGUCAAAAAGUU14.920.112


Target Position: 4021, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4021GUUAAUUACCUUUAUGUGA84.25041179

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4019-4041TGGTTAATTACCTTTATGTGAACUCACAUAAAGGUAAUUAACCAGUUAAUUACCUUUAUGUGAACU13.5-7.522


Target Position: 2056, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2056GAAGUGAAAAAGUUUUACA92.7239284

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2054-2076ATGAAGTGAAAAAGTTTTACAATUGUAAAACUUUUUCACUUCAUGAAGUGAAAAAGUUUUACAAUU8.219.222


Target Position: 3696, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3696CCAAAUGUGUAAUAUUCCA90.0512496

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3694-3716ACCCAAATGTGTAATATTCCAGTUGGAAUAUUACACAUUUGGGUCCAAAUGUGUAAUAUUCCAGUU15.412.121


Target Position: 1959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1959ACAAACUCUUUUUUAAAAA80.61051748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7481977ACAAACTCTTTTTTAAAAATTTTTAAAAAAGAGTTTGT0.321300.120000.706900.750001.000001.00000


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392AGGCAAUGGAAACUAUUAU81.17031656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881410AGGCAATGGAAACTATTATATAATAGTTTCCATTGCCT0.280800.028900.801700.750001.000001.00000


Target Position: 3956, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3956GCUUAUGAGGGGAUAUUUA94.9976170

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3954-3976GTGCTTATGAGGGGATATTTAGGUAAAUAUCCCCUCAUAAGCACGCUUAUGAGGGGAUAUUUAGGU1.813.432


Target Position: 1415, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415CCAUUUCCUUUUCACAUUA89.0416584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111433CCATTTCCTTTTCACATTATAATGTGAAAAGGAAATGG0.508800.041700.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1413-1435GGCCATTTCCTTTTCACATTAGAUAAUGUGAAAAGGAAAUGGCCCCAUUUCCUUUUCACAUUAGAU20.520.122


Target Position: 2354, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2354GAAGUCAUCUCAAACUCUU88.1133681

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2352-2374AAGAAGTCATCTCAAACTCTTAGAAGAGUUUGAGAUGACUUCUUGAAGUCAUCUCAAACUCUUAGU17.719.222


Target Position: 746, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746GUGUAAUUAUGUAAAUACA97.889682

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
744-766GTGTGTAATTATGTAAATACAATUGUAUUUACAUAAUUACACACGUGUAAUUAUGUAAAUACAAUU1.46.922


Target Position: 2758, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2758GAUUUGACCUAAUCACUAA103.97610

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2756-2778GGGATTTGACCTAATCACTAATTUUAGUGAUUAGGUCAAAUCCCGAUUUGACCUAAUCACUAAUUU20.314.833


Target Position: 5416, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5416CUUGUUAGAAGUAUCCUUU80.56811755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5414-5436AGCTTGTTAGAAGTATCCTTTATAAAGGAUACUUCUAACAAGCUCUUGUUAGAAGUAUCCUUUAUU19.911.8


Target Position: 3819, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3819GUAAAAAUCACUAUGAUUU83.9611212

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3817-3839ATGTAAAAATCACTATGATTTCTAAAUCAUAGUGAUUUUUACAUGUAAAAAUCACUAUGAUUUCUU8.7-9.732


Target Position: 4525, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4525CCAUUUGUCAAAAAGUAAU81.09661674

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4523-4545TTCCATTTGTCAAAAAGTAATGAAUUACUUUUUGACAAAUGGAACCAUUUGUCAAAAAGUAAUGAU4.912.122


Target Position: 1520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520GGCUAUAUUUACAUGCUAC86.4851878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021538GGCTATATTTACATGCTACGTAGCATGTAAATATAGCC0.571900.034700.819000.750001.000001.00000


Target Position: 2831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2831GACAGUAGGAUUUUUCAAA94.2135203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8842849GACAGTAGGATTTTTCAAATTTGAAAAATCCTACTGTC0.327500.035900.819000.750001.000001.00000


Target Position: 2613, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2613CAGUUUUAAUACUUGUAAU93.4776239

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2611-2633TGCAGTTTTAATACTTGTAATTCAUUACAAGUAUUAAAACUGCACAGUUUUAAUACUUGUAAUUCU11.84.922


Target Position: 3015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3015UCAUGAAGCUUACUUUUUU78.66652059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5843033TCATGAAGCTTACTTTTTTAAAAAAGTAAGCTTCATGA0.716900.088000.724100.750001.000001.00000


Target Position: 4795, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4795GGUAAUUUAGAUGAAUUUA92.643289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8934813GGTAATTTAGATGAATTTATAAATTCATCTAAATTACC0.273000.035400.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4793-4815TAGGTAATTTAGATGAATTTAGGUAAAUUCAUCUAAAUUACCUAGGUAAUUUAGAUGAAUUUAGGU7.4-0.312


Target Position: 3595, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3595GGAAUAAACUUGAUUAUAU100.19543

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3593-3615AAGGAATAAACTTGATTATATTGAUAUAAUCAAGUUUAUUCCUUGGAAUAAACUUGAUUAUAUUGU3.52.122


Target Position: 4807, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4807GAAUUUAGGGGAAAAAAAA93.5482234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9854825GAATTTAGGGGAAAAAAAATTTTTTTTCCCCTAAATTC0.281500.180400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4805-4827ATGAATTTAGGGGAAAAAAAAGTUUUUUUUUCCCCUAAAUUCAUGAAUUUAGGGGAAAAAAAAGUU-11.3-4.321


Target Position: 2031, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2031GACAUUAAUUUUUUUUUUA92.1626323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6922049GACATTAATTTTTTTTTTATAAAAAAAAAATTAATGTC0.342500.053000.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2029-2051AAGACATTAATTTTTTTTTTAAAUAAAAAAAAAAUUAAUGUCUUGACAUUAAUUUUUUUUUUAAAU-11.36.921


Target Position: 1122, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1122GUUUUAUCUAGUCACAUAA93.8539220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1120-1142GTGTTTTATCTAGTCACATAAATUUAUGUGACUAGAUAAAACACGUUUUAUCUAGUCACAUAAAUU21.52.122


Target Position: 1570, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1570CAAGUAUAAAAAAUUCUCA92.1378326

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1568-1590AACAAGTATAAAAAATTCTCATAUGAGAAUUUUUUAUACUUGUUCAAGUAUAAAAAAUUCUCAUAU14.86.322


Target Position: 4517, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4517GAAGAUUUCCAUUUGUCAA96.1365129

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4515-4537CTGAAGATTTCCATTTGTCAAAAUUGACAAAUGGAAAUCUUCAGGAAGAUUUCCAUUUGUCAAAAU20.55.312


Target Position: 4114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4114CUAAUUAUUACAGCCUUAA83.43261295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8844132CTAATTATTACAGCCTTAATTAAGGCTGTAATAATTAG0.631300.471600.637900.750001.000001.00000


Target Position: 709, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
709GAUGGUAAAAAGAAGAAAA97.0153114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684727GATGGTAAAAAGAAGAAAATTTTCTTCTTTTTACCATC0.905300.689000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
707-729AAGATGGTAAAAAGAAGAAAAAGUUUUCUUCUUUUUACCAUCUUGAUGGUAAAAAGAAGAAAAAGU14.820.011


Target Position: 431, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431GUGUAUUUGCCAUAAAUAA94.5718192

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
429-451TTGTGTATTTGCCATAAATAATAUUAUUUAUGGCAAAUACACAAGUGUAUUUGCCAUAAAUAAUAU-8.06.911


Target Position: 282, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
282CGAAUAUGAUCCAACAAUA103.2213

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
280-302GACGAATATGATCCAACAATAGAUAUUGUUGGAUCAUAUUCGUCCGAAUAUGAUCCAACAAUAGAU12.18.713


Target Position: 1030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030UGCAUGCAGUUGAUUACUU75.31752647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7421048TGCATGCAGTTGATTACTTAAGTAATCAACTGCATGCA0.241600.127600.715500.750000.994600.75000


Target Position: 1180, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1180GUUUUUACUGAAACAUUGA84.42381158

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1178-1200TGGTTTTTACTGAAACATTGAGGUCAAUGUUUCAGUAAAAACCAGUUUUUACUGAAACAUUGAGGU12.10.022


Target Position: 3572, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3572GUAAAUCACUUCAUUGUUU84.86531096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5753590GTAAATCACTTCATTGTTTAAACAATGAAGTGATTTAC0.300200.210800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3570-3592ATGTAAATCACTTCATTGTTTTAAAACAAUGAAGUGAUUUACAUGUAAAUCACUUCAUUGUUUUAU12.18.921


Target Position: 432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432UGUAUUUGCCAUAAAUAAU79.01631996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861450TGTATTTGCCATAAATAATATTATTTATGGCAAATACA0.646400.051900.698300.750001.000001.00000


Target Position: 1422, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1422CUUUUCACAUUAGAUAAAU77.99992174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1420-1442TCCTTTTCACATTAGATAAATTAAUUUAUCUAAUGUGAAAAGGACUUUUCACAUUAGAUAAAUUAU6.914.922


Target Position: 4461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4461UCAAACAGUAUAUAACUUU72.42993122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8924479TCAAACAGTATATAACTTTAAAGTTATATACTGTTTGA0.169500.100800.724100.750000.994600.75000


Target Position: 1429, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429CAUUAGAUAAAUUACUAUA101.29928

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1427-1449CACATTAGATAAATTACTATAAAUAUAGUAAUUUAUCUAAUGUGCAUUAGAUAAAUUACUAUAAAU6.36.633


Target Position: 3723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3723UGCAUAAGUAAUUAAAAUA87.0732804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6133741TGCATAAGTAATTAAAATATATTTTAATTACTTATGCA0.647500.062400.810300.750001.000001.00000


Target Position: 4147, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4147GUUGAAGUUUUUUUAAAAA90.6837440

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4145-4167TTGTTGAAGTTTTTTTAAAAAAAUUUUUAAAAAAACUUCAACAAGUUGAAGUUUUUUUAAAAAAAU-9.119.220


Target Position: 3583, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3583CAUUGUUUUAAAGGAAUAA88.1027683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3581-3603TTCATTGTTTTAAAGGAATAAACUUAUUCCUUUAAAACAAUGAACAUUGUUUUAAAGGAAUAAACU19.95.312


Target Position: 2909, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2909GAAAGAAUUCCUUAGGUAA100.05646

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2907-2929CTGAAAGAATTCCTTAGGTAATCUUACCUAAGGAAUUCUUUCAGGAAAGAAUUCCUUAGGUAAUCU19.85.333


Target Position: 3516, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3516GCUCUAUAAUUGUUUUGCU86.3317894

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3514-3536CAGCTCTATAATTGTTTTGCTACAGCAAAACAAUUAUAGAGCUGGCUCUAUAAUUGUUUUGCUACU21.113.032


Target Position: 4295, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4295GAAUUUAGAACCUAACUUU91.5089372

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4293-4315AGGAATTTAGAACCTAACTTTTAAAAGUUAGGUUCUAAAUUCCUGAAUUUAGAACCUAACUUUUAU9.8-4.332


Target Position: 2464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464CCUAUGUUACACCAUCUUC72.55013097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6072482CCTATGTTACACCATCTTCGAAGATGGTGTAACATAGG0.275900.064200.672400.750000.951100.87500


Target Position: 701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
701UGAGCAAAGAUGGUAAAAA82.95561372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312719TGAGCAAAGATGGTAAAAATTTTTACCATCTTTGCTCA0.751500.577500.724100.750001.000001.00000


Target Position: 4992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4992UCUUAAUGUAACAUGUUUA85.974935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9495010TCTTAATGTAACATGTTTATAAACATGTTACATTAAGA0.158000.113000.689700.750001.000001.00000


Target Position: 2735, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2735GAAUCUGACAGAUACCAUA102.49220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2733-2755GAGAATCTGACAGATACCATAAAUAUGGUAUCUGUCAGAUUCUCGAAUCUGACAGAUACCAUAAAU20.020.423


Target Position: 252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
252GAUACAGCUAAUUCAGAAU90.2918470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777270GATACAGCTAATTCAGAATATTCTGAATTAGCTGTATC0.310200.063900.672400.750001.000001.00000


Target Position: 5723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5723ACAUAUUAUUUAUUUCUAU88.9843593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6985741ACATATTATTTATTTCTATATAGAAATAAATAATATGT0.223000.204900.663800.750001.000001.00000


Target Position: 2388, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2388CAACUAUGUAAUUUAUAUU92.4185301

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2386-2408TACAACTATGTAATTTATATTCCAAUAUAAAUUACAUAGUUGUACAACUAUGUAAUUUAUAUUCCU-8.011.632


Target Position: 3673, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3673GUAUGUCAGAUAUUCAUAU91.4898375

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3671-3693GTGTATGTCAGATATTCATATTGAUAUGAAUAUCUGACAUACACGUAUGUCAGAUAUUCAUAUUGU8.721.522


Target Position: 1393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1393GGCAAUGGAAACUAUUAUA95.7207143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9601411GGCAATGGAAACTATTATATATAATAGTTTCCATTGCC0.262300.031100.956901.000001.000001.00000


Target Position: 4804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4804GAUGAAUUUAGGGGAAAAA88.2146671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5344822GATGAATTTAGGGGAAAAATTTTTCCCCTAAATTCATC0.481900.316500.681000.750001.000001.00000


Target Position: 1628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1628UCAUAGUAUAACUUUAAAU81.13191666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111646TCATAGTATAACTTTAAATATTTAAAGTTATACTATGA0.449400.338400.715500.750001.000001.00000


Target Position: 2612, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2612GCAGUUUUAAUACUUGUAA88.7934614

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2610-2632ATGCAGTTTTAATACTTGTAATTUUACAAGUAUUAAAACUGCAUGCAGUUUUAAUACUUGUAAUUU19.010.322


Target Position: 1561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1561AGAUUUUAACAAGUAUAAA90.7624433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081579AGATTTTAACAAGTATAAATTTATACTTGTTAAAATCT0.258400.130400.724100.750001.000001.00000


Target Position: 188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
188UGAAAAUGACUGAAUAUAA93.8374221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
713206TGAAAATGACTGAATATAATTATATTCAGTCATTTTCA0.233700.151100.689700.750001.000001.00000


Target Position: 4750, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4750GUGUUUUAGUUUAAUAGUU83.81391231

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4748-4770CTGTGTTTTAGTTTAATAGTTTGAACUAUUAAACUAAAACACAGGUGUUUUAGUUUAAUAGUUUGU6.37.222


Target Position: 4747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4747UCUGUGUUUUAGUUUAAUA86.275901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8074765TCTGTGTTTTAGTTTAATATATTAAACTAAAACACAGA0.188800.080000.681000.750001.000001.00000


Target Position: 3628, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3628GCAUAACUGUGAUUCUUUU91.7171359

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1362819GCATAACTGTGATTCTTTT1/1/0/0100.00KRASNM_033360.2+NM_004985.31+1NANANA12:25359842..25359860(-)00KRAS(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3626-3648TGGCATAACTGTGATTCTTTTAGAAAAGAAUCACAGUUAUGCCAGCAUAACUGUGAUUCUUUUAGU5.311.632


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473ACCAUUAUAGAGAACAAAU80.95921693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561491ACCATTATAGAGAACAAATATTTGTTCTCTATAATGGT0.411700.307800.844800.750001.000001.00000


Target Position: 5178, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5178CUUUUAAUUGAAAUUAACU79.72821899

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5176-5198CTCTTTTAATTGAAATTAACTTTAGUUAAUUUCAAUUAAAAGAGCUUUUAAUUGAAAUUAACUUUU-0.3-9.721


Target Position: 2321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2321ACAUCACUUACUAUCCAUU82.68611411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5022339ACATCACTTACTATCCATTAATGGATAGTAAGTGATGT0.266700.156100.698300.750001.000001.00000


Target Position: 3614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3614UGUUUUUUUAUUUGGCAUA74.72372754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8773632TGTTTTTTTATTTGGCATATATGCCAAATAAAAAAACA0.335600.052100.663800.750001.000001.00000


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771ACUUUUUUCUUAAGGCAUA82.04361510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
680789ACTTTTTTCTTAAGGCATATATGCCTTAAGAAAAAAGT0.413700.283800.663800.750001.000001.00000


Target Position: 4729, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4729GUCAUAACUAGAUUAAGAU88.7333619

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4727-4749TAGTCATAACTAGATTAAGATCTAUCUUAAUCUAGUUAUGACUAGUCAUAACUAGAUUAAGAUCUU6.916.123


Target Position: 2274, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2274GUGACUUAGGUUCUAGAUA89.3326558

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2272-2294AGGTGACTTAGGTTCTAGATAGGUAUCUAGAACCUAAGUCACCUGUGACUUAGGUUCUAGAUAGGU20.220.333


Target Position: 1981, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1981CUUUUAAAUAUUAACUCAA90.3803462

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1979-2001TACTTTTAAATATTAACTCAAAAUUGAGUUAAUAUUUAAAAGUACUUUUAAAUAUUAACUCAAAAU20.3-9.122


Target Position: 4431, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4431GAUUUUUUUUUUCUUCUAA92.9724266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7854449GATTTTTTTTTTCTTCTAATTAGAAGAAAAAAAAAATC0.834600.772800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4429-4451TTGATTTTTTTTTTCTTCTAAACUUAGAAGAAAAAAAAAAUCAAGAUUUUUUUUUUCUUCUAAACU20.2-12.011


Target Position: 1955, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1955GAAAACAAACUCUUUUUUA91.8909350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251973GAAAACAAACTCTTTTTTATAAAAAAGAGTTTGTTTTC0.244700.061300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1953-1975AAGAAAACAAACTCTTTTTTAAAUAAAAAAGAGUUUGUUUUCUUGAAAACAAACUCUUUUUUAAAU-5.95.621


Target Position: 245, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245CCUUGACGAUACAGCUAAU92.9595269

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1024519CCTTGACGATACAGCTAAT1/1/0/097.21KRASNM_033360.2+NM_004985.31+1NANANA12:25398248..25398266(-)00KRAS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
597263CCTTGACGATACAGCTAATATTAGCTGTATCGTCAAGG0.238500.071000.836201.000001.000001.00000


Target Position: 1028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028GGUGCAUGCAGUUGAUUAC79.45711943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621046GGTGCATGCAGTTGATTACGTAATCAACTGCATGCACC0.224400.129600.672400.750000.983700.62500


Target Position: 5227, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5227AGUGAUCUAAAAUUUGUAA89.1296578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9405245AGTGATCTAAAATTTGTAATTACAAATTTTAGATCACT0.159600.071100.672400.750001.000001.00000


Target Position: 1070, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070GAAUGUUGGUGUGAAACAA98.203174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1068-1090GTGAATGTTGGTGTGAAACAAATUUGUUUCACACCAACAUUCACGAAUGUUGGUGUGAAACAAAUU20.512.122


Target Position: 4279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4279GAGUCACACUGCAUAGGAA107.3653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9624297GAGTCACACTGCATAGGAATTCCTATGCAGTGTGACTC0.209700.031000.637900.750001.000001.00000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413GGCCAUUUCCUUUUCACAU82.60341423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351431GGCCATTTCCTTTTCACATATGTGAAAAGGAAATGGCC0.273100.039800.844801.000001.000001.00000


Target Position: 763, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763CAAUUUGUACUUUUUUCUU82.94821373

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
761-783TACAATTTGTACTTTTTTCTTAAAAGAAAAAAGUACAAAUUGUACAAUUUGUACUUUUUUCUUAAU5.55.312


Target Position: 2095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095CUCUUAACACUGGUUAAAU81.32281632

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2093-2115TTCTCTTAACACTGGTTAAATTAAUUUAACCAGUGUUAAGAGAACUCUUAACACUGGUUAAAUUAU14.014.631


Target Position: 942, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
942CCAGUAUUCCCAGAGUUUU77.25052303

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
940-962TGCCAGTATTCCCAGAGTTTTGGAAAACUCUGGGAAUACUGGCACCAGUAUUCCCAGAGUUUUGGU17.711.622


Target Position: 4346, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4346CAAUUUUGUCCUAAUAUAU92.2478317

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4344-4366CACAATTTTGTCCTAATATATACAUAUAUUAGGACAAAAUUGUGCAAUUUUGUCCUAAUAUAUACU-5.9-3.323


Target Position: 1420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1420UCCUUUUCACAUUAGAUAA82.37591455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7941438TCCTTTTCACATTAGATAATTATCTAATGTGAAAAGGA0.483400.103600.836200.750001.000001.00000


Target Position: 4216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4216CAGACGUAUAUUGUAUCAU83.47851287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9984234CAGACGTATATTGTATCATATGATACAATATACGTCTG0.254700.034500.629300.750001.000001.00000


Target Position: 2635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2635CCUAACCAUAAGAUUUACU75.6662584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392653CCTAACCATAAGATTTACTAGTAAATCTTATGGTTAGG0.321500.252900.637900.750000.956500.87500


Target Position: 1622, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622GCUCUUUCAUAGUAUAACU89.9469506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731640GCTCTTTCATAGTATAACTAGTTATACTATGAAAGAGC0.491400.322500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1620-1642CTGCTCTTTCATAGTATAACTTTAGUUAUACUAUGAAAGAGCAGGCUCUUUCAUAGUAUAACUUUU9.519.132


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557CUAGAACAGUAGACACAAA100.07245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
866575CTAGAACAGTAGACACAAATTTGTGTCTACTGTTCTAG0.228700.045600.672400.750001.000001.00000


Target Position: 4673, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4673CAUAAAAUGAAACUUUCUU81.40541619

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4671-4693GTCATAAAATGAAACTTTCTTTCAAGAAAGUUUCAUUUUAUGACCAUAAAAUGAAACUUUCUUUCU17.7-10.322


Target Position: 3300, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3300CUCAUUUAUUCAGCAAAUA83.63751263

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3298-3320AACTCATTTATTCAGCAAATATTUAUUUGCUGAAUAAAUGAGUUCUCAUUUAUUCAGCAAAUAUUU18.58.910


Target Position: 5630, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5630CAACAUUAAUAAUGGAAAU89.618528

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5628-5650AGCAACATTAATAATGGAAATAAAUUUCCAUUAUUAAUGUUGCUCAACAUUAAUAAUGGAAAUAAU20.16.9


Target Position: 256, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256CAGCUAAUUCAGAAUCAUU93.4891238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
628274CAGCTAATTCAGAATCATTAATGATTCTGAATTAGCTG0.252100.078700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
254-276TACAGCTAATTCAGAATCATTTTAAUGAUUCUGAAUUAGCUGUACAGCUAAUUCAGAAUCAUUUUU16.218.302


Target Position: 1661, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1661GAGUCUUUGAAGAUAGUUU89.6064529

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1659-1681TTGAGTCTTTGAAGATAGTTTTAAAACUAUCUUCAAAGACUCAAGAGUCUUUGAAGAUAGUUUUAU14.517.722


Target Position: 3268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3268CCACCUUGGCCUCAUAAAC67.96973858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6283286CCACCTTGGCCTCATAAACGTTTATGAGGCCAAGGTGG0.594800.061100.698300.750001.000001.00000


Target Position: 5390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5390AGUAUACCAGUGAAUCUUU83.96581210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4895408AGTATACCAGTGAATCTTTAAAGATTCACTGGTATACT0.269700.114400.706900.750001.000001.00000


Target Position: 748, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748GUAAUUAUGUAAAUACAAU92.0669331

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
746-768GTGTAATTATGTAAATACAATTTAUUGUAUUUACAUAAUUACACGUAAUUAUGUAAAUACAAUUUU6.9-8.022


Target Position: 5316, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5316GUGUAUUUAUUCAUGAAAU89.7334521

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5314-5336GTGTGTATTTATTCATGAAATTTAUUUCAUGAAUAAAUACACACGUGUAUUUAUUCAUGAAAUUUU13.86.9


Target Position: 3837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3837UCUGAAUUGCUAUGUGAAA81.43011614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9433855TCTGAATTGCTATGTGAAATTTCACATAGCAATTCAGA0.159100.055400.724100.750001.000001.00000


Target Position: 4310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4310CUUUUAUAGGUUAUCAAAA90.1269491

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4308-4330AACTTTTATAGGTTATCAAAACTUUUUGAUAACCUAUAAAAGUUCUUUUAUAGGUUAUCAAAACUU8.9-7.522


Target Position: 1687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687GCUUGUGACAUUAAAAGAU86.4923876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6751705GCTTGTGACATTAAAAGATATCTTTTAATGTCACAAGC0.258200.055100.672401.000001.000001.00000


Target Position: 2395, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2395GUAAUUUAUAUUCCAUUUA86.3064898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8332413GTAATTTATATTCCATTTATAAATGGAATATAAATTAC0.214600.078400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2393-2415ATGTAATTTATATTCCATTTACAUAAAUGGAAUAUAAAUUACAUGUAAUUUAUAUUCCAUUUACAU20.1-7.521


Target Position: 931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931UCCUCUAAGUGCCAGUAUU75.51522605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978949TCCTCTAAGTGCCAGTATTAATACTGGCACTTAGAGGA0.153900.088300.862100.750001.000001.00000


Target Position: 4476, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4476CUUUUUUUAGGGGAUUUUU69.16153656

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4474-4496AACTTTTTTTAGGGGATTTTTTTAAAAAUCCCCUAAAAAAAGUUCUUUUUUUAGGGGAUUUUUUUU14.2-11.321


Target Position: 4662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4662UGAAUAGCUGUCAUAAAAU81.82921543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9544680TGAATAGCTGTCATAAAATATTTTATGACAGCTATTCA0.157500.059100.715500.750001.000001.00000


Target Position: 1781, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1781GCUUUCAUAGAGAGUUUCA88.2068672

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1779-1801GAGCTTTCATAGAGAGTTTCACAUGAAACUCUCUAUGAAAGCUCGCUUUCAUAGAGAGUUUCACAU21.512.032


Target Position: 4041, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4041CUUUGAAUGGUUUAACAAA92.0573334

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4039-4061AACTTTGAATGGTTTAACAAAAGUUUGUUAAACCAUUCAAAGUUCUUUGAAUGGUUUAACAAAAGU7.27.422


Target Position: 2184, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184CCUUUUGAUAAAUUUAAAA88.271668

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2182-2204ATCCTTTTGATAAATTTAAAATGUUUUAAAUUUAUCAAAAGGAUCCUUUUGAUAAAUUUAAAAUGU-9.712.221


Target Position: 3185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3185ACUAAUUUUUGUAUUUUUA85.8471959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9513203ACTAATTTTTGTATTTTTATAAAAATACAAAAATTAGT0.157800.074100.672400.750001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440CCAUAAAUAAUACUAAAUC76.63772422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
701458CCATAAATAATACTAAATCGATTTAGTATTATTTATGG0.510000.435100.663800.750001.000001.00000


Target Position: 4783, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4783GGGAUAAUGAUAGGUAAUU81.39431622

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4781-4803TTGGGATAATGATAGGTAATTTAAAUUACCUAUCAUUAUCCCAAGGGAUAAUGAUAGGUAAUUUAU18.515.423


Target Position: 2956, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2956GUAAUACAUUCCAUUGUUU87.256781

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2954-2976CAGTAATACATTCCATTGTTTTAAAACAAUGGAAUGUAUUACUGGUAAUACAUUCCAUUGUUUUAU12.18.522


Target Position: 3603, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3603CUUGAUUAUAUUGUUUUUU71.09233361

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3601-3623AACTTGATTATATTGTTTTTTTAAAAAAACAAUAUAAUCAAGUUCUUGAUUAUAUUGUUUUUUUAU5.68.922


Target Position: 2146, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2146CAUAUUUAAUAAUGCUUUA95.7484141

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2144-2166TCCATATTTAATAATGCTTTAAAUAAAGCAUUAUUAAAUAUGGACAUAUUUAAUAAUGCUUUAAAU18.5-8.012


Target Position: 5271, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5271CCUAAUUAUUGUAAUGUAA96.2771124

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5269-5291CTCCTAATTATTGTAATGTAATAUUACAUUACAAUAAUUAGGAGCCUAAUUAUUGUAAUGUAAUAU8.5-2.323


Target Position: 2139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2139UCUGAUCCAUAUUUAAUAA88.8669607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362157TCTGATCCATATTTAATAATTATTAAATATGGATCAGA0.233000.134900.689700.750001.000001.00000


Target Position: 1193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1193CAUUGAGGGAACACAAAUU87.2651779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661211CATTGAGGGAACACAAATTAATTTGTGTTCCCTCAATG0.176500.051800.646600.750001.000001.00000


Target Position: 4937, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4937GUUGAAAAUACUUUUGCAU80.95551695

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4935-4957ATGTTGAAAATACTTTTGCATTTAUGCAAAAGUAUUUUCAACAUGUUGAAAAUACUUUUGCAUUUU20.07.721


Target Position: 2705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2705CCCUACAUCUUAUUUCCUC69.61123593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372723CCCTACATCTTATTTCCTCGAGGAAATAAGATGTAGGG0.753000.076100.681000.750001.000001.00000


Target Position: 4558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4558UGUGUAGUAAUGUUUUUUA85.33651022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8214576TGTGTAGTAATGTTTTTTATAAAAAACATTACTACACA0.228800.121500.672400.750001.000001.00000


Target Position: 5514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5514CAAAUCUGCCUUUAUGACA85.0911059

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5512-5534AACAAATCTGCCTTTATGACAAAUGUCAUAAAGGCAGAUUUGUUCAAAUCUGCCUUUAUGACAAAU16.112.0


Target Position: 5715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5715GACUCCAUACAUAUUAUUU90.5069452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9675733GACTCCATACATATTATTTAAATAATATGTATGGAGTC0.339600.044300.819000.750001.000001.00000


Target Position: 4405, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4405CAAGUUCAUCUCAUUUGUA96.9472116

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4403-4425CACAAGTTCATCTCATTTGTATTUACAAAUGAGAUGAACUUGUGCAAGUUCAUCUCAUUUGUAUUU12.119.232


Target Position: 2208, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2208CUUAUUUUAAAAUAAAUGA80.68931737

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2206-2228TACTTATTTTAAAATAAATGAAGUCAUUUAUUUUAAAAUAAGUACUUAUUUUAAAAUAAAUGAAGU-1.8-9.721


Target Position: 1173, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1173CUAAUUGGUUUUUACUGAA90.3027469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1171-1193TTCTAATTGGTTTTTACTGAAACUUCAGUAAAAACCAAUUAGAACUAAUUGGUUUUUACUGAAACU20.312.822


Target Position: 883, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
883GCUUUUACCUUAAAUGCUU82.16671488

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
881-903TAGCTTTTACCTTAAATGCTTATAAGCAUUUAAGGUAAAAGCUAGCUUUUACCUUAAAUGCUUAUU18.54.922


Target Position: 3448, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3448GUAUACGACCCAGAGAUAA87.4171762

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3446-3468TGGTATACGACCCAGAGATAACAUUAUCUCUGGGUCGUAUACCAGUAUACGACCCAGAGAUAACAU20.217.733


Target Position: 5050, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5050GAAACAUGCACAUUUUGUA97.1353108

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5048-5070CTGAAACATGCACATTTTGTACAUACAAAAUGUGCAUGUUUCAGGAAACAUGCACAUUUUGUACAU5.312.131


Target Position: 4090, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4090GAGAAUUCUAGAAAUAAAU88.6669624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7194108GAGAATTCTAGAAATAAATATTTATTTCTAGAATTCTC0.209800.091300.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4088-4110GGGAGAATTCTAGAAATAAATGTAUUUAUUUCUAGAAUUCUCCCGAGAAUUCUAGAAAUAAAUGUU-9.714.822


Target Position: 3181, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3181CUCAACUAAUUUUUGUAUU74.8952729

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7323199CTCAACTAATTTTTGTATTAATACAAAAATTAGTTGAG0.697900.075600.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3179-3201CACTCAACTAATTTTTGTATTTTAAUACAAAAAUUAGUUGAGUGCUCAACUAAUUUUUGUAUUUUU6.920.311


Target Position: 683, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683GAAAACAUAAAGAAAAGAU86.4526882

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
681-703TCGAAAACATAAAGAAAAGATGAAUCUUUUCUUUAUGUUUUCGAGAAAACAUAAAGAAAAGAUGAU14.85.322


Target Position: 3023, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3023CUUACUUUUUUUUUUUGGU66.52944057

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3021-3043AGCTTACTTTTTTTTTTTGGTGTACCAAAAAAAAAAAGUAAGCUCUUACUUUUUUUUUUUGGUGUU11.54.921


Target Position: 674, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674GAGAAAUUCGAAAACAUAA97.064111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923692GAGAAATTCGAAAACATAATTATGTTTTCGAATTTCTC0.344000.047700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
672-694TCGAGAAATTCGAAAACATAAAGUUAUGUUUUCGAAUUUCUCGAGAGAAAUUCGAAAACAUAAAGU6.95.322


Target Position: 1078, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078GUGUGAAACAAAUUAAUGA91.3879379

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1076-1098TGGTGTGAAACAAATTAATGAAGUCAUUAAUUUGUUUCACACCAGUGUGAAACAAAUUAAUGAAGU-1.820.532


Target Position: 3671, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3671GUGUAUGUCAGAUAUUCAU88.4747647

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3669-3691AGGTGTATGTCAGATATTCATATAUGAAUAUCUGACAUACACCUGUGUAUGUCAGAUAUUCAUAUU8.720.432


Target Position: 2204, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2204GUUACUUAUUUUAAAAUAA94.8763174

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2202-2224ATGTTACTTATTTTAAAATAAATUUAUUUUAAAAUAAGUAACAUGUUACUUAUUUUAAAAUAAAUU-7.56.621


Target Position: 2444, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2444CACAAUCUGUAAAUUUUUA93.1779251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942462CACAATCTGTAAATTTTTATAAAAATTTACAGATTGTG0.345200.095500.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2442-2464AGCACAATCTGTAAATTTTTAACUAAAAAUUUACAGAUUGUGCUCACAAUCUGUAAAUUUUUAACU-12.019.221


Target Position: 4113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4113CCUAAUUAUUACAGCCUUA94.1469208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1554131CCTAATTATTACAGCCTTATAAGGCTGTAATAATTAGG0.611100.468800.810301.000001.000001.00000


Target Position: 799, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
799GUGGUAAUUUUUGUACAUU81.66331579

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
797-819AAGTGGTAATTTTTGTACATTACAAUGUACAAAAAUUACCACUUGUGGUAAUUUUUGUACAUUACU20.420.022


Target Position: 4598, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4598GCUGAAUUUAUAUUUAGUA95.2223161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4596-4618AAGCTGAATTTATATTTAGTAACUACUAAAUAUAAAUUCAGCUUGCUGAAUUUAUAUUUAGUAACU4.612.022


Target Position: 5150, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5150GUCAUAUCAAACAUUAAAA91.894347

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5148-5170TGGTCATATCAAACATTAAAAATUUUUAAUGUUUGAUAUGACCAGUCAUAUCAAACAUUAAAAAUU-1.417.421


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698AGAUGAGCAAAGAUGGUAA94.6841184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486716AGATGAGCAAAGATGGTAATTACCATCTTTGCTCATCT0.657700.510500.689700.750001.000001.00000


Target Position: 4050, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4050GUUUAACAAAAGAUUUGUU82.09341502

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4048-4070TGGTTTAACAAAAGATTTGTTTTAACAAAUCUUUUGUUAAACCAGUUUAACAAAAGAUUUGUUUUU14.87.221


Target Position: 997, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997GAAUACCUAAGAUUUCUGU80.47181778

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
995-1017CTGAATACCTAAGATTTCTGTCTACAGAAAUCUUAGGUAUUCAGGAAUACCUAAGAUUUCUGUCUU12.018.522


Target Position: 1688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688CUUGUGACAUUAAAAGAUU82.21621478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9941706CTTGTGACATTAAAAGATTAATCTTTTAATGTCACAAG0.261000.072100.629300.750001.000001.00000


Target Position: 2414, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414CAUAAGGAUACACUUAUUU83.07931354

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2412-2434TACATAAGGATACACTTATTTGTAAAUAAGUGUAUCCUUAUGUACAUAAGGAUACACUUAUUUGUU4.619.912


Target Position: 5643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5643GGAAAUAAUUGAAUAGUUA103.05214

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5641-5663ATGGAAATAATTGAATAGTTAGTUAACUAUUCAAUUAUUUCCAUGGAAAUAAUUGAAUAGUUAGUU4.62.1


Target Position: 4416, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4416CAUUUGUAUUCCAUUGAUU88.7017621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8094434CATTTGTATTCCATTGATTAATCAATGGAATACAAATG0.462300.243100.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4414-4436CTCATTTGTATTCCATTGATTTTAAUCAAUGGAAUACAAAUGAGCAUUUGUAUUCCAUUGAUUUUU13.66.922


Target Position: 2465, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465CUAUGUUACACCAUCUUCA91.1998396

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2463-2485ACCTATGTTACACCATCTTCAGTUGAAGAUGGUGUAACAUAGGUCUAUGUUACACCAUCUUCAGUU20.48.532


Target Position: 891, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891CUUAAAUGCUUAUUUUAAA92.3862302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922909CTTAAATGCTTATTTTAAATTTAAAATAAGCATTTAAG0.515100.078800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
889-911ACCTTAAATGCTTATTTTAAAATUUUAAAAUAAGCAUUUAAGGUCUUAAAUGCUUAUUUUAAAAUU-9.7-1.421


Target Position: 2102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2102CACUGGUUAAAUUAACAUU85.5815990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8612120CACTGGTTAAATTAACATTAATGTTAATTTAACCAGTG0.287400.037700.784500.750001.000001.00000


Target Position: 5261, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5261CUGUACUACUCCUAAUUAU89.7536518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9455279CTGTACTACTCCTAATTATATAATTAGGAGTAGTACAG0.220700.127100.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5259-5281AACTGTACTACTCCTAATTATTGAUAAUUAGGAGUAGUACAGUUCUGUACUACUCCUAAUUAUUGU-2.320.233


Target Position: 439, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439GCCAUAAAUAAUACUAAAU85.9706936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
198457GCCATAAATAATACTAAATATTTAGTATTATTTATGGC0.509800.403100.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
437-459TTGCCATAAATAATACTAAATCAAUUUAGUAUUAUUUAUGGCAAGCCAUAAAUAAUACUAAAUCAU6.612.822


Target Position: 811, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811GUACAUUACACUAAAUUAU87.6906732

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
809-831TTGTACATTACACTAAATTATTAAUAAUUUAGUGUAAUGUACAAGUACAUUACACUAAAUUAUUAU-7.58.532


Target Position: 2364, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364CAAACUCUUAGUUUUUUUU80.67611741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8992382CAAACTCTTAGTTTTTTTTAAAAAAAACTAAGAGTTTG0.307700.168400.646600.750000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2362-2384CTCAAACTCTTAGTTTTTTTTTTAAAAAAAACUAAGAGUUUGAGCAAACUCUUAGUUUUUUUUUUU-11.317.722


Target Position: 433, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433GUAUUUGCCAUAAAUAAUA90.0855493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
934451GTATTTGCCATAAATAATATATTATTTATGGCAAATAC0.649900.083300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
431-453GTGTATTTGCCATAAATAATACTUAUUAUUUAUGGCAAAUACACGUAUUUGCCAUAAAUAAUACUU-10.315.311


Target Position: 4784, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4784GGAUAAUGAUAGGUAAUUU97.2894102

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4782-4804TGGGATAATGATAGGTAATTTAGAAAUUACCUAUCAUUAUCCCAGGAUAAUGAUAGGUAAUUUAGU13.98.732


Target Position: 4134, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4134GACAAAAAUCCUUGUUGAA94.1042210

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4132-4154AAGACAAAAATCCTTGTTGAAGTUUCAACAAGGAUUUUUGUCUUGACAAAAAUCCUUGUUGAAGUU20.55.622


Target Position: 2756, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2756GGGAUUUGACCUAAUCACU83.77461236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2754-2776AAGGGATTTGACCTAATCACTAAAGUGAUUAGGUCAAAUCCCUUGGGAUUUGACCUAAUCACUAAU16.120.133


Target Position: 5477, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5477CUUAAACUUAAAACCAUAU80.00121848

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5475-5497TGCTTAAACTTAAAACCATATTTAUAUGGUUUUAAGUUUAAGCACUUAAACUUAAAACCAUAUUUU20.04.9


Target Position: 5419, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5419GUUAGAAGUAUCCUUUAUU86.0541924

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5417-5439TTGTTAGAAGTATCCTTTATTTCAAUAAAGGAUACUUCUAACAAGUUAGAAGUAUCCUUUAUUUCU10.911.7


Target Position: 2605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2605ACUUGAUGCAGUUUUAAUA90.1419484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9782623ACTTGATGCAGTTTTAATATATTAAAACTGCATCAAGT0.220500.030000.663800.750000.989100.62500


Target Position: 1538, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1538CUAAAUUUUUAUAAUAAUU84.89581091

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1536-1558TACTAAATTTTTATAATAATTGAAAUUAUUAUAAAAAUUUAGUACUAAAUUUUUAUAAUAAUUGAU-8.0-9.712


Target Position: 2362, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362CUCAAACUCUUAGUUUUUU74.99632708

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2360-2382ATCTCAAACTCTTAGTTTTTTTTAAAAAACUAAGAGUUUGAGAUCUCAAACUCUUAGUUUUUUUUU3.219.221


Target Position: 1428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428ACAUUAGAUAAAUUACUAU88.1971674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7001446ACATTAGATAAATTACTATATAGTAATTTATCTAATGT0.580400.381200.663800.750001.000001.00000


Target Position: 2369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369UCUUAGUUUUUUUUUUUUA78.30472121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892387TCTTAGTTTTTTTTTTTTATAAAAAAAAAAAACTAAGA0.417600.120800.689700.750001.000001.00000


Target Position: 2996, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2996CAAUGAAAAAUACUUUAAU89.1701576

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2994-3016TGCAATGAAAAATACTTTAATTCAUUAAAGUAUUUUUCAUUGCACAAUGAAAAAUACUUUAAUUCU4.97.411


Target Position: 4466, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4466CAGUAUAUAACUUUUUUUA95.733142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9154484CAGTATATAACTTTTTTTATAAAAAAAGTTATATACTG0.164400.100100.750000.750000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4464-4486AACAGTATATAACTTTTTTTAGGUAAAAAAAGUUAUAUACUGUUCAGUAUAUAACUUUUUUUAGGU-11.36.112


Target Position: 2134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134UCAAGUCUGAUCCAUAUUU71.99243199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3472152TCAAGTCTGATCCATATTTAAATATGGATCAGACTTGA0.369100.115300.724100.750001.000001.00000


Target Position: 5423, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5423GAAGUAUCCUUUAUUUCUA100.21942

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5421-5443TAGAAGTATCCTTTATTTCTAAAUAGAAAUAAAGGAUACUUCUAGAAGUAUCCUUUAUUUCUAAAU6.914.5


Target Position: 1041, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041GAUUACUUCUUAUUUUUCU84.22731185

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1039-1061TTGATTACTTCTTATTTTTCTTAAGAAAAAUAAGAAGUAAUCAAGAUUACUUCUUAUUUUUCUUAU0.44.620


Target Position: 2549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2549GGACUCUUCUUCCAUAUUA96.6429120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412567GGACTCTTCTTCCATATTATAATATGGAAGAAGAGTCC0.257400.076500.836201.000001.000001.00000


Target Position: 1723, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723GCUUAUUAGGUGUUGAAGA87.6714734

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1721-1743TAGCTTATTAGGTGTTGAAGAGAUCUUCAACACCUAAUAAGCUAGCUUAUUAGGUGUUGAAGAGAU19.2-2.323


Target Position: 5318, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5318GUAUUUAUUCAUGAAAUUU83.15141342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5316-5338GTGTATTTATTCATGAAATTTGAAAAUUUCAUGAAUAAAUACACGUAUUUAUUCAUGAAAUUUGAU7.4-8.0


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390CAAGGCAAUGGAAACUAUU82.13521498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8911408CAAGGCAATGGAAACTATTAATAGTTTCCATTGCCTTG0.270400.039100.637900.750001.000001.00000


Target Position: 3287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287CUGUUUUGCAGAACUCAUU77.83312200

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3285-3307ACCTGTTTTGCAGAACTCATTTAAAUGAGUUCUGCAAAACAGGUCUGUUUUGCAGAACUCAUUUAU19.212.222


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877CUGUUAGCUUUUACCUUAA90.7843428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
928895CTGTTAGCTTTTACCTTAATTAAGGTAAAAGCTAACAG0.160900.050400.750000.750001.000001.00000


Target Position: 585, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585GGACUUAGCAAGAAGUUAU92.9534270

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
583-605CAGGACTTAGCAAGAAGTTATGGAUAACUUCUUGCUAAGUCCUGGGACUUAGCAAGAAGUUAUGGU14.618.913


Target Position: 4681, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4681GAAACUUUCUUUCUAAAGA89.8753508

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4679-4701ATGAAACTTTCTTTCTAAAGAAAUCUUUAGAAAGAAAGUUUCAUGAAACUUUCUUUCUAAAGAAAU11.73.212


Target Position: 4088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4088GGGAGAAUUCUAGAAAUAA99.291153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7474106GGGAGAATTCTAGAAATAATTATTTCTAGAATTCTCCC0.204000.070800.956901.000001.000001.00000


Target Position: 5258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5258GAACUGUACUACUCCUAAU97.2815104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6815276GAACTGTACTACTCCTAATATTAGGAGTAGTACAGTTC0.314800.216900.663800.750001.000001.00000


Target Position: 5633, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5633CAUUAAUAAUGGAAAUAAU97.879683

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5631-5653AACATTAATAATGGAAATAATTGAUUAUUUCCAUUAUUAAUGUUCAUUAAUAAUGGAAAUAAUUGU2.1-8.0


Target Position: 1034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1034UGCAGUUGAUUACUUCUUA86.0614922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391052TGCAGTTGATTACTTCTTATAAGAAGTAATCAACTGCA0.424700.132000.819000.750000.994600.62500


Target Position: 3467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3467CACGAUGCGUAUUUUAGUU83.63741264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9583485CACGATGCGTATTTTAGTTAACTAAAATACGCATCGTG0.462900.031100.646600.750001.000001.00000


Target Position: 5542, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5542GAUAACAUUAUUUAUUUAU86.4696879

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5540-5562AGGATAACATTATTTATTTATTTAUAAAUAAAUAAUGUUAUCCUGAUAACAUUAUUUAUUUAUUUU-7.56.7


Target Position: 4217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4217AGACGUAUAUUGUAUCAUU94.0115214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9524235AGACGTATATTGTATCATTAATGATACAATATACGTCT0.309400.042400.715500.750001.000001.00000


Target Position: 3559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3559CAAGCUACUUUAUGUAAAU91.93346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713577CAAGCTACTTTATGTAAATATTTACATAAAGTAGCTTG0.178200.084700.637900.750000.994600.75000


Target Position: 5187, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5187GAAAUUAACUUUUAAAUGU84.26561177

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5185-5207TTGAAATTAACTTTTAAATGTTTACAUUUAAAAGUUAAUUUCAAGAAAUUAACUUUUAAAUGUUUU-1.4-9.721


Target Position: 2331, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2331CUAUCCAUUUCUUCAUGUU83.23441329

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2329-2351TACTATCCATTTCTTCATGTTAAAACAUGAAGAAAUGGAUAGUACUAUCCAUUUCUUCAUGUUAAU20.521.222


Target Position: 922, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922GUUUUUUUUUCCUCUAAGU75.9142548

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
920-942AAGTTTTTTTTTCCTCTAAGTGCACUUAGAGGAAAAAAAAACUUGUUUUUUUUUCCUCUAAGUGCU16.3-11.312


Target Position: 4302, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4302GAACCUAACUUUUAUAGGU84.91641083

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4300-4322TAGAACCTAACTTTTATAGGTTAACCUAUAAAAGUUAGGUUCUAGAACCUAACUUUUAUAGGUUAU12.318.623


Target Position: 2159, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2159GCUUUAAAAUAAAAAUAAA99.059257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
982177GCTTTAAAATAAAAATAAATTTATTTTTATTTTAAAGC0.812100.468100.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2157-2179ATGCTTTAAAATAAAAATAAAAAUUUAUUUUUAUUUUAAAGCAUGCUUUAAAAUAAAAAUAAAAAU-9.7-3.811


Target Position: 5624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5624CAGCAGCAACAUUAAUAAU89.7107524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7795642CAGCAGCAACATTAATAATATTATTAATGTTGCTGCTG0.238800.044100.775900.750001.000001.00000


Target Position: 4281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4281GUCACACUGCAUAGGAAUU81.12851667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6744299GTCACACTGCATAGGAATTAATTCCTATGCAGTGTGAC0.254600.130700.810300.750001.000001.00000


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368AGAAAAAAAUGGAAAAAAA93.3151245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9131386AGAAAAAAATGGAAAAAAATTTTTTTCCATTTTTTTCT0.410700.159000.724100.750001.000001.00000


Target Position: 5658, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5658GUUAGUUAUGUAUGUUAAU85.7459972

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5656-5678TAGTTAGTTATGTATGTTAATGCAUUAACAUACAUAACUAACUAGUUAGUUAUGUAUGUUAAUGCU6.96.6


Target Position: 2028, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2028CAAGACAUUAAUUUUUUUU78.54072082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8302046CAAGACATTAATTTTTTTTAAAAAAAATTAATGTCTTG0.354000.049700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2026-2048GCCAAGACATTAATTTTTTTTTTAAAAAAAAUUAAUGUCUUGGCCAAGACAUUAAUUUUUUUUUUU-11.319.222


Target Position: 1035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1035GCAGUUGAUUACUUCUUAU93.6843227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2661053GCAGTTGATTACTTCTTATATAAGAAGTAATCAACTGC0.430800.136500.810301.000001.000001.00000


Target Position: 1337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1337CUCCCCAAAAUAUUAUAUU75.20892665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8031355CTCCCCAAAATATTATATTAATATAATATTTTGGGGAG0.189200.169300.801700.750001.000001.00000


Target Position: 2026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2026GCCAAGACAUUAAUUUUUU80.99021691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9972044GCCAAGACATTAATTTTTTAAAAAATTAATGTCTTGGC0.189000.028201.000001.000001.000001.00000


Target Position: 5107, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5107CAGUUGUUUUCCAUCAUUU87.8127724

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5105-5127TCCAGTTGTTTTCCATCATTTGGAAAUGAUGGAAAACAACUGGACAGUUGUUUUCCAUCAUUUGGU13.617.822


Target Position: 2441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2441CAGCACAAUCUGUAAAUUU86.5496866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7792459CAGCACAATCTGTAAATTTAAATTTACAGATTGTGCTG0.197400.087000.784500.750000.967400.62500


Target Position: 2877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2877CAGUGGAAGGAGAAUUUAA98.864461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602895CAGTGGAAGGAGAATTTAATTAAATTCTCCTTCCACTG0.479600.037800.750000.750001.000001.00000


Target Position: 5019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5019GUAUUUUAACUAUUUUUGU78.38982107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5017-5039ATGTATTTTAACTATTTTTGTATACAAAAAUAGUUAAAAUACAUGUAUUUUAACUAUUUUUGUAUU-3.3-7.522


Target Position: 3651, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3651CAAUUACUGUACACAUUAA104.9938

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3649-3671GACAATTACTGTACACATTAAGGUUAAUGUGUACAGUAAUUGUCCAAUUACUGUACACAUUAAGGU13.54.622


Target Position: 3693, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3693GACCCAAAUGUGUAAUAUU92.6236290

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7369319GACCCAAATGTGTAATATT1/1/0/097.75KRASNM_033360.2+NM_004985.31+1NANANA12:25359777..25359795(-)00KRAS(0.002)


Target Position: 4599, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4599CUGAAUUUAUAUUUAGUAA95.6053148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4597-4619AGCTGAATTTATATTTAGTAACTUUACUAAAUAUAAAUUCAGCUCUGAAUUUAUAUUUAGUAACUU6.67.422


Target Position: 821, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821CUAAAUUAUUAGCAUUUGU78.77752038

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
819-841CACTAAATTATTAGCATTTGTTTACAAAUGCUAAUAAUUUAGUGCUAAAUUAUUAGCAUUUGUUUU20.0-7.522


Target Position: 1340, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1340CCCAAAAUAUUAUAUUUUU84.9251082

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1338-1360TCCCCAAAATATTATATTTTTTCAAAAAUAUAAUAUUUUGGGGACCCAAAAUAUUAUAUUUUUUCU-10.311.322


Target Position: 5468, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5468GCGUGUUUGCUUAAACUUA92.1569324

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5466-5488AGGCGTGTTTGCTTAAACTTAAAUAAGUUUAAGCAAACACGCCUGCGUGUUUGCUUAAACUUAAAU4.919.8


Target Position: 4066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4066GUUUUUGUAGAGAUUUUAA92.8706274

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4064-4086TTGTTTTTGTAGAGATTTTAAAGUUAAAAUCUCUACAAAAACAAGUUUUUGUAGAGAUUUUAAAGU2.15.612


Target Position: 186, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
186GCUGAAAAUGACUGAAUAU92.7277283

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_318619GCTGAAAATGACTGAATAT1/1/0/097.75KRASNM_033360.2+NM_004985.31+1NANANA6:54635374..54635392(+)|1:210791468..210791486(+)00KRAS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
707204GCTGAAAATGACTGAATATATATTCAGTCATTTTCAGC0.212800.145400.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
184-206CTGCTGAAAATGACTGAATATAAAUAUUCAGUCAUUUUCAGCAGGCUGAAAAUGACUGAAUAUAAU13.412.202


Target Position: 2335, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2335CCAUUUCUUCAUGUUAAAA88.0047706

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2333-2355ATCCATTTCTTCATGTTAAAAGAUUUUAACAUGAAGAAAUGGAUCCAUUUCUUCAUGUUAAAAGAU7.212.022


Target Position: 802, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802GUAAUUUUUGUACAUUACA84.23681182

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
800-822TGGTAATTTTTGTACATTACACTUGUAAUGUACAAAAAUUACCAGUAAUUUUUGUACAUUACACUU14.6-9.722


Target Position: 3594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3594AGGAAUAAACUUGAUUAUA86.921819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9143612AGGAATAAACTTGATTATATATAATCAAGTTTATTCCT0.559200.033900.801700.750001.000001.00000


Target Position: 3943, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3943CAGGAACUGCAGUGCUUAU88.8061613

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9394319CAGGAACTGCAGTGCTTAT1/1/0/097.75KRASNM_033360.2+NM_004985.31+1NANANA12:25359527..25359545(-)00KRAS(0.002)


Target Position: 1632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1632AGUAUAACUUUAAAUCUUU86.6123857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791650AGTATAACTTTAAATCTTTAAAGATTTAAAGTTATACT0.400000.350200.706900.750001.000001.00000


Target Position: 723, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
723GAAAAAGAAGUCAAAGACA93.5073236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
721-743AAGAAAAAGAAGTCAAAGACAAAUGUCUUUGACUUCUUUUUCUUGAAAAAGAAGUCAAAGACAAAU19.25.512


Target Position: 3744, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3744CUUAAAAAUUAAUAGUUUU84.97241076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9383762CTTAAAAATTAATAGTTTTAAAACTATTAATTTTTAAG0.160000.043100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3742-3764TACTTAAAAATTAATAGTTTTATAAAACUAUUAAUUUUUAAGUACUUAAAAAUUAAUAGUUUUAUU4.6-9.121


Target Position: 4552, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4552GAUAAUUGUGUAGUAAUGU80.44191781

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4550-4572TTGATAATTGTGTAGTAATGTTTACAUUACUACACAAUUAUCAAGAUAAUUGUGUAGUAAUGUUUU11.6-1.833


Target Position: 452, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452CUAAAUCAUUUGAAGAUAU88.1547677

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
450-472TACTAAATCATTTGAAGATATTCAUAUCUUCAAAUGAUUUAGUACUAAAUCAUUUGAAGAUAUUCU16.08.932


Target Position: 4685, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4685CUUUCUUUCUAAAGAAAGA85.5837989

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4683-4705AACTTTCTTTCTAAAGAAAGATAUCUUUCUUUAGAAAGAAAGUUCUUUCUUUCUAAAGAAAGAUAU10.35.522


Target Position: 682, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682CGAAAACAUAAAGAAAAGA83.09571351

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
680-702TTCGAAAACATAAAGAAAAGATGUCUUUUCUUUAUGUUUUCGAACGAAAACAUAAAGAAAAGAUGU10.314.922


Target Position: 3606, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3606GAUUAUAUUGUUUUUUUAU90.7091439

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3604-3626TTGATTATATTGTTTTTTTATTTAUAAAAAAACAAUAUAAUCAAGAUUAUAUUGUUUUUUUAUUUU-9.1-8.622


Target Position: 729, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729GAAGUCAAAGACAAAGUGU81.10021673

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
727-749AAGAAGTCAAAGACAAAGTGTGTACACUUUGUCUUUGACUUCUUGAAGUCAAAGACAAAGUGUGUU16.719.212


Target Position: 995, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
995CUGAAUACCUAAGAUUUCU77.75622210

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
993-1015AACTGAATACCTAAGATTTCTGTAGAAAUCUUAGGUAUUCAGUUCUGAAUACCUAAGAUUUCUGUU14.816.123


Target Position: 4176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4176ACAUAGACUUAGGCAUUAA91.6091363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5764194ACATAGACTTAGGCATTAATTAATGCCTAAGTCTATGT0.512600.094700.672400.750001.000001.00000


Target Position: 2438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438GCUCAGCACAAUCUGUAAA90.1376487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872456GCTCAGCACAATCTGTAAATTTACAGATTGTGCTGAGC0.195400.081600.853401.000000.934800.87500


Target Position: 3551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3551UCUUCGAUCAAGCUACUUU74.4282787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9863569TCTTCGATCAAGCTACTTTAAAGTAGCTTGATCGAAGA0.180900.066700.724100.750000.994600.62500


Target Position: 5066, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5066GUACAUUGUGCUUUCUUUU82.15681492

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5064-5086TTGTACATTGTGCTTTCTTTTGTAAAAGAAAGCACAAUGUACAAGUACAUUGUGCUUUCUUUUGUU5.513.522


Target Position: 2762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762UGACCUAAUCACUAAUUUU85.25081035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8832780TGACCTAATCACTAATTTTAAAATTAGTGATTAGGTCA0.171500.064300.724100.750001.000001.00000


Target Position: 704, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
704GCAAAGAUGGUAAAAAGAA91.572365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563722GCAAAGATGGTAAAAAGAATTCTTTTTACCATCTTTGC0.955100.634900.681001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
702-724GAGCAAAGATGGTAAAAAGAAGAUUCUUUUUACCAUCUUUGCUCGCAAAGAUGGUAAAAAGAAGAU5.512.022


Target Position: 3555, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3555CGAUCAAGCUACUUUAUGU95.4513154

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3553-3575TTCGATCAAGCTACTTTATGTAAACAUAAAGUAGCUUGAUCGAACGAUCAAGCUACUUUAUGUAAU3.520.432


Target Position: 5014, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5014GGAAUGUAUUUUAACUAUU90.7239438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9445032GGAATGTATTTTAACTATTAATAGTTAAAATACATTCC0.258000.031900.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5012-5034CTGGAATGTATTTTAACTATTTTAAUAGUUAAAAUACAUUCCAGGGAAUGUAUUUUAACUAUUUUU6.316.122


Target Position: 5710, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5710GUAAUGACUCCAUACAUAU91.1579400

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5708-5730AAGTAATGACTCCATACATATTAAUAUGUAUGGAGUCAUUACUUGUAAUGACUCCAUACAUAUUAU8.216.1


Target Position: 3649, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3649GACAAUUACUGUACACAUU90.7763430

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3647-3669AGGACAATTACTGTACACATTAAAAUGUGUACAGUAAUUGUCCUGACAAUUACUGUACACAUUAAU20.46.923


Target Position: 4056, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4056CAAAAGAUUUGUUUUUGUA94.9552172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4054-4076AACAAAAGATTTGTTTTTGTAGAUACAAAAACAAAUCUUUUGUUCAAAAGAUUUGUUUUUGUAGAU5.65.322


Target Position: 5483, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5483CUUAAAACCAUAUUUAGAA89.8273512

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5481-5503AACTTAAAACCATATTTAGAAGTUUCUAAAUAUGGUUUUAAGUUCUUAAAACCAUAUUUAGAAGUU6.90.0


Target Position: 2030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2030AGACAUUAAUUUUUUUUUU79.81431875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472048AGACATTAATTTTTTTTTTAAAAAAAAAATTAATGTCT0.357000.047800.724100.750001.000001.00000


Target Position: 4427, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4427CAUUGAUUUUUUUUUUCUU85.7424973

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4425-4447TCCATTGATTTTTTTTTTCTTCTAAGAAAAAAAAAAUCAAUGGACAUUGAUUUUUUUUUUCUUCUU5.57.201


Target Position: 5623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5623GCAGCAGCAACAUUAAUAA96.1045130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7665641GCAGCAGCAACATTAATAATTATTAATGTTGCTGCTGC0.270800.045200.819001.000001.000001.00000


Target Position: 4168, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4168GCUAAAUUACAUAGACUUA97.978378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8044186GCTAAATTACATAGACTTATAAGTCTATGTAATTTAGC0.189100.151500.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4166-4188AAGCTAAATTACATAGACTTAGGUAAGUCUAUGUAAUUUAGCUUGCUAAAUUACAUAGACUUAGGU18.9-4.323


Target Position: 4426, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4426CCAUUGAUUUUUUUUUUCU78.69992053

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4424-4446TTCCATTGATTTTTTTTTTCTTCAGAAAAAAAAAAUCAAUGGAACCAUUGAUUUUUUUUUUCUUCU0.713.601


Target Position: 3629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3629CAUAACUGUGAUUCUUUUA90.0663494

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3627-3649GGCATAACTGTGATTCTTTTAGGUAAAAGAAUCACAGUUAUGCCCAUAACUGUGAUUCUUUUAGGU5.511.622


Target Position: 4407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4407AGUUCAUCUCAUUUGUAUU87.3513765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4384425AGTTCATCTCATTTGTATTAATACAAATGAGATGAACT0.443000.136000.698300.750001.000001.00000


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144UCCAUAUUUAAUAAUGCUU68.09143837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6132162TCCATATTTAATAATGCTTAAGCATTATTAAATATGGA0.235800.130600.732800.750001.000001.00000


Target Position: 875, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875GACUGUUAGCUUUUACCUU87.2243785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
931893GACTGTTAGCTTTTACCTTAAGGTAAAAGCTAACAGTC0.160200.073900.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
873-895CAGACTGTTAGCTTTTACCTTAAAAGGUAAAAGCUAACAGUCUGGACUGUUAGCUUUUACCUUAAU18.619.022


Target Position: 619, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
619GAAACAUCAGCAAAGACAA97.2257106

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
617-639TTGAAACATCAGCAAAGACAAGAUUGUCUUUGCUGAUGUUUCAAGAAACAUCAGCAAAGACAAGAU19.214.822


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844GCAUUACCUAAUUUUUUUC71.06233366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
681862GCATTACCTAATTTTTTTCGAAAAAAATTAGGTAATGC0.475900.248300.681000.750001.000001.00000


Target Position: 3016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3016CAUGAAGCUUACUUUUUUU89.0301587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7513034CATGAAGCTTACTTTTTTTAAAAAAAGTAAGCTTCATG0.711400.105800.655200.750001.000001.00000


Target Position: 4344, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4344CACAAUUUUGUCCUAAUAU84.54231143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5684362CACAATTTTGTCCTAATATATATTAGGACAAAATTGTG0.477100.070700.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4342-4364TGCACAATTTTGTCCTAATATATAUAUUAGGACAAAAUUGUGCACACAAUUUUGUCCUAAUAUAUU12.35.332


Target Position: 1587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587CAUAGGAAUUAAAUGUAGU86.794831

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1585-1607CTCATAGGAATTAAATGTAGTCTACUACAUUUAAUUCCUAUGAGCAUAGGAAUUAAAUGUAGUCUU11.619.932


Target Position: 673, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673CGAGAAAUUCGAAAACAUA99.705350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
848691CGAGAAATTCGAAAACATATATGTTTTCGAATTTCTCG0.239100.038800.750001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
671-693TTCGAGAAATTCGAAAACATAAAUAUGUUUUCGAAUUUCUCGAACGAGAAAUUCGAAAACAUAAAU5.314.822


Target Position: 4100, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4100GAAAUAAAUGUUACCUAAU90.0487497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7034118GAAATAAATGTTACCTAATATTAGGTAACATTTATTTC0.531500.204600.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4098-4120TAGAAATAAATGTTACCTAATTAAUUAGGUAACAUUUAUUUCUAGAAAUAAAUGUUACCUAAUUAU19.8-9.711


Target Position: 4724, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4724GAAUAGUCAUAACUAGAUU95.3196156

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4722-4744AAGAATAGTCATAACTAGATTAAAAUCUAGUUAUGACUAUUCUUGAAUAGUCAUAACUAGAUUAAU18.914.532


Target Position: 744, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744GUGUGUAAUUAUGUAAAUA97.593891

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
742-764AAGTGTGTAATTATGTAAATACAUAUUUACAUAAUUACACACUUGUGUGUAAUUAUGUAAAUACAU6.920.432


Target Position: 1715, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715CAGUUAUAGCUUAUUAGGU83.93151220

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1713-1735GCCAGTTATAGCTTATTAGGTGTACCUAAUAAGCUAUAACUGGCCAGUUAUAGCUUAUUAGGUGUU12.36.323


Target Position: 3980, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3980CUUGAAUUUUUGAUGUAGA87.3192768

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3978-4000CTCTTGAATTTTTGATGTAGATGUCUACAUCAAAAAUUCAAGAGCUUGAAUUUUUGAUGUAGAUGU20.37.422


Target Position: 4848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4848GCCCAUCUCUCCCCCCACA77.96272181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7034866GCCCATCTCTCCCCCCACATGTGGGGGGAGAGATGGGC0.387600.126800.793100.750001.000001.00000


Target Position: 4731, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4731CAUAACUAGAUUAAGAUCU78.09762152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4729-4751GTCATAACTAGATTAAGATCTGTAGAUCUUAAUCUAGUUAUGACCAUAACUAGAUUAAGAUCUGUU16.06.332


Target Position: 604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
604GGAAUUCCUUUUAUUGAAA93.3137246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
286622GGAATTCCTTTTATTGAAATTTCAATAAAAGGAATTCC0.401900.133800.870701.000001.000001.00000


Target Position: 1941, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1941CUUUUGUUUCUUAAGAAAA85.5906988

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1939-1961TGCTTTTGTTTCTTAAGAAAACAUUUUCUUAAGAAACAAAAGCACUUUUGUUUCUUAAGAAAACAU7.15.612


Target Position: 5195, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5195CUUUUAAAUGUUUAUAGGA82.89861378

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5193-5215AACTTTTAAATGTTTATAGGAGTUCCUAUAAACAUUUAAAAGUUCUUUUAAAUGUUUAUAGGAGUU12.3-9.123


Target Position: 2626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2626UGUAAUUCCCCUAACCAUA81.7181566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6962644TGTAATTCCCCTAACCATATATGGTTAGGGGAATTACA0.655200.127800.663800.750001.000001.00000


Target Position: 952, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952CAGAGUUUUGGUUUUUGAA91.0149409

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
950-972CCCAGAGTTTTGGTTTTTGAACTUUCAAAAACCAAAACUCUGGGCAGAGUUUUGGUUUUUGAACUU7.717.712


Target Position: 588, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588CUUAGCAAGAAGUUAUGGA78.37582109

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
586-608GACTTAGCAAGAAGTTATGGAATUCCAUAACUUCUUGCUAAGUCCUUAGCAAGAAGUUAUGGAAUU20.019.722


Target Position: 1132, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1132GUCACAUAAAUGGAUUAAU80.37931794

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1130-1152TAGTCACATAAATGGATTAATTAAUUAAUCCAUUUAUGUGACUAGUCACAUAAAUGGAUUAAUUAU15.521.533


Target Position: 5547, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5547CAUUAUUUAUUUAUUUCCU81.63171583

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5545-5567AACATTATTTATTTATTTCCTTTAGGAAAUAAAUAAAUAAUGUUCAUUAUUUAUUUAUUUCCUUUU15.5-10.3


Target Position: 5719, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5719CCAUACAUAUUAUUUAUUU88.662625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5015737CCATACATATTATTTATTTAAATAAATAATATGTATGG0.267100.245400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5717-5739CTCCATACATATTATTTATTTCTAAAUAAAUAAUAUGUAUGGAGCCAUACAUAUUAUUUAUUUCUU-10.313.3


Target Position: 4280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4280AGUCACACUGCAUAGGAAU79.22341970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8224298AGTCACACTGCATAGGAATATTCCTATGCAGTGTGACT0.257400.041000.698300.750001.000001.00000


Target Position: 1966, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1966CUUUUUUAAAAAUUACUUU76.2772485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621984CTTTTTTAAAAATTACTTTAAAGTAATTTTTAAAAAAG0.197500.056700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1964-1986CTCTTTTTTAAAAATTACTTTTAAAAGUAAUUUUUAAAAAAGAGCUUUUUUAAAAAUUACUUUUAU4.6-9.111


Target Position: 2442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2442AGCACAAUCUGUAAAUUUU85.7158978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6442460AGCACAATCTGTAAATTTTAAAATTTACAGATTGTGCT0.342400.118900.853400.750001.000001.00000


Target Position: 3596, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3596GAAUAAACUUGAUUAUAUU100.15944

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3594-3616AGGAATAAACTTGATTATATTGTAAUAUAAUCAAGUUUAUUCCUGAAUAAACUUGAUUAUAUUGUU-8.6-0.332


Target Position: 5308, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5308CUAUGAGUGUGUAUUUAUU92.2461318

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5306-5328GACTATGAGTGTGTATTTATTCAAAUAAAUACACACUCAUAGUCCUAUGAGUGUGUAUUUAUUCAU-8.020.3


Target Position: 4549, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4549CUUGAUAAUUGUGUAGUAA92.325306

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4547-4569TTCTTGATAATTGTGTAGTAATGUUACUACACAAUUAUCAAGAACUUGAUAAUUGUGUAGUAAUGU20.28.932


Target Position: 462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462UGAAGAUAUUCACCAUUAU84.83721101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522480TGAAGATATTCACCATTATATAATGGTGAATATCTTCA0.326100.083100.681000.750001.000001.00000


Target Position: 3018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3018UGAAGCUUACUUUUUUUUU68.59913748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7523036TGAAGCTTACTTTTTTTTTAAAAAAAAAGTAAGCTTCA0.628100.134500.724100.750001.000001.00000


Target Position: 838, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838GUUUUAGCAUUACCUAAUU82.15911490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
954856GTTTTAGCATTACCTAATTAATTAGGTAATGCTAAAAC0.272500.088200.637900.750000.923900.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
836-858TTGTTTTAGCATTACCTAATTTTAAUUAGGUAAUGCUAAAACAAGUUUUAGCAUUACCUAAUUUUU18.513.722


Target Position: 1427, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1427CACAUUAGAUAAAUUACUA100.54235

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1425-1447TTCACATTAGATAAATTACTATAUAGUAAUUUAUCUAAUGUGAACACAUUAGAUAAAUUACUAUAU4.611.621


Target Position: 3421, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3421GUCUGUAAUAUCUUACUAA100.72433

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3419-3441TGGTCTGTAATATCTTACTAAGGUUAGUAAGAUAUUACAGACCAGUCUGUAAUAUCUUACUAAGGU11.320.332


Target Position: 4345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4345ACAAUUUUGUCCUAAUAUA90.8421424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8344363ACAATTTTGTCCTAATATATATATTAGGACAAAATTGT0.481600.086000.663800.750001.000001.00000


Target Position: 5716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5716ACUCCAUACAUAUUAUUUA91.7706358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8395734ACTCCATACATATTATTTATAAATAATATGTATGGAGT0.321600.286400.672400.750001.000001.00000


Target Position: 4940, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4940GAAAAUACUUUUGCAUUUU80.55961759

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4938-4960TTGAAAATACTTTTGCATTTTTCAAAAUGCAAAAGUAUUUUCAAGAAAAUACUUUUGCAUUUUUCU20.0-0.322


Target Position: 5348, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5348CCCGAAAUGGAUAUGGAAU78.27242126

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5346-5368GCCCCGAAATGGATATGGAATACAUUCCAUAUCCAUUUCGGGGCCCCGAAAUGGAUAUGGAAUACU21.220.7


Target Position: 3182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3182UCAACUAAUUUUUGUAUUU74.25142817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4733200TCAACTAATTTTTGTATTTAAATACAAAAATTAGTTGA0.705100.085400.724100.750001.000001.00000


Target Position: 4411, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4411CAUCUCAUUUGUAUUCCAU88.0403700

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4409-4431TTCATCTCATTTGTATTCCATTGAUGGAAUACAAAUGAGAUGAACAUCUCAUUUGUAUUCCAUUGU21.220.422


Target Position: 311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
311ACAGGAAGCAAGUAGUAAU86.4342886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
950329ACAGGAAGCAAGTAGTAATATTACTACTTGCTTCCTGT0.214300.031400.698300.750001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414GCCAUUUCCUUUUCACAUU78.05472163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631432GCCATTTCCTTTTCACATTAATGTGAAAAGGAAATGGC0.519800.037100.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1412-1434AGGCCATTTCCTTTTCACATTAGAAUGUGAAAAGGAAAUGGCCUGCCAUUUCCUUUUCACAUUAGU20.520.122


Target Position: 4592, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4592CUUAAAGCUGAAUUUAUAU84.76931110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4590-4612ACCTTAAAGCTGAATTTATATTTAUAUAAAUUCAGCUUUAAGGUCUUAAAGCUGAAUUUAUAUUUU-8.013.722


Target Position: 1334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1334ACUCUCCCCAAAAUAUUAU71.47623286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6971352ACTCTCCCCAAAATATTATATAATATTTTGGGGAGAGT0.680800.488500.663800.750001.000001.00000


Target Position: 3558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3558UCAAGCUACUUUAUGUAAA81.46951608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8683576TCAAGCTACTTTATGTAAATTTACATAAAGTAGCTTGA0.176300.084700.724100.750000.994600.62500


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179ACAAUCCUUUUGAUAAAUU74.94992716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302197ACAATCCTTTTGATAAATTAATTTATCAAAAGGATTGT0.208100.145400.698300.750001.000001.00000


Target Position: 971, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
971CUAGCAAUGCCUGUGAAAA86.7941830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
780989CTAGCAATGCCTGTGAAAATTTTCACAGGCATTGCTAG0.197000.077000.672400.750000.967400.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
969-991AACTAGCAATGCCTGTGAAAAAGUUUUCACAGGCAUUGCUAGUUCUAGCAAUGCCUGUGAAAAAGU20.519.723


Target Position: 5262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5262UGUACUACUCCUAAUUAUU81.43491612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7355280TGTACTACTCCTAATTATTAATAATTAGGAGTAGTACA0.206700.108400.698300.750001.000001.00000


Target Position: 2879, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2879GUGGAAGGAGAAUUUAAUA93.5842231

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5287919GTGGAAGGAGAATTTAATA1/1/0/097.75KRASNM_033360.2+NM_004985.31+1NANANA12:25360591..25360609(-)00KRAS(0.002)


Target Position: 5281, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5281GUAAUGUAAUAAAAAUAGU83.07981353

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5279-5301TTGTAATGTAATAAAAATAGTTAACUAUUUUUAUUACAUUACAAGUAAUGUAAUAAAAAUAGUUAU-4.38.522


Target Position: 4144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4144CUUGUUGAAGUUUUUUUAA83.63661266

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4142-4164TCCTTGTTGAAGTTTTTTTAAAAUUAAAAAAACUUCAACAAGGACUUGUUGAAGUUUUUUUAAAAU-9.120.521


Target Position: 2514, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514GUGAAGUUUAUAUUUGAAU80.35581800

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2512-2534AGGTGAAGTTTATATTTGAATATAUUCAAAUAUAAACUUCACCUGUGAAGUUUAUAUUUGAAUAUU7.419.222


Target Position: 3758, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3758GUUUUAUCUGGGUACAAAU87.2759776

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8375819GTTTTATCTGGGTACAAAT1/1/0/097.75KRASNM_033360.2+NM_004985.31+1NANANANA00KRAS(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3756-3778TAGTTTTATCTGGGTACAAATAAAUUUGUACCCAGAUAAAACUAGUUUUAUCUGGGUACAAAUAAU14.72.122


Target Position: 1620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1620CUGCUCUUUCAUAGUAUAA88.1204679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9641638CTGCTCTTTCATAGTATAATTATACTATGAAAGAGCAG0.498700.056300.750000.750001.000001.00000


Target Position: 3183, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3183CAACUAAUUUUUGUAUUUU84.8541097

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3181-3203CTCAACTAATTTTTGTATTTTTAAAAAUACAAAAAUUAGUUGAGCAACUAAUUUUUGUAUUUUUAU6.94.600


Target Position: 3713, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3713CAGUUUUCUCUGCAUAAGU80.14371834

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3711-3733TCCAGTTTTCTCTGCATAAGTAAACUUAUGCAGAGAAAACUGGACAGUUUUCUCUGCAUAAGUAAU19.713.323


Target Position: 3812, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3812CUUCUAUGUAAAAAUCACU80.51241769

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3810-3832AACTTCTATGTAAAAATCACTATAGUGAUUUUUACAUAGAAGUUCUUCUAUGUAAAAAUCACUAUU14.813.433


Target Position: 3552, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3552CUUCGAUCAAGCUACUUUA92.4829299

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6355219CTTCGATCAAGCTACTTTA1/1/0/097.75KRASNM_033360.2+NM_004985.31+1NANANA12:25359918..25359936(-)00KRAS(0.002)


Target Position: 4153, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4153GUUUUUUUAAAAAAAGCUA81.67151576

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4151-4173AAGTTTTTTTAAAAAAAGCTAAAUAGCUUUUUUUAAAAAAACUUGUUUUUUUAAAAAAAGCUAAAU17.0-11.311


Target Position: 2885, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2885GGAGAAUUUAAUAAAGAUA99.572652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7982903GGAGAATTTAATAAAGATATATCTTTATTAAATTCTCC0.190800.133700.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2883-2905AAGGAGAATTTAATAAAGATAGTUAUCUUUAUUAAAUUCUCCUUGGAGAAUUUAAUAAAGAUAGUU6.914.822


Target Position: 2033, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2033CAUUAAUUUUUUUUUUAAA94.133209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372051CATTAATTTTTTTTTTAAATTTAAAAAAAAAATTAATG0.345100.075100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2031-2053GACATTAATTTTTTTTTTAAACAUUUAAAAAAAAAAUUAAUGUCCAUUAAUUUUUUUUUUAAACAU-9.1-10.321


Target Position: 5718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5718UCCAUACAUAUUAUUUAUU71.90213215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4395736TCCATACATATTATTTATTAATAAATAATATGTATGGA0.288000.265000.862100.750001.000001.00000


Target Position: 4533, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4533CAAAAAGUAAUGAUUUCUU83.96511211

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4531-4553GTCAAAAAGTAATGATTTCTTGAAAGAAAUCAUUACUUUUUGACCAAAAAGUAAUGAUUUCUUGAU14.83.222


Target Position: 1639, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639CUUUAAAUCUUUUCUUCAA92.2534316

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1637-1659AACTTTAAATCTTTTCTTCAACTUUGAAGAAAAGAUUUAAAGUUCUUUAAAUCUUUUCUUCAACUU20.4-9.722


Target Position: 3301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3301UCAUUUAUUCAGCAAAUAU80.47681776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7903319TCATTTATTCAGCAAATATATATTTGCTGAATAAATGA0.249700.156600.681000.750001.000001.00000


Target Position: 596, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596GAAGUUAUGGAAUUCCUUU86.812828

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
594-616AAGAAGTTATGGAATTCCTTTTAAAAGGAAUUCCAUAACUUCUUGAAGUUAUGGAAUUCCUUUUAU18.74.632


Target Position: 3474, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3474CGUAUUUUAGUUUUGCAAA88.2888663

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3472-3494TGCGTATTTTAGTTTTGCAAAGAUUUGCAAAACUAAAAUACGCACGUAUUUUAGUUUUGCAAAGAU20.0-0.332


Target Position: 4739, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4739GAUUAAGAUCUGUGUUUUA101.18929

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4737-4759TAGATTAAGATCTGTGTTTTAGTUAAAACACAGAUCUUAAUCUAGAUUAAGAUCUGUGUUUUAGUU13.36.922


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878UGUUAGCUUUUACCUUAAA82.78941393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
959896TGTTAGCTTTTACCTTAAATTTAAGGTAAAAGCTAACA0.157100.039200.706900.750001.000001.00000


Target Position: 740, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740CAAAGUGUGUAAUUAUGUA101.32727

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
738-760GACAAAGTGTGTAATTATGTAAAUACAUAAUUACACACUUUGUCCAAAGUGUGUAAUUAUGUAAAU6.717.832


Target Position: 2058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2058AGUGAAAAAGUUUUACAAU84.13711193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932076AGTGAAAAAGTTTTACAATATTGTAAAACTTTTTCACT0.282300.036500.698300.750001.000001.00000


Target Position: 603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
603UGGAAUUCCUUUUAUUGAA82.76831397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
615621TGGAATTCCTTTTATTGAATTCAATAAAAGGAATTCCA0.404900.131200.672400.750000.962000.75000


Target Position: 472, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472CACCAUUAUAGAGAACAAA90.238475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
267490CACCATTATAGAGAACAAATTTGTTCTCTATAATGGTG0.429100.318900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
470-492TTCACCATTATAGAGAACAAATTUUUGUUCUCUAUAAUGGUGAACACCAUUAUAGAGAACAAAUUU19.220.022


Target Position: 2881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2881GGAAGGAGAAUUUAAUAAA98.759964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7112899GGAAGGAGAATTTAATAAATTTATTAAATTCTCCTTCC0.295300.051200.870701.000001.000001.00000


Target Position: 4791, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4791GAUAGGUAAUUUAGAUGAA100.76132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4789-4811ATGATAGGTAATTTAGATGAATTUUCAUCUAAAUUACCUAUCAUGAUAGGUAAUUUAGAUGAAUUU21.419.833


Target Position: 4383, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4383GCAUGUUAAGUUACAGUUU85.526999

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4381-4403GGGCATGTTAAGTTACAGTTTGCAAACUGUAACUUAACAUGCCCGCAUGUUAAGUUACAGUUUGCU19.013.532


Target Position: 5233, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5233CUAAAAUUUGUAAUAUUUU81.52651600

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5231-5253ATCTAAAATTTGTAATATTTTTGAAAAUAUUACAAAUUUUAGAUCUAAAAUUUGUAAUAUUUUUGU-10.3-9.722


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633CCCCUAACCAUAAGAUUUA85.9599938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4032651CCCCTAACCATAAGATTTATAAATCTTATGGTTAGGGG0.305200.251400.956901.000000.934800.62500


Target Position: 5522, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5522CCUUUAUGACAAAAAAAUA95.1212165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4665540CCTTTATGACAAAAAAATATATTTTTTTGTCATAAAGG0.294200.087100.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5520-5542TGCCTTTATGACAAAAAAATAGGUAUUUUUUUGUCAUAAAGGCACCUUUAUGACAAAAAAAUAGGU-12.03.5


Target Position: 4030, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4030CUUUAUGUGAACUUUGAAU81.32191633

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4028-4050ACCTTTATGTGAACTTTGAATGGAUUCAAAGUUCACAUAAAGGUCUUUAUGUGAACUUUGAAUGGU12.26.922


Target Position: 3289, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3289GUUUUGCAGAACUCAUUUA88.6012633

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3287-3309CTGTTTTGCAGAACTCATTTATTUAAAUGAGUUCUGCAAAACAGGUUUUGCAGAACUCAUUUAUUU12.020.022


Target Position: 4710, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4710CAUGAGUUCUUGAAGAAUA98.645966

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4708-4730CACATGAGTTCTTGAAGAATAGTUAUUCUUCAAGAACUCAUGUGCAUGAGUUCUUGAAGAAUAGUU14.819.222


Target Position: 3587, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3587GUUUUAAAGGAAUAAACUU83.67361257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3585-3607TTGTTTTAAAGGAATAAACTTGAAAGUUUAUUCCUUUAAAACAAGUUUUAAAGGAAUAAACUUGAU4.6-9.122


Target Position: 1663, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1663GUCUUUGAAGAUAGUUUUA88.0136704

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1661-1683GAGTCTTTGAAGATAGTTTTAATUAAAACUAUCUUCAAAGACUCGUCUUUGAAGAUAGUUUUAAUU4.920.422


Target Position: 4143, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4143CCUUGUUGAAGUUUUUUUA88.52643

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4141-4163ATCCTTGTTGAAGTTTTTTTAAAUAAAAAAACUUCAACAAGGAUCCUUGUUGAAGUUUUUUUAAAU-11.316.722


Target Position: 2528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2528UGAAUAUCCAUUCUCGUUU70.26383485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562546TGAATATCCATTCTCGTTTAAACGAGAATGGATATTCA0.292900.067800.724100.750000.967400.62500


Target Position: 1964, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1964CUCUUUUUUAAAAAUUACU71.85663227

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1962-1984AACTCTTTTTTAAAAATTACTTTAGUAAUUUUUAAAAAAGAGUUCUCUUUUUUAAAAAUUACUUUU-0.35.521


Target Position: 3563, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3563CUACUUUAUGUAAAUCACU80.37561795

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3561-3583AGCTACTTTATGTAAATCACTTCAGUGAUUUACAUAAAGUAGCUCUACUUUAUGUAAAUCACUUCU14.86.622


Target Position: 4901, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4901CCGAAAGUUUCCAAUUCCA85.0821062

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4899-4921ATCCGAAAGTTTCCAATTCCACTUGGAAUUGGAAACUUUCGGAUCCGAAAGUUUCCAAUUCCACUU20.119.733


Target Position: 1837, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1837CAUGCAUUGGUUAGUCAAA92.683286

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1835-1857GTCATGCATTGGTTAGTCAAAATUUUGACUAACCAAUGCAUGACCAUGCAUUGGUUAGUCAAAAUU20.319.933


Target Position: 1329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1329UGGUCACUCUCCCCAAAAU78.57932074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051347TGGTCACTCTCCCCAAAATATTTTGGGGAGAGTGACCA0.647200.478500.836200.750000.907600.75000


Target Position: 4128, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4128CUUAAAGACAAAAAUCCUU76.9112371

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4126-4148GCCTTAAAGACAAAAATCCTTGTAAGGAUUUUUGUCUUUAAGGCCUUAAAGACAAAAAUCCUUGUU18.77.122


Target Position: 2519, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2519GUUUAUAUUUGAAUAUCCA92.2149320

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2517-2539AAGTTTATATTTGAATATCCATTUGGAUAUUCAAAUAUAAACUUGUUUAUAUUUGAAUAUCCAUUU15.4-8.022


Target Position: 2829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2829GCGACAGUAGGAUUUUUCA90.018502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9632847GCGACAGTAGGATTTTTCATGAAAAATCCTACTGTCGC0.226800.048800.698300.750001.000001.00000


Target Position: 5391, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5391GUAUACCAGUGAAUCUUUU84.06171203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8505409GTATACCAGTGAATCTTTTAAAAGATTCACTGGTATAC0.352500.124300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5389-5411TAGTATACCAGTGAATCTTTTATAAAAGAUUCACUGGUAUACUAGUAUACCAGUGAAUCUUUUAUU5.321.1


Target Position: 4049, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4049GGUUUAACAAAAGAUUUGU76.85072383

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4047-4069ATGGTTTAACAAAAGATTTGTTTACAAAUCUUUUGUUAAACCAUGGUUUAACAAAAGAUUUGUUUU12.08.222


Target Position: 889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
889ACCUUAAAUGCUUAUUUUA85.8782955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
782907ACCTTAAATGCTTATTTTATAAAATAAGCATTTAAGGT0.225400.067600.819000.750001.000001.00000


Target Position: 5175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5175ACUCUUUUAAUUGAAAUUA76.95362365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6505193ACTCTTTTAATTGAAATTATAATTTCAATTAAAAGAGT0.260700.094200.672400.750001.000001.00000


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031GCAUGCAGUUGAUUACUUC80.88741704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231049GCATGCAGTTGATTACTTCGAAGTAATCAACTGCATGC0.374200.126800.681000.750000.994600.87500


Target Position: 2919, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2919CUUAGGUAAUCUAUAACUA97.1668107

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2917-2939TCCTTAGGTAATCTATAACTAGGUAGUUAUAGAUUACCUAAGGACUUAGGUAAUCUAUAACUAGGU6.319.833


Target Position: 4208, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4208GAAUAUAGCAGACGUAUAU93.4209242

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4206-4228AAGAATATAGCAGACGTATATTGAUAUACGUCUGCUAUAUUCUUGAAUAUAGCAGACGUAUAUUGU16.2-2.723


Target Position: 3310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3310CAGCAAAUAUUUAUUGAGU84.48551149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3308-3330TTCAGCAAATATTTATTGAGTGCACUCAAUAAAUAUUUGCUGAACAGCAAAUAUUUAUUGAGUGCU13.418.500


Target Position: 1341, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1341CCAAAAUAUUAUAUUUUUU86.8695823

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1339-1361CCCCAAAATATTATATTTTTTCTAAAAAAUAUAAUAUUUUGGGGCCAAAAUAUUAUAUUUUUUCUU-9.7-1.422


Target Position: 1618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618GACUGCUCUUUCAUAGUAU92.3133308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271636GACTGCTCTTTCATAGTATATACTATGAAAGAGCAGTC0.463500.032900.775900.750001.000001.00000


Target Position: 734, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734CAAAGACAAAGUGUGUAAU83.37011302

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
732-754GTCAAAGACAAAGTGTGTAATTAAUUACACACUUUGUCUUUGACCAAAGACAAAGUGUGUAAUUAU20.419.232


Target Position: 1336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1336UCUCCCCAAAAUAUUAUAU69.35773629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5321354TCTCCCCAAAATATTATATATATAATATTTTGGGGAGA0.330900.265000.681000.750001.000001.00000


Target Position: 5521, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5521GCCUUUAUGACAAAAAAAU80.30071811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4775539GCCTTTATGACAAAAAAATATTTTTTTGTCATAAAGGC0.415200.084800.991401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5519-5541CTGCCTTTATGACAAAAAAATAGAUUUUUUUGUCAUAAAGGCAGGCCUUUAUGACAAAAAAAUAGU-11.310.9


Target Position: 4257, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4257GCAUUCUAGGCUCUAUUUA88.1977673

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4255-4277AGGCATTCTAGGCTCTATTTAACUAAAUAGAGCCUAGAAUGCCUGCAUUCUAGGCUCUAUUUAACU6.913.433


Target Position: 4924, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4924CUUGUGUUUUCAUGUUGAA88.5451639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4922-4944GTCTTGTGTTTTCATGTTGAAAAUUCAACAUGAAAACACAAGACCUUGUGUUUUCAUGUUGAAAAU20.519.322


Target Position: 5724, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5724CAUAUUAUUUAUUUCUAUA102.70817

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5722-5744TACATATTATTTATTTCTATAACUAUAGAAAUAAAUAAUAUGUACAUAUUAUUUAUUUCUAUAACU6.9-8.6


Target Position: 2463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2463ACCUAUGUUACACCAUCUU72.00793197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6772481ACCTATGTTACACCATCTTAAGATGGTGTAACATAGGT0.220600.068900.715500.750000.951100.87500


Target Position: 5531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5531CAAAAAAAUAGGAUAACAU90.579448

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5529-5551GACAAAAAAATAGGATAACATTAAUGUUAUCCUAUUUUUUUGUCCAAAAAAAUAGGAUAACAUUAU16.1-11.3


Target Position: 3536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3536CGAUUCCACUGAAACUCUU84.87421093

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8503554CGATTCCACTGAAACTCTTAAGAGTTTCAGTGGAATCG0.269300.038700.655201.000001.000001.00000


Target Position: 528, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
528CCUAGUAGGAAAUAAAUGU80.77031724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
943546CCTAGTAGGAAATAAATGTACATTTATTTCCTACTAGG0.279000.038300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
526-548GTCCTAGTAGGAAATAAATGTGAACAUUUAUUUCCUACUAGGACCCUAGUAGGAAAUAAAUGUGAU-1.816.102


Target Position: 1036, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036CAGUUGAUUACUUCUUAUU85.39351014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911054CAGTTGATTACTTCTTATTAATAAGAAGTAATCAACTG0.453600.174200.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1034-1056TGCAGTTGATTACTTCTTATTTTAAUAAGAAGUAAUCAACUGCACAGUUGAUUACUUCUUAUUUUU6.919.222


Target Position: 2962, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2962CAUUCCAUUGUUUUAGUAA92.341305

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2960-2982TACATTCCATTGTTTTAGTAACCUUACUAAAACAAUGGAAUGUACAUUCCAUUGUUUUAGUAACCU6.620.121


Target Position: 5426, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5426GUAUCCUUUAUUUCUAAAA87.0828803

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5424-5446AAGTATCCTTTATTTCTAAAAGGUUUUAGAAAUAAAGGAUACUUGUAUCCUUUAUUUCUAAAAGGU7.119.9


Target Position: 657, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657CUUCUAUACAUUAGUUCGA78.5582079

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
655-677GCCTTCTATACATTAGTTCGAGAUCGAACUAAUGUAUAGAAGGCCUUCUAUACAUUAGUUCGAGAU20.98.432


Target Position: 2394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2394UGUAAUUUAUAUUCCAUUU78.3362114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6572412TGTAATTTATATTCCATTTAAATGGAATATAAATTACA0.256900.056600.706900.750001.000001.00000


Target Position: 5149, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5149GGUCAUAUCAAACAUUAAA97.427198

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5147-5169TTGGTCATATCAAACATTAAAAAUUUAAUGUUUGAUAUGACCAAGGUCAUAUCAAACAUUAAAAAU6.916.022


Target Position: 884, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884CUUUUACCUUAAAUGCUUA91.1731397

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
882-904AGCTTTTACCTTAAATGCTTATTUAAGCAUUUAAGGUAAAAGCUCUUUUACCUUAAAUGCUUAUUU18.514.031


Target Position: 3550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3550CUCUUCGAUCAAGCUACUU69.97553542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8533568CTCTTCGATCAAGCTACTTAAGTAGCTTGATCGAAGAG0.179200.066200.672400.750000.994600.75000


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363UCAAACUCUUAGUUUUUUU70.59353439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412381TCAAACTCTTAGTTTTTTTAAAAAAACTAAGAGTTTGA0.292400.162700.724100.750000.956500.75000


Target Position: 5176, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5176CUCUUUUAAUUGAAAUUAA92.3188307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8705194CTCTTTTAATTGAAATTAATTAATTTCAATTAAAAGAG0.202200.077700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5174-5196CACTCTTTTAATTGAAATTAACTUUAAUUUCAAUUAAAAGAGUGCUCUUUUAAUUGAAAUUAACUU2.17.122


Target Position: 3533, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3533CUACGAUUCCACUGAAACU84.41541161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3531-3553TGCTACGATTCCACTGAAACTCTAGUUUCAGUGGAAUCGUAGCACUACGAUUCCACUGAAACUCUU19.216.532


Target Position: 4195, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4195CAUGUUUGUGGAAGAAUAU86.7121844

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4193-4215AACATGTTTGTGGAAGAATATAGAUAUUCUUCCACAAACAUGUUCAUGUUUGUGGAAGAAUAUAGU6.912.112


Target Position: 2027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2027CCAAGACAUUAAUUUUUUU86.6446852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7632045CCAAGACATTAATTTTTTTAAAAAAATTAATGTCTTGG0.342900.045600.844801.000001.000001.00000


Target Position: 3840, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3840GAAUUGCUAUGUGAAACUA96.4599123

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3838-3860CTGAATTGCTATGTGAAACTACAUAGUUUCACAUAGCAAUUCAGGAAUUGCUAUGUGAAACUACAU19.218.522


Target Position: 3808, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3808GAAACUUCUAUGUAAAAAU90.3417464

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3806-3828AGGAAACTTCTATGTAAAAATCAAUUUUUACAUAGAAGUUUCCUGAAACUUCUAUGUAAAAAUCAU0.013.323


Target Position: 5575, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5575GAAGGUAAUUGAUACACAA106.0234

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5573-5595AAGAAGGTAATTGATACACAACAUUGUGUAUCAAUUACCUUCUUGAAGGUAAUUGAUACACAACAU20.418.6


Target Position: 187, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
187CUGAAAAUGACUGAAUAUA86.7023846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760205CTGAAAATGACTGAATATATATATTCAGTCATTTTCAG0.261500.156600.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
185-207TGCTGAAAATGACTGAATATAAAUAUAUUCAGUCAUUUUCAGCACUGAAAAUGACUGAAUAUAAAU8.77.403


Target Position: 1619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619ACUGCUCUUUCAUAGUAUA91.7964357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9341637ACTGCTCTTTCATAGTATATATACTATGAAAGAGCAGT0.497500.043700.663800.750001.000001.00000


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876ACUGUUAGCUUUUACCUUA88.8726605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
918894ACTGTTAGCTTTTACCTTATAAGGTAAAAGCTAACAGT0.166000.061900.672400.750001.000001.00000


Target Position: 599, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
599GUUAUGGAAUUCCUUUUAU82.341460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
597-619AAGTTATGGAATTCCTTTTATTGAUAAAAGGAAUUCCAUAACUUGUUAUGGAAUUCCUUUUAUUGU11.021.222


Target Position: 5622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5622AGCAGCAGCAACAUUAAUA86.6673850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9555640AGCAGCAGCAACATTAATATATTAATGTTGCTGCTGCT0.157400.047800.810300.750000.940200.75000


Target Position: 2697, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2697CAGAAAUGCCCUACAUCUU84.9151084

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2695-2717ATCAGAAATGCCCTACATCTTATAAGAUGUAGGGCAUUUCUGAUCAGAAAUGCCCUACAUCUUAUU20.312.033


Target Position: 4847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4847GGCCCAUCUCUCCCCCCAC63.73844445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4374865GGCCCATCTCTCCCCCCACGTGGGGGGAGAGATGGGCC0.288700.120000.706900.750001.000001.00000


Target Position: 4283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4283CACACUGCAUAGGAAUUUA93.3313244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5564301CACACTGCATAGGAATTTATAAATTCCTATGCAGTGTG0.252800.128100.758600.750001.000001.00000


Target Position: 3911, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3911GUUUCUACACAGAGAAAGA91.5626366

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3909-3931TCGTTTCTACACAGAGAAAGAAAUCUUUCUCUGUGUAGAAACGAGUUUCUACACAGAGAAAGAAAU19.114.622


Target Position: 4661, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4661CUGAAUAGCUGUCAUAAAA94.4993194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4659-4681AACTGAATAGCTGTCATAAAATGUUUUAUGACAGCUAUUCAGUUCUGAAUAGCUGUCAUAAAAUGU8.913.432


Target Position: 2325, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2325CACUUACUAUCCAUUUCUU90.8444423

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2323-2345ATCACTTACTATCCATTTCTTCAAAGAAAUGGAUAGUAAGUGAUCACUUACUAUCCAUUUCUUCAU12.017.622


Target Position: 4601, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4601GAAUUUAUAUUUAGUAACU90.2238478

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4599-4621CTGAATTTATATTTAGTAACTTCAGUUACUAAAUAUAAAUUCAGGAAUUUAUAUUUAGUAACUUCU14.3-10.321


Target Position: 1960, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960CAAACUCUUUUUUAAAAAU86.2715902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9051978CAAACTCTTTTTTAAAAATATTTTTAAAAAAGAGTTTG0.333600.159200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1958-1980AACAAACTCTTTTTTAAAAATTAAUUUUUAAAAAAGAGUUUGUUCAAACUCUUUUUUAAAAAUUAU-9.117.722


Target Position: 2097, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2097CUUAACACUGGUUAAAUUA85.881954

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2095-2117CTCTTAACACTGGTTAAATTAACUAAUUUAACCAGUGUUAAGAGCUUAACACUGGUUAAAUUAACU-9.714.722


Target Position: 4353, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4353GUCCUAAUAUAUACAUAGA96.158128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4351-4373TTGTCCTAATATATACATAGAAAUCUAUGUAUAUAUUAGGACAAGUCCUAAUAUAUACAUAGAAAU13.119.933


Target Position: 3302, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3302CAUUUAUUCAGCAAAUAUU88.7522616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9443320CATTTATTCAGCAAATATTAATATTTGCTGAATAAATG0.283900.159800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3300-3322CTCATTTATTCAGCAAATATTTAAAUAUUUGCUGAAUAAAUGAGCAUUUAUUCAGCAAAUAUUUAU-1.8-10.300


Target Position: 1623, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623CUCUUUCAUAGUAUAACUU81.23181645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6111641CTCTTTCATAGTATAACTTAAGTTATACTATGAAAGAG0.669000.326400.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1621-1643TGCTCTTTCATAGTATAACTTTAAAGUUAUACUAUGAAAGAGCACUCUUUCAUAGUAUAACUUUAU6.320.422


Target Position: 4961, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4961CUUUGAGUGCCAAUUUCUU80.17551830

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4959-4981TCCTTTGAGTGCCAATTTCTTACAAGAAAUUGGCACUCAAAGGACUUUGAGUGCCAAUUUCUUACU5.319.222


Target Position: 4980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4980ACUAGUACUAUUUCUUAAU81.00091690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7514998ACTAGTACTATTTCTTAATATTAAGAAATAGTACTAGT0.203500.109000.698300.750001.000001.00000


Target Position: 4960, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4960CCUUUGAGUGCCAAUUUCU78.96552001

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4958-4980TTCCTTTGAGTGCCAATTTCTTAAGAAAUUGGCACUCAAAGGAACCUUUGAGUGCCAAUUUCUUAU7.416.623


Target Position: 1691, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691GUGACAUUAAAAGAUUAUU79.12681982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9201709GTGACATTAAAAGATTATTAATAATCTTTTAATGTCAC0.217700.050500.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1689-1711TTGTGACATTAAAAGATTATTTGAAUAAUCUUUUAAUGUCACAAGUGACAUUAAAAGAUUAUUUGU6.620.522


Target Position: 3642, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3642CUUUUAGGACAAUUACUGU81.22941646

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3640-3662TTCTTTTAGGACAATTACTGTACACAGUAAUUGUCCUAAAAGAACUUUUAGGACAAUUACUGUACU11.611.012


Target Position: 970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
970ACUAGCAAUGCCUGUGAAA81.76461560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
891988ACTAGCAATGCCTGTGAAATTTCACAGGCATTGCTAGT0.169600.070000.706900.750000.967400.87500


Target Position: 1633, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1633GUAUAACUUUAAAUCUUUU90.038498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6051651GTATAACTTTAAATCTTTTAAAAGATTTAAAGTTATAC0.262000.230800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1631-1653TAGTATAACTTTAAATCTTTTCTAAAAGAUUUAAAGUUAUACUAGUAUAACUUUAAAUCUUUUCUU5.36.322


Target Position: 2052, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2052CAAUGAAGUGAAAAAGUUU91.3782381

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2050-2072AACAATGAAGTGAAAAAGTTTTAAAACUUUUUCACUUCAUUGUUCAAUGAAGUGAAAAAGUUUUAU3.212.022


Target Position: 1936, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1936CAUUGCUUUUGUUUCUUAA93.4281241

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1934-1956AGCATTGCTTTTGTTTCTTAAGAUUAAGAAACAAAAGCAAUGCUCAUUGCUUUUGUUUCUUAAGAU7.118.522


Target Position: 3861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3861GAUCUUUGGAACACUGUUU83.31651311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8033879GATCTTTGGAACACTGTTTAAACAGTGTTCCAAAGATC0.249200.051200.681000.750001.000001.00000


Target Position: 4462, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4462CAAACAGUAUAUAACUUUU93.1284253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9054480CAAACAGTATATAACTTTTAAAAGTTATATACTGTTTG0.166400.108600.646600.750000.994600.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4460-4482TTCAAACAGTATATAACTTTTTTAAAAGUUAUAUACUGUUUGAACAAACAGUAUAUAACUUUUUUU4.917.812


Target Position: 1134, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134CACAUAAAUGGAUUAAUUA97.917481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6831152CACATAAATGGATTAATTATAATTAATCCATTTATGTG0.353000.054000.758600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1132-1154GTCACATAAATGGATTAATTACTUAAUUAAUCCAUUUAUGUGACCACAUAAAUGGAUUAAUUACUU-10.36.922


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367ACUCUUAGUUUUUUUUUUU76.2032499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4852385ACTCTTAGTTTTTTTTTTTAAAAAAAAAAACTAAGAGT0.512500.131400.706900.750001.000001.00000


Target Position: 1170, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1170CUUCUAAUUGGUUUUUACU78.57382076

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1168-1190ACCTTCTAATTGGTTTTTACTGAAGUAAAAACCAAUUAGAAGGUCUUCUAAUUGGUUUUUACUGAU0.06.922


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438UGCCAUAAAUAAUACUAAA91.3126387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434456TGCCATAAATAATACTAAATTTAGTATTATTTATGGCA0.529900.372400.853400.750001.000001.00000


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196UGAGGGAACACAAAUUUAU77.91882189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9791214TGAGGGAACACAAATTTATATAAATTTGTGTTCCCTCA0.322900.029800.681000.750001.000001.00000


Target Position: 1690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1690UGUGACAUUAAAAGAUUAU74.09352842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931708TGTGACATTAAAAGATTATATAATCTTTTAATGTCACA0.256700.076300.663800.750001.000001.00000


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843AGCAUUACCUAAUUUUUUU79.21971971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
345861AGCATTACCTAATTTTTTTAAAAAAATTAGGTAATGCT0.368100.201900.853400.750001.000001.00000


Target Position: 2516, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2516GAAGUUUAUAUUUGAAUAU88.2766666

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2514-2536GTGAAGTTTATATTTGAATATCCAUAUUCAAAUAUAAACUUCACGAAGUUUAUAUUUGAAUAUCCU8.94.923


Target Position: 3978, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3978CUCUUGAAUUUUUGAUGUA89.6724526

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3976-3998GCCTCTTGAATTTTTGATGTAGAUACAUCAAAAAUUCAAGAGGCCUCUUGAAUUUUUGAUGUAGAU20.520.421


Target Position: 4087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4087GGGGAGAAUUCUAGAAAUA98.478369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7864105GGGGAGAATTCTAGAAATATATTTCTAGAATTCTCCCC0.195400.061600.948301.000001.000001.00000


Target Position: 3278, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3278CUCAUAAACCUGUUUUGCA85.8906953

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3276-3298GCCTCATAAACCTGTTTTGCAGAUGCAAAACAGGUUUAUGAGGCCUCAUAAACCUGUUUUGCAGAU21.18.923


Target Position: 1136, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136CAUAAAUGGAUUAAUUACU82.28891466

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1134-1156CACATAAATGGATTAATTACTAAAGUAAUUAAUCCAUUUAUGUGCAUAAAUGGAUUAAUUACUAAU1.4-1.822


Target Position: 5620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5620GUAGCAGCAGCAACAUUAA93.7267226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8455638GTAGCAGCAGCAACATTAATTAATGTTGCTGCTGCTAC0.288400.039100.646600.750000.940200.87500


Target Position: 5629, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5629GCAACAUUAAUAAUGGAAA91.1318401

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5627-5649CAGCAACATTAATAATGGAAATAUUUCCAUUAUUAAUGUUGCUGGCAACAUUAAUAAUGGAAAUAU20.112.1


Target Position: 2107, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2107GUUAAAUUAACAUUGCAUA89.2766565

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2105-2127TGGTTAAATTAACATTGCATAAAUAUGCAAUGUUAAUUUAACCAGUUAAAUUAACAUUGCAUAAAU19.9-9.732


Target Position: 4669, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4669CUGUCAUAAAAUGAAACUU78.30012122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8494687CTGTCATAAAATGAAACTTAAGTTTCATTTTATGACAG0.209700.038700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4667-4689AGCTGTCATAAAATGAAACTTTCAAGUUUCAUUUUAUGACAGCUCUGUCAUAAAAUGAAACUUUCU19.221.532


Target Position: 2185, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2185CUUUUGAUAAAUUUAAAAU80.84411712

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2183-2205TCCTTTTGATAAATTTAAAATGTAUUUUAAAUUUAUCAAAAGGACUUUUGAUAAAUUUAAAAUGUU-9.17.422


Target Position: 2160, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2160CUUUAAAAUAAAAAUAAAA90.432459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9612178CTTTAAAATAAAAATAAAATTTTATTTTTATTTTAAAG0.730700.435200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2158-2180TGCTTTAAAATAAAAATAAAAACUUUUAUUUUUAUUUUAAAGCACUUUAAAAUAAAAAUAAAAACU-9.7-9.110


Target Position: 2880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880UGGAAGGAGAAUUUAAUAA82.47411444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5852898TGGAAGGAGAATTTAATAATTATTAAATTCTCCTTCCA0.494300.066700.810300.750001.000001.00000


Target Position: 3540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3540UCCACUGAAACUCUUCGAU66.80434018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7453558TCCACTGAAACTCTTCGATATCGAAGAGTTTCAGTGGA0.204600.102700.689700.750001.000001.00000


Target Position: 4892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4892GUGUUUUAUCCGAAAGUUU81.08011678

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4890-4912CAGTGTTTTATCCGAAAGTTTCCAAACUUUCGGAUAAAACACUGGUGUUUUAUCCGAAAGUUUCCU13.37.233


Target Position: 3687, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3687CAUAUUGACCCAAAUGUGU77.5522245

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3685-3707TTCATATTGACCCAAATGTGTAAACACAUUUGGGUCAAUAUGAACAUAUUGACCCAAAUGUGUAAU12.18.722


Target Position: 258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258GCUAAUUCAGAAUCAUUUU82.97691370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
256-278CAGCTAATTCAGAATCATTTTGTAAAAUGAUUCUGAAUUAGCUGGCUAAUUCAGAAUCAUUUUGUU7.26.902


Target Position: 314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314GGAAGCAAGUAGUAAUUGA96.2415125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
800332GGAAGCAAGTAGTAATTGATCAATTACTACTTGCTTCC0.198200.066000.646600.750001.000001.00000


Target Position: 4282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4282UCACACUGCAUAGGAAUUU61.82764665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5614300TCACACTGCATAGGAATTTAAATTCCTATGCAGTGTGA0.251100.129500.724100.750001.000001.00000


Target Position: 532, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
532GUAGGAAAUAAAUGUGAUU85.37781016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
812550GTAGGAAATAAATGTGATTAATCACATTTATTTCCTAC0.243500.057500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
530-552TAGTAGGAAATAAATGTGATTTGAAUCACAUUUAUUUCCUACUAGUAGGAAAUAAAUGUGAUUUGU20.519.902


Target Position: 251, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251CGAUACAGCUAAUUCAGAA102.02923

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
249-271GACGATACAGCTAATTCAGAATCUUCUGAAUUAGCUGUAUCGUCCGAUACAGCUAAUUCAGAAUCU20.420.302


Target Position: 5080, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5080CUUUUGUGGGACAUAUGCA83.29161319

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5078-5100TTCTTTTGTGGGACATATGCAGTUGCAUAUGUCCCACAAAAGAACUUUUGUGGGACAUAUGCAGUU21.112.232


Target Position: 5229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5229UGAUCUAAAAUUUGUAAUA86.5735862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9215247TGATCTAAAATTTGTAATATATTACAAATTTTAGATCA0.193400.081200.681000.750001.000001.00000


Target Position: 4927, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4927GUGUUUUCAUGUUGAAAAU84.25671178

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4925-4947TTGTGTTTTCATGTTGAAAATACAUUUUCAACAUGAAAACACAAGUGUUUUCAUGUUGAAAAUACU7.714.922


Target Position: 2368, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368CUCUUAGUUUUUUUUUUUU77.46482266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5292386CTCTTAGTTTTTTTTTTTTAAAAAAAAAAAACTAAGAG0.483600.113200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2366-2388AACTCTTAGTTTTTTTTTTTTACAAAAAAAAAAAACUAAGAGUUCUCUUAGUUUUUUUUUUUUACU-11.318.911


Target Position: 1192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1192ACAUUGAGGGAACACAAAU78.47672096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181210ACATTGAGGGAACACAAATATTTGTGTTCCCTCAATGT0.164100.056700.698300.750001.000001.00000


Target Position: 4112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4112ACCUAAUUAUUACAGCCUU77.1382327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7704130ACCTAATTATTACAGCCTTAAGGCTGTAATAATTAGGT0.616300.410000.715500.750001.000001.00000


Target Position: 1038, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038GUUGAUUACUUCUUAUUUU87.2648780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861056GTTGATTACTTCTTATTTTAAAATAAGAAGTAATCAAC0.259800.065200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1036-1058CAGTTGATTACTTCTTATTTTTCAAAAUAAGAAGUAAUCAACUGGUUGAUUACUUCUUAUUUUUCU-4.38.921


Target Position: 5327, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5327CAUGAAAUUUGAACUGUUU88.0885691

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5325-5347TTCATGAAATTTGAACTGTTTGCAAACAGUUCAAAUUUCAUGAACAUGAAAUUUGAACUGUUUGCU17.87.2


Target Position: 4443, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4443CUUCUAAACAUUUUUUCUU77.31052293

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4441-4463TTCTTCTAAACATTTTTTCTTCAAAGAAAAAAUGUUUAGAAGAACUUCUAAACAUUUUUUCUUCAU5.57.121


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675AGAAAUUCGAAAACAUAAA84.40381164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
659693AGAAATTCGAAAACATAAATTTATGTTTTCGAATTTCT0.592500.056600.724100.750001.000001.00000


Target Position: 4984, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4984GUACUAUUUCUUAAUGUAA96.9747115

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4982-5004TAGTACTATTTCTTAATGTAACAUUACAUUAAGAAAUAGUACUAGUACUAUUUCUUAAUGUAACAU8.56.313


Target Position: 2440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2440UCAGCACAAUCUGUAAAUU74.99872707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952458TCAGCACAATCTGTAAATTAATTTACAGATTGTGCTGA0.192700.083800.715500.750000.934800.62500


Target Position: 4421, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4421GUAUUCCAUUGAUUUUUUU80.41941786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8534439GTATTCCATTGATTTTTTTAAAAAAATCAATGGAATAC0.581000.404500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4419-4441TTGTATTCCATTGATTTTTTTTTAAAAAAAUCAAUGGAAUACAAGUAUUCCAUUGAUUUUUUUUUU-12.021.222


Target Position: 5272, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5272CUAAUUAUUGUAAUGUAAU84.45831152

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5270-5292TCCTAATTATTGTAATGTAATAAAUUACAUUACAAUAAUUAGGACUAAUUAUUGUAAUGUAAUAAU6.9-8.023


Target Position: 2140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2140CUGAUCCAUAUUUAAUAAU77.66232228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672158CTGATCCATATTTAATAATATTATTAAATATGGATCAG0.217300.135100.775900.750001.000001.00000


Target Position: 981, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981CUGUGAAAAAGAAACUGAA93.1152256

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
979-1001GCCTGTGAAAAAGAAACTGAATAUUCAGUUUCUUUUUCACAGGCCUGUGAAAAAGAAACUGAAUAU19.220.512


Target Position: 4715, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4715GUUCUUGAAGAAUAGUCAU84.41681160

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4713-4735GAGTTCTTGAAGAATAGTCATAAAUGACUAUUCUUCAAGAACUCGUUCUUGAAGAAUAGUCAUAAU20.320.422


Target Position: 790, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790CUAGUACAAGUGGUAAUUU80.88511706

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
788-810TACTAGTACAAGTGGTAATTTTTAAAUUACCACUUGUACUAGUACUAGUACAAGUGGUAAUUUUUU13.920.223


Target Position: 4086, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4086GGGGGAGAAUUCUAGAAAU93.4605240

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2408619GGGGGAGAATTCTAGAAAT1/1/0/0100.00KRASNM_033360.2+NM_004985.31+1NANANA12:94158109..94158127(+)|12:25359384..25359402(-)00KRAS(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9154104GGGGGAGAATTCTAGAAATATTTCTAGAATTCTCCCCC0.198500.033900.982801.000001.000001.00000


Target Position: 1684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684UCUGCUUGUGACAUUAAAA85.08361061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9381702TCTGCTTGTGACATTAAAATTTTAATGTCACAAGCAGA0.164200.032100.724100.750001.000001.00000


Target Position: 819, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819CACUAAAUUAUUAGCAUUU84.38371165

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
817-839TACACTAAATTATTAGCATTTGTAAAUGCUAAUAAUUUAGUGUACACUAAAUUAUUAGCAUUUGUU19.74.632


Target Position: 2548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2548AGGACUCUUCUUCCAUAUU77.82362202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7582566AGGACTCTTCTTCCATATTAATATGGAAGAAGAGTCCT0.640200.046200.836200.750000.934800.62500


Target Position: 2145, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145CCAUAUUUAAUAAUGCUUU81.28361639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6382163CCATATTTAATAATGCTTTAAAGCATTATTAAATATGG0.230100.136000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2143-2165ATCCATATTTAATAATGCTTTAAAAAGCAUUAUUAAAUAUGGAUCCAUAUUUAAUAAUGCUUUAAU18.5-1.822


Target Position: 1112, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1112CCUAUUCUGUGUUUUAUCU81.81251547

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1110-1132TCCCTATTCTGTGTTTTATCTAGAGAUAAAACACAGAAUAGGGACCUAUUCUGUGUUUUAUCUAGU2.111.622


Target Position: 5357, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5357GAUAUGGAAUACUUUAUAA105.4735

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5355-5377TGGATATGGAATACTTTATAAGCUUAUAAAGUAUUCCAUAUCCAGAUAUGGAAUACUUUAUAAGCU-2.321.2


Target Position: 4591, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4591CCUUAAAGCUGAAUUUAUA99.579851

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4589-4611TACCTTAAAGCTGAATTTATATTUAUAAAUUCAGCUUUAAGGUACCUUAAAGCUGAAUUUAUAUUU-10.31.312


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521GCUAUAUUUACAUGCUACU81.74841562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8221539GCTATATTTACATGCTACTAGTAGCATGTAAATATAGC0.552300.057000.646600.750001.000001.00000


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837UGUUUUAGCAUUACCUAAU75.42612626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947855TGTTTTAGCATTACCTAATATTAGGTAATGCTAAAACA0.264100.079700.698300.750000.923900.62500


Target Position: 4689, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4689CUUUCUAAAGAAAGAUACU81.04181684

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4687-4709TTCTTTCTAAAGAAAGATACTCAAGUAUCUUUCUUUAGAAAGAACUUUCUAAAGAAAGAUACUCAU14.57.122


Target Position: 5476, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5476GCUUAAACUUAAAACCAUA99.265354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5025494GCTTAAACTTAAAACCATATATGGTTTTAAGTTTAAGC0.272600.080500.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5474-5496TTGCTTAAACTTAAAACCATATTUAUGGUUUUAAGUUUAAGCAAGCUUAAACUUAAAACCAUAUUU18.84.9


Target Position: 2634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634CCCUAACCAUAAGAUUUAC71.94833205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3872652CCCTAACCATAAGATTTACGTAAATCTTATGGTTAGGG0.316600.249100.810300.750000.940200.62500


Target Position: 2138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2138GUCUGAUCCAUAUUUAAUA95.2086162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4952156GTCTGATCCATATTTAATATATTAAATATGGATCAGAC0.464800.174900.775900.750001.000001.00000


Target Position: 713, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713GUAAAAAGAAGAAAAAGAA92.9331272

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
711-733TGGTAAAAAGAAGAAAAAGAAGTUUCUUUUUCUUCUUUUUACCAGUAAAAAGAAGAAAAAGAAGUU5.5-3.811


Target Position: 5469, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5469CGUGUUUGCUUAAACUUAA95.0093169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5467-5489GGCGTGTTTGCTTAAACTTAAAAUUAAGUUUAAGCAAACACGCCCGUGUUUGCUUAAACUUAAAAU4.919.3


Target Position: 1950, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950CUUAAGAAAACAAACUCUU76.10272520

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1948-1970TTCTTAAGAAAACAAACTCTTTTAAGAGUUUGUUUUCUUAAGAACUUAAGAAAACAAACUCUUUUU17.77.121


Target Position: 4511, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4511CUAUCUGAAGAUUUCCAUU85.10681056

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4509-4531AACTATCTGAAGATTTCCATTTGAAUGGAAAUCUUCAGAUAGUUCUAUCUGAAGAUUUCCAUUUGU20.121.422


Target Position: 2374, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374GUUUUUUUUUUUUACAACU75.14432679

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2372-2394TAGTTTTTTTTTTTTACAACTATAGUUGUAAAAAAAAAAAACUAGUUUUUUUUUUUUACAACUAUU14.7-11.310


Target Position: 3730, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3730GUAAUUAAAAUAUACUUAA94.1835207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8693748GTAATTAAAATATACTTAATTAAGTATATTTTAATTAC0.175900.074000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3728-3750AAGTAATTAAAATATACTTAAAAUUAAGUAUAUUUUAAUUACUUGUAAUUAAAAUAUACUUAAAAU6.3-7.522


Target Position: 189, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
189GAAAAUGACUGAAUAUAAA102.87216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
989207GAAAATGACTGAATATAAATTTATATTCAGTCATTTTC0.240500.133100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
187-209CTGAAAATGACTGAATATAAACTUUUAUAUUCAGUCAUUUUCAGGAAAAUGACUGAAUAUAAACUU-8.07.402


Target Position: 4717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4717UCUUGAAGAAUAGUCAUAA84.91471085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9394735TCTTGAAGAATAGTCATAATTATGACTATTCTTCAAGA0.159600.036500.689700.750001.000001.00000


Target Position: 4946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4946ACUUUUGCAUUUUUCCUUU72.51193103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9114964ACTTTTGCATTTTTCCTTTAAAGGAAAAATGCAAAAGT0.164700.073500.706900.750001.000001.00000


Target Position: 3670, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3670GGUGUAUGUCAGAUAUUCA103.95511

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3668-3690AAGGTGTATGTCAGATATTCATAUGAAUAUCUGACAUACACCUUGGUGUAUGUCAGAUAUUCAUAU11.620.423


Target Position: 712, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712GGUAAAAAGAAGAAAAAGA90.8687422

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
710-732ATGGTAAAAAGAAGAAAAAGAAGUCUUUUUCUUCUUUUUACCAUGGUAAAAAGAAGAAAAAGAAGU5.50.011


Target Position: 756, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756GUAAAUACAAUUUGUACUU79.37471952

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
754-776ATGTAAATACAATTTGTACTTTTAAGUACAAAUUGUAUUUACAUGUAAAUACAAUUUGUACUUUUU19.01.422


Target Position: 1652, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1652CUUCAACUUGAGUCUUUGA85.7731967

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1650-1672TTCTTCAACTTGAGTCTTTGAAGUCAAAGACUCAAGUUGAAGAACUUCAACUUGAGUCUUUGAAGU19.219.222


Target Position: 4420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4420UGUAUUCCAUUGAUUUUUU75.15572677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7284438TGTATTCCATTGATTTTTTAAAAAATCAATGGAATACA0.481900.395800.706900.750001.000001.00000


Target Position: 1535, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1535CUACUAAAUUUUUAUAAUA99.110356

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1533-1555TGCTACTAAATTTTTATAATAATUAUUAUAAAAAUUUAGUAGCACUACUAAAUUUUUAUAAUAAUU-8.06.612


Target Position: 482, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482GAGAACAAAUUAAAAGAGU79.52031931

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
480-502TAGAGAACAAATTAAAAGAGTTAACUCUUUUAAUUUGUUCUCUAGAGAACAAAUUAAAAGAGUUAU10.319.212


Target Position: 4343, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4343GCACAAUUUUGUCCUAAUA95.2456160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6174361GCACAATTTTGTCCTAATATATTAGGACAAAATTGTGC0.398400.062200.810301.000000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4341-4363TTGCACAATTTTGTCCTAATATAUAUUAGGACAAAAUUGUGCAAGCACAAUUUUGUCCUAAUAUAU19.912.122


Target Position: 312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312CAGGAAGCAAGUAGUAAUU82.81791390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
900330CAGGAAGCAAGTAGTAATTAATTACTACTTGCTTCCTG0.187400.034900.775900.750001.000001.00000


Target Position: 3473, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3473GCGUAUUUUAGUUUUGCAA87.3578764

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3471-3493ATGCGTATTTTAGTTTTGCAAAGUUGCAAAACUAAAAUACGCAUGCGUAUUUUAGUUUUGCAAAGU20.06.932


Target Position: 2627, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2627GUAAUUCCCCUAACCAUAA87.4933750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7702645GTAATTCCCCTAACCATAATTATGGTTAGGGGAATTAC0.596900.253700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2625-2647TTGTAATTCCCCTAACCATAAGAUUAUGGUUAGGGGAAUUACAAGUAAUUCCCCUAACCAUAAGAU20.015.523


Target Position: 4776, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4776CCUGUUUGGGAUAAUGAUA88.1722676

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4774-4796TGCCTGTTTGGGATAATGATAGGUAUCAUUAUCCCAAACAGGCACCUGUUUGGGAUAAUGAUAGGU8.716.723


Target Position: 2361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2361UCUCAAACUCUUAGUUUUU72.48863111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6162379TCTCAAACTCTTAGTTTTTAAAAACTAAGAGTTTGAGA0.234700.163900.724100.750000.956500.75000


Target Position: 2830, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2830CGACAGUAGGAUUUUUCAA94.4409197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8462848CGACAGTAGGATTTTTCAATTGAAAAATCCTACTGTCG0.275300.043500.646601.000001.000001.00000


Target Position: 4524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4524UCCAUUUGUCAAAAAGUAA78.92342011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9674542TCCATTTGTCAAAAAGTAATTACTTTTTGACAAATGGA0.155400.057900.836200.750001.000001.00000


Target Position: 4099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4099AGAAAUAAAUGUUACCUAA97.3115100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8874117AGAAATAAATGTTACCTAATTAGGTAACATTTATTTCT0.484800.147100.689700.750001.000001.00000


Target Position: 5006, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5006GUUUACCUGGAAUGUAUUU75.87442556

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5004-5026ATGTTTACCTGGAATGTATTTTAAAAUACAUUCCAGGUAAACAUGUUUACCUGGAAUGUAUUUUAU6.718.621


Target Position: 4640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4640CAUGAAUUCUGCAUUGAGA94.8551176

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4638-4660AGCATGAATTCTGCATTGAGAAAUCUCAAUGCAGAAUUCAUGCUCAUGAAUUCUGCAUUGAGAAAU18.17.232


Target Position: 4806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4806UGAAUUUAGGGGAAAAAAA80.29751812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9414824TGAATTTAGGGGAAAAAAATTTTTTTCCCCTAAATTCA0.272000.208100.724100.750001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719AGAAGAAAAAGAAGUCAAA90.9889413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
660737AGAAGAAAAAGAAGTCAAATTTGACTTCTTTTTCTTCT0.224800.226300.724100.750001.000001.00000


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037AGUUGAUUACUUCUUAUUU85.00121071

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501055AGTTGATTACTTCTTATTTAAATAAGAAGTAATCAACT0.355300.101100.706900.750001.000001.00000


Target Position: 475, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
475CAUUAUAGAGAACAAAUUA99.921848

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
473-495ACCATTATAGAGAACAAATTAAAUAAUUUGUUCUCUAUAAUGGUCAUUAUAGAGAACAAAUUAAAU5.3-2.722


Target Position: 699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699GAUGAGCAAAGAUGGUAAA92.177322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536717GATGAGCAAAGATGGTAAATTTACCATCTTTGCTCATC0.662500.530600.681000.750001.000001.00000


Target Position: 2158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2158UGCUUUAAAAUAAAAAUAA81.54781595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122176TGCTTTAAAATAAAAATAATTATTTTTATTTTAAAGCA0.768600.466800.819000.750001.000001.00000


Target Position: 2662, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2662GGAUAUCUCCAUGAAGUUU87.2949771

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2660-2682GTGGATATCTCCATGAAGTTTTCAAACUUCAUGGAGAUAUCCACGGAUAUCUCCAUGAAGUUUUCU19.215.922


Target Position: 5304, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5304GUGACUAUGAGUGUGUAUU79.36381953

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5302-5324CAGTGACTATGAGTGTGTATTTAAAUACACACUCAUAGUCACUGGUGACUAUGAGUGUGUAUUUAU20.420.3


Target Position: 3638, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3638GAUUCUUUUAGGACAAUUA97.295101

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3636-3658GTGATTCTTTTAGGACAATTACTUAAUUGUCCUAAAAGAAUCACGAUUCUUUUAGGACAAUUACUU14.85.332


Target Position: 4561, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4561GUAGUAAUGUUUUUUAGAA97.47695

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4559-4581GTGTAGTAATGTTTTTTAGAACCUUCUAAAAAACAUUACUACACGUAGUAAUGUUUUUUAGAACCU7.16.322


Target Position: 4970, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4970CCAAUUUCUUACUAGUACU85.32531025

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4968-4990TGCCAATTTCTTACTAGTACTATAGUACUAGUAAGAAAUUGGCACCAAUUUCUUACUAGUACUAUU18.87.431


Target Position: 2032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2032ACAUUAAUUUUUUUUUUAA88.9408597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6472050ACATTAATTTTTTTTTTAATTAAAAAAAAAATTAATGT0.349400.058300.672400.750001.000001.00000


Target Position: 1771, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1771GAACCUUUGAGCUUUCAUA95.988135

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1769-1791GTGAACCTTTGAGCTTTCATAGAUAUGAAAGCUCAAAGGUUCACGAACCUUUGAGCUUUCAUAGAU12.017.312


Target Position: 2604, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2604GACUUGAUGCAGUUUUAAU91.8924349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9872622GACTTGATGCAGTTTTAATATTAAAACTGCATCAAGTC0.151800.030400.810300.750000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2602-2624ATGACTTGATGCAGTTTTAATACAUUAAAACUGCAUCAAGUCAUGACUUGAUGCAGUUUUAAUACU0.019.222


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624UCUUUCAUAGUAUAACUUU73.55392929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6731642TCTTTCATAGTATAACTTTAAAGTTATACTATGAAAGA0.527900.299400.724100.750001.000001.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UGUGAAAAAGAAACUGAAU77.50222258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091000TGTGAAAAAGAAACTGAATATTCAGTTTCTTTTTCACA0.187600.058000.698300.750001.000001.00000


Target Position: 4092, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4092GAAUUCUAGAAAUAAAUGU80.34381801

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4090-4112GAGAATTCTAGAAATAAATGTTAACAUUUAUUUCUAGAAUUCUCGAAUUCUAGAAAUAAAUGUUAU-1.86.912


Target Position: 4544, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4544GAUUUCUUGAUAAUUGUGU74.06772849

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4542-4564ATGATTTCTTGATAATTGTGTAGACACAAUUAUCAAGAAAUCAUGAUUUCUUGAUAAUUGUGUAGU12.15.331


Target Position: 4965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4965GAGUGCCAAUUUCUUACUA92.9763264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9414983GAGTGCCAATTTCTTACTATAGTAAGAAATTGGCACTC0.571100.032000.637900.750001.000001.00000


Target Position: 1421, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1421CCUUUUCACAUUAGAUAAA88.0377701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251439CCTTTTCACATTAGATAAATTTATCTAATGTGAAAAGG0.482100.189000.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1419-1441TTCCTTTTCACATTAGATAAATTUUUAUCUAAUGUGAAAAGGAACCUUUUCACAUUAGAUAAAUUU8.412.222


Target Position: 3991, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3991GAUGUAGAUGGGCAUUUUU86.3756891

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3989-4011TTGATGTAGATGGGCATTTTTTTAAAAAUGCCCAUCUACAUCAAGAUGUAGAUGGGCAUUUUUUUU14.020.322


Target Position: 5142, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5142GAAUGUUGGUCAUAUCAAA105.4296

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5140-5162AGGAATGTTGGTCATATCAAACAUUUGAUAUGACCAACAUUCCUGAAUGUUGGUCAUAUCAAACAU8.712.132


Target Position: 4124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4124CAGCCUUAAAGACAAAAAU82.15641493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9574142CAGCCTTAAAGACAAAAATATTTTTGTCTTTAAGGCTG0.198800.133100.775900.750000.923900.75000


Target Position: 5541, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5541GGAUAACAUUAUUUAUUUA107.7672

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5539-5561TAGGATAACATTATTTATTTATTUAAAUAAAUAAUGUUAUCCUAGGAUAACAUUAUUUAUUUAUUU-9.716.1


Target Position: 2663, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2663GAUAUCUCCAUGAAGUUUU80.30331810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9972681GATATCTCCATGAAGTTTTAAAACTTCATGGAGATATC0.187600.042200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2661-2683TGGATATCTCCATGAAGTTTTCCAAAACUUCAUGGAGAUAUCCAGAUAUCUCCAUGAAGUUUUCCU13.315.922


Target Position: 1369, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1369GAAAAAAAUGGAAAAAAAU86.7111845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791387GAAAAAAATGGAAAAAAATATTTTTTTCCATTTTTTTC0.475000.175400.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1367-1389AAGAAAAAAATGGAAAAAAATTAAUUUUUUUCCAUUUUUUUCUUGAAAAAAAUGGAAAAAAAUUAU-11.3-11.311


Target Position: 5386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5386CUAUAGUAUACCAGUGAAU86.2058908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8805404CTATAGTATACCAGTGAATATTCACTGGTATACTATAG0.172000.077000.663800.750001.000001.00000


Target Position: 185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
185UGCUGAAAAUGACUGAAUA91.0004410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
706203TGCTGAAAATGACTGAATATATTCAGTCATTTTCAGCA0.213000.140300.810300.750001.000001.00000


Target Position: 2529, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2529GAAUAUCCAUUCUCGUUUU89.295563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7062547GAATATCCATTCTCGTTTTAAAACGAGAATGGATATTC0.283900.071000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2527-2549TTGAATATCCATTCTCGTTTTAGAAAACGAGAAUGGAUAUUCAAGAAUAUCCAUUCUCGUUUUAGU19.715.433


Target Position: 4220, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4220CGUAUAUUGUAUCAUUUGA92.8694275

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4218-4240GACGTATATTGTATCATTTGAGTUCAAAUGAUACAAUAUACGUCCGUAUAUUGUAUCAUUUGAGUU13.81.123


Target Position: 5141, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5141GGAAUGUUGGUCAUAUCAA97.494194

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5139-5161TAGGAATGTTGGTCATATCAAACUUGAUAUGACCAACAUUCCUAGGAAUGUUGGUCAUAUCAAACU14.914.822


Target Position: 4971, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4971CAAUUUCUUACUAGUACUA93.5679232

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4969-4991GCCAATTTCTTACTAGTACTATTUAGUACUAGUAAGAAAUUGGCCAAUUUCUUACUAGUACUAUUU18.85.322


Target Position: 1113, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113CUAUUCUGUGUUUUAUCUA89.0353585

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1111-1133CCCTATTCTGTGTTTTATCTAGTUAGAUAAAACACAGAAUAGGGCUAUUCUGUGUUUUAUCUAGUU6.913.433


Target Position: 463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
463GAAGAUAUUCACCAUUAUA103.24112

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
461-483TTGAAGATATTCACCATTATAGAUAUAAUGGUGAAUAUCUUCAAGAAGAUAUUCACCAUUAUAGAU12.66.632


Target Position: 4803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4803AGAUGAAUUUAGGGGAAAA91.5236369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3134821AGATGAATTTAGGGGAAAATTTTCCCCTAAATTCATCT0.495700.182900.724100.750001.000001.00000


Target Position: 2106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2106GGUUAAAUUAACAUUGCAU91.288388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9532124GGTTAAATTAACATTGCATATGCAATGTTAATTTAACC0.511700.031400.698301.000001.000001.00000


Target Position: 1534, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1534GCUACUAAAUUUUUAUAAU91.9667342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1532-1554ATGCTACTAAATTTTTATAATAAAUUAUAAAAAUUUAGUAGCAUGCUACUAAAUUUUUAUAAUAAU-7.511.312


Target Position: 2445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2445ACAAUCUGUAAAUUUUUAA81.12471668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6062463ACAATCTGTAAATTTTTAATTAAAAATTTACAGATTGT0.394200.101800.672400.750001.000001.00000


Target Position: 4446, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4446CUAAACAUUUUUUCUUCAA84.64531128

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4444-4466TTCTAAACATTTTTTCTTCAAACUUGAAGAAAAAAUGUUUAGAACUAAACAUUUUUUCUUCAAACU20.46.912


Target Position: 2437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2437AGCUCAGCACAAUCUGUAA93.7364225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9372455AGCTCAGCACAATCTGTAATTACAGATTGTGCTGAGCT0.159700.080000.819000.750000.934800.87500


Target Position: 1625, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625CUUUCAUAGUAUAACUUUA98.816162

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1623-1645CTCTTTCATAGTATAACTTTAAAUAAAGUUAUACUAUGAAAGAGCUUUCAUAGUAUAACUUUAAAU4.98.923


Target Position: 3000, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000GAAAAAUACUUUAAUUCAU92.0367337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2998-3020ATGAAAAATACTTTAATTCATGAAUGAAUUAAAGUAUUUUUCAUGAAAAAUACUUUAAUUCAUGAU8.9-9.722


Target Position: 560, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560GAACAGUAGACACAAAACA91.2456392

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
558-580TAGAACAGTAGACACAAAACAGGUGUUUUGUGUCUACUGUUCUAGAACAGUAGACACAAAACAGGU13.319.012


Target Position: 4258, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4258CAUUCUAGGCUCUAUUUAA102.58719

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4256-4278GGCATTCTAGGCTCTATTTAACTUUAAAUAGAGCCUAGAAUGCCCAUUCUAGGCUCUAUUUAACUU-2.311.633


Target Position: 1511, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1511CCAUUUUGGGGCUAUAUUU81.0731680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1509-1531AACCATTTTGGGGCTATATTTACAAAUAUAGCCCCAAAAUGGUUCCAUUUUGGGGCUAUAUUUACU-2.74.232


Target Position: 4987, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4987CUAUUUCUUAAUGUAACAU79.29691961

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4985-5007TACTATTTCTTAATGTAACATGTAUGUUACAUUAAGAAAUAGUACUAUUUCUUAAUGUAACAUGUU20.46.922


Target Position: 4089, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4089GGAGAAUUCUAGAAAUAAA108.1411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6694107GGAGAATTCTAGAAATAAATTTATTTCTAGAATTCTCC0.222500.088000.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4087-4109GGGGAGAATTCTAGAAATAAATGUUUAUUUCUAGAAUUCUCCCCGGAGAAUUCUAGAAAUAAAUGU2.114.832


Target Position: 3541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3541CCACUGAAACUCUUCGAUC73.75562907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7393559CCACTGAAACTCTTCGATCGATCGAAGAGTTTCAGTGG0.206200.102000.663800.750001.000001.00000


Target Position: 5028, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5028CUAUUUUUGUAUAGUGUAA93.643229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
5026-5048AACTATTTTTGTATAGTGTAAACUUACACUAUACAAAAAUAGUUCUAUUUUUGUAUAGUGUAAACU20.2-9.722


Target Position: 4123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4123ACAGCCUUAAAGACAAAAA80.51961767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6844141ACAGCCTTAAAGACAAAAATTTTTGTCTTTAAGGCTGT0.219300.202400.706900.750000.923900.87500


Target Position: 2757, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2757GGAUUUGACCUAAUCACUA98.95559

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2755-2777AGGGATTTGACCTAATCACTAATUAGUGAUUAGGUCAAAUCCCUGGAUUUGACCUAAUCACUAAUU19.216.333


Target Position: 1562, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562GAUUUUAACAAGUAUAAAA100.27740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511580GATTTTAACAAGTATAAAATTTTATACTTGTTAAAATC0.268700.142500.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1560-1582AAGATTTTAACAAGTATAAAAAAUUUUAUACUUGUUAAAAUCUUGAUUUUAACAAGUAUAAAAAAU1.4-9.732


Target Position: 2137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137AGUCUGAUCCAUAUUUAAU87.5117749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302155AGTCTGATCCATATTTAATATTAAATATGGATCAGACT0.344000.171700.698300.750001.000001.00000