siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 1   31   32   59   60   61   67   68   70   71   72   73   76   77   78   79   80   81   97   99  
100   101   102   104   105   112   122   123   124   128   181   184   193   194   195   199   200   213   214   215  
219   220   221   222   240   242   252   253   254   255   256   258   259   260   261   262   263   264   273   274  
318   319   320   351   352   360   362   379   451   452   453   502   547   644   645   646   654   655   715   716  
717   718   719   751   752   770   771   772   773   774   775   776   777   778   779   780   781   782   783   784  
789   790   819   821   822   824   825   826   827   828   832   833   834   835   836   848   876   877   895   900  
901   922   923   975   976   1025   1038   1047   1048   1049   1051   1052   1089   1099   1100   1101   1102   1103   1104   1105  
1106   1108   1109   1145   1165   1166   1192   1287   1288   1289   1344   1345   1346   1347   1389   1390   1393   1394   1397   1399  
1442   1446   1447   1448   1450   1451   1452   1453   1454   1462   1475   1476   1538   1539   1585   1586   1588   1615   1616   1636  
1637   1638   1639   1640   1641   1642   1643   1644   1645   1719   1720   1721   1723   1759   1767   1768   1803   1969   1970   1971  
1972   1976   1977   1978   2018   2045   2046   2047   2048   2081   2124   2127   2128   2129   2130   2131   2132   2133   2134   2143  
2144   2145   2146   2196   2214   2215   2216   2249   2299   2302   2303   2306   2328   2329   2386   2387   2400   2401   2403   2406  
2407   2408   2409   2413   2414   2415   2419   2420   2426   2427   2433   2434   2435   2436   2437   2438   2439   2440   2445   2466  
2503   2504   2505   2506   2512   2513   2516   2517   2518   2520   2521   2522   2523   2524   2525   2526   2536   2537   2574   2575  
2629   2631   2632   2648   2657   2658   2659   2680   2687   2688   2689   2692   2693   2700   2701   2702   2703   2709   2723   2724  
2728   2729   2739   2740   2760   2761   2762   2765   2766   2816   2817   2818   2819   2820   2821   2825   2833   2834   2840   2841  
2842   2843   2844   2845   2846   2847   2851   2873   2881   2882   2883   2884   2885   2886   2887   2888   2889   2946   2947   2957  
2958   2959   2960   2968   2976   2977   2978   2979   2980   2981   2982   2983   2989   2997   2998   2999   3000   3001   3003   3004  
3005   3006   3007   3008   3009   3026   3027   3028   3029   3092   3093   3094   3095   3096   3097   3105   3106   3107   3108   3109  
3110   3137   3138   3143   3144   3145   3146   3147   3148   3149   3150   3151   3152   3155   3156   3160   3161   3162   3163   3165  
3166   3168   3169   3170   3171   3179   3180   3185   3186   3189   3190   3193   3202   3203   3204   3205   3206   3209   3210   3211  
3212   3213   3224   3230   3231   3245   3246   3250   3251   3252   3253   3254   3255   3256   3257   3289   3315   3316   3339   3363  
3367   3368   3369   3444   3464   3465   3467   3469   3499   3524   3548   3549   3550   3551   3552   3553   3554   3555   3556   3557  
3586   3588   3589   3590   3591   3595   3597   3598   3600   3603   3624   3625   3626   3632   3633   3634   3635   3636   3637   3638  
3639   3640   3642   3647   3648   3658   3659   3662   3663   3667   3668   3669   3671   3672   3673   3674   3702   3703   3704   3734  
3735   3754   3755   3756   3757   3764   3768   3769   3775   3776   3777   3786   3788   3789   3790   3797   3798   3799   3801   3802  
3808   3809   3810   3811   3812   3813   3843   3844   3845   3852   3853   3854   3855   3860   3861   3862   3885   3886   3888   3889  
3894   3895   3896   3898   3900   3901   3902   3903   3904   3905   3906   3907   3909   3924   3925   3926   3930   3931   3935   4031  
4032   4033   4034   4035   4036   4037   4038   4039   4040   4042   4043   4045   4048   4049   4051   4052   4069   4081   4082   4090  
4091   4092   4093   4094   4095   4096   4098   4099   4100   4101   4102   4104   4105   4107   4108   4110   4112   4113  
Biltr, Ernai, Rnaxs, Sidirect 3641   3759   3779  
Biltr, Ernai, Rnaxs 1443   2465   3167   3232   3897  
Biltr, Ernai 888   3592  
Biltr, Rnaxs, Sidirect 182   1722   3098   3099   3599   3601   3758   3763   3778   3899   3908   3910   3927   3929   3936   4041   4044   4050   4097   4103  
4106   4109   4111  
Biltr, Sidirect 712   1489   3602   4065   4071   4073   4084  


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833CACAGGACAGACAGGCUAC75.1833799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522851CACAGGACAGACAGGCTACGTAGCCTGTCTGTCCTGTG0.082600.032200.612100.500001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784AGAUUGUCAACAACACAGA83.7691274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560802AGATTGTCAACAACACAGATCTGTGTTGTTGACAATCT0.090200.024000.500000.500000.983700.75000


Target Position: 3316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3316GCCCCUGCUGUCUCUCUGG61.7822283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813334GCCCCTGCTGTCTCTCTGGCCAGAGAGACAGCAGGGGC0.028400.001500.655200.500001.000001.00000


Target Position: 99, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
99ACCGCAAGAGCUACCAUUC63.13462107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512117ACCGCAAGAGCTACCATTCGAATGGTAGCTCTTGCGGT0.448100.002500.681000.500000.929300.87500


Target Position: 81, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
81CUCUAGCCUCAGUUUAUCA89.864183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
37599CTCTAGCCTCAGTTTATCATGATAAACTGAGGCTAGAG0.603500.115700.586200.500001.000001.00000


Target Position: 1475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475GUACAUGAGCAAGGGGAGU67.45781603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6091493GTACATGAGCAAGGGGAGTACTCCCCTTGCTCATGTAC0.137200.009200.474100.500000.989100.62500


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390CCCAGGUCAUGAAGAAGCU76.5049691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3611408CCCAGGTCATGAAGAAGCTAGCTTCTTCATGACCTGGG0.184900.009000.637900.750001.000001.00000


Target Position: 3907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3907UGUCCUUUUUUUUUUUUUA79.594469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1943925TGTCCTTTTTTTTTTTTTATAAAAAAAAAAAAAGGACA0.944700.902300.672400.750001.000001.00000


Target Position: 3212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3212GGCACCCUUUAACUCAUGA83.3832295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4663230GGCACCCTTTAACTCATGATCATGAGTTAAAGGGTGCC0.050200.013500.775900.750001.000001.00000


Target Position: 3798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3798CCCAAGUCUUCUCCCGUCC54.34433121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5443816CCCAAGTCTTCTCCCGTCCGGACGGGAGAAGACTTGGG0.829300.577000.620700.500000.929300.62500


Target Position: 835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835CAGGACAGACAGGCUACAU82.1887346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476853CAGGACAGACAGGCTACATATGTAGCCTGTCTGTCCTG0.047400.030100.629300.750001.000001.00000


Target Position: 3600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3600UCCAUAUUUAACAUGUAAA81.3243384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4063618TCCATATTTAACATGTAAATTTACATGTTAAATATGGA0.072100.034400.870700.750000.929300.75000


Target Position: 3855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3855CUCAAAUCCCUCUCCAACU74.4858864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4573873CTCAAATCCCTCTCCAACTAGTTGGAGAGGGATTTGAG0.703700.643700.603400.500001.000001.00000


Target Position: 1, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1CAAACAAGUGCGGCCAUUU78.4085552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46419CAAACAAGTGCGGCCATTTAAATGGCCGCACTTGTTTG0.050300.004900.646600.750001.000001.00000


Target Position: 3671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3671CCUCAUCAUAGCAAUAACA90.3375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2733689CCTCATCATAGCAATAACATGTTATTGCTATGATGAGG0.594000.371600.637900.750000.978300.62500


Target Position: 2816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2816UGUCAUCCUCAGGAACCAA82.3611337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4182834TGTCATCCTCAGGAACCAATTGGTTCCTGAGGATGACA0.099100.047300.560300.750000.967401.00000


Target Position: 2419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2419ACUCCUUCCCCACUUCUGU66.32441730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5442437ACTCCTTCCCCACTTCTGTACAGAAGTGGGGAAGGAGT0.073600.065800.500000.500001.000001.00000


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099UCACCUCCCGCACCCAGUU60.68882417

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831117TCACCTCCCGCACCCAGTTAACTGGGTGCGGGAGGTGA0.108700.047100.577600.750000.907600.75000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718UGGCCCUCUAUGACUAUGA72.69981042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
559736TGGCCCTCTATGACTATGATCATAGTCATAGAGGGCCA0.072500.004700.620700.500000.945700.75000


Target Position: 2629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2629GAUGGUGGGUGGGUGGGAU78.8639515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5532647GATGGTGGGTGGGTGGGATATCCCACCCACCCACCATC0.029900.005400.500000.750001.000001.00000


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655CCUCGGACACCGUCACCUC70.37131271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533673CCTCGGACACCGTCACCTCGAGGTGACGGTGTCCGAGG0.089900.002200.534500.750000.923900.87500


Target Position: 3246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3246CCUAAGCGGGGGUGAAAGA75.2449794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3493264CCTAAGCGGGGGTGAAAGATCTTTCACCCCCGCTTAGG0.087600.038400.620700.750000.989100.75000


Target Position: 3894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3894GGUGUCUUAAUACUGUCCU74.6957849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5123912GGTGTCTTAATACTGTCCTAGGACAGTATTAAGACACC0.216300.006000.508600.750001.000001.00000


Target Position: 1976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976GCCCACCUUCGAGUACCUG60.2912464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3531994GCCCACCTTCGAGTACCTGCAGGTACTCGAAGGTGGGC0.086100.067900.715500.750000.956500.62500


Target Position: 3704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3704GGUUCUUGAGCCAGCCAGG67.21361627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6253722GGTTCTTGAGCCAGCCAGGCCTGGCTGGCTCAAGAACC0.012200.012300.508600.500000.994600.75000


Target Position: 3469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3469UGGGUGUGUGGUGGAUUCU63.13082109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5243487TGGGTGTGTGGTGGATTCTAGAATCCACCACACACCCA0.053600.002800.620700.500001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969AGGAGCGGCCCACCUUCGA64.58141930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5611987AGGAGCGGCCCACCTTCGATCGAAGGTGGGCCGCTCCT0.161000.001700.551700.500000.902200.62500


Target Position: 3156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3156CCCCGUACUUUGUCCCGUG67.99251534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5403174CCCCGTACTTTGTCCCGTGCACGGGACAAAGTACGGGG0.030600.024600.698300.750001.000001.00000


Target Position: 848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848CUACAUCCCCAGCAACUAC72.2391083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576866CTACATCCCCAGCAACTACGTAGTTGCTGGGGATGTAG0.591700.019700.491400.500000.994600.62500


Target Position: 2513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2513CCUGCCACCCUGCCCCUUG54.6393090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982531CCTGCCACCCTGCCCCTTGCAAGGGGCAGGGTGGCAGG0.261900.184500.698300.750000.956500.87500


Target Position: 3186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3186CCUGGCCCUGUUCUCCUCC50.71573441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6063204CCTGGCCCTGTTCTCCTCCGGAGGAGAACAGGGCCAGG0.551800.055600.474100.500001.000001.00000


Target Position: 3889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3889UGUAAGGUGUCUUAAUACU76.7013675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5763907TGTAAGGTGTCTTAATACTAGTATTAAGACACCTTACA0.029200.001600.500000.500000.978300.75000


Target Position: 3759, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3759CUAUGAAAUUUCAACUUUU90.148478

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5375919CTATGAAATTTCAACTTTT1/1/0/093.44SRCNM_198291.1+NM_005417.31+1NANANA18:29341230..29341248(-)|20:36033481..36033499(+)00SRC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3253777CTATGAAATTTCAACTTTTAAAAGTTGAAATTTCATAG0.799300.045600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3757-3779GCCTATGAAATTTCAACTTTTCCAAAAGUUGAAAUUUCAUAGGCCUAUGAAAUUUCAACUUUUCCU10.38.922


Target Position: 4052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4052UGUAAAUACUUUGCAUAUU74.6722850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5154070TGTAAATACTTTGCATATTAATATGCAAAGTATTTACA0.036800.012700.698300.750001.000001.00000


Target Position: 112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
112CCAUUCAUCUAGCACAACC69.57911355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
586130CCATTCATCTAGCACAACCGGTTGTGCTAGATGAATGG0.143000.144300.491400.500001.000001.00000


Target Position: 3799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3799CCAAGUCUUCUCCCGUCCA79.8551448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5323817CCAAGTCTTCTCCCGTCCATGGACGGGAGAAGACTTGG0.861700.581600.500000.750000.929300.62500


Target Position: 2299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299CACGCCUCUCCCUGCACUC63.28382090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5962317CACGCCTCTCCCTGCACTCGAGTGCAGGGAGAGGCGTG0.254400.029000.482800.500000.956500.87500


Target Position: 3202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3202UCCCCAAGUCGGCACCCUU65.05241872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3743220TCCCCAAGTCGGCACCCTTAAGGGTGCCGACTTGGGGA0.097300.007800.732800.750000.907600.75000


Target Position: 2386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2386CCUUUUCCAGCCUCAGCCU69.13821399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6192404CCTTTTCCAGCCTCAGCCTAGGCTGAGGCTGGAAAAGG0.013900.003200.500000.750000.951100.62500


Target Position: 2884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2884GGGUCUGAGGAUGCAUUCG67.01521650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4522902GGGTCTGAGGATGCATTCGCGAATGCATCCTCAGACCC0.140700.004100.698300.500001.000001.00000


Target Position: 1977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1977CCCACCUUCGAGUACCUGC56.61332853

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4511995CCCACCTTCGAGTACCTGCGCAGGTACTCGAAGGTGGG0.078400.073000.637900.500000.989100.75000


Target Position: 4031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4031GGGGGGGUAUCCAGAAUUG73.5446956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5174049GGGGGGGTATCCAGAATTGCAATTCTGGATACCCCCCC0.037900.002400.844800.750000.989100.75000


Target Position: 2129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2129CCCCACUCUGCCUGCCUGC48.93993577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5892147CCCCACTCTGCCTGCCTGCGCAGGCAGGCAGAGTGGGG0.086900.030100.637900.500000.940200.75000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826CGCUCAGCACAGGACAGAC76.3963699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354844CGCTCAGCACAGGACAGACGTCTGTCCTGTGCTGAGCG0.342900.031300.603400.750001.000001.00000


Target Position: 3639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3639CCCCAAACAUGUUGUACAU85.1553222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3853657CCCCAAACATGTTGTACATATGTACAACATGTTTGGGG0.078300.029000.836201.000001.000001.00000


Target Position: 4091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4091ACCUCAGAAUCUGAUCAAC69.12541401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4754109ACCTCAGAATCTGATCAACGTTGATCAGATTCTGAGGT0.051600.047100.706900.500000.918500.87500


Target Position: 3926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3926ACAGUGUUUUGUAGAUUUC67.59091587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6223944ACAGTGTTTTGTAGATTTCGAAATCTACAAAACACTGT0.127700.001000.534500.500001.000001.00000


Target Position: 2881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2881AAGGGGUCUGAGGAUGCAU72.32181074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6112899AAGGGGTCTGAGGATGCATATGCATCCTCAGACCCCTT0.118400.002800.482800.500001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462ACAUCGUCACGGAGUACAU83.0385309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6141480ACATCGTCACGGAGTACATATGTACTCCGTGACGATGT0.015200.004000.551700.750001.000001.00000


Target Position: 31, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
31GCUGGCUUCUGCUGUUGAC72.35171072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
61349GCTGGCTTCTGCTGTTGACGTCAACAGCAGAAGCCAGC0.059500.001100.534500.750000.983701.00000


Target Position: 3155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3155UCCCCGUACUUUGUCCCGU53.30473230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4473173TCCCCGTACTTTGTCCCGTACGGGACAAAGTACGGGGA0.157800.131500.594800.500001.000001.00000


Target Position: 451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
451UGGGUAGCAACAAGAGCAA77.7227597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364469TGGGTAGCAACAAGAGCAATTGCTCTTGTTGCTACCCA0.115900.008400.698300.750000.962000.75000


Target Position: 1489, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1489GGAGUUUGCUGGACUUUCU86.7305159

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1487-1509GGGGAGTTTGCTGGACTTTCTCAAGAAAGUCCAGCAAACUCCCCGGAGUUUGCUGGACUUUCUCAU21.519.222


Target Position: 3908, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3908GUCCUUUUUUUUUUUUUAA83.489293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2003926GTCCTTTTTTTTTTTTTAATTAAAAAAAAAAAAAGGAC0.372600.266900.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3906-3928CTGTCCTTTTTTTTTTTTTAACAUUAAAAAAAAAAAAAGGACAGGUCCUUUUUUUUUUUUUAACAU-9.118.700


Target Position: 4090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4090GACCUCAGAAUCUGAUCAA92.717839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4544108GACCTCAGAATCTGATCAATTGATCAGATTCTGAGGTC0.052300.047700.672400.750000.918501.00000


Target Position: 3001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3001GCAGGUGUGGAGAGAGAGG67.69871575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5183019GCAGGTGTGGAGAGAGAGGCCTCTCTCTCCACACCTGC0.044500.005200.508600.500001.000001.00000


Target Position: 2574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2574AGACCCUCUGCCGCUGCUU63.05442120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4042592AGACCCTCTGCCGCTGCTTAAGCAGCGGCAGAGGGTCT0.072500.006800.586200.750000.940200.62500


Target Position: 3003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3003AGGUGUGGAGAGAGAGGCU77.5756603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813021AGGTGTGGAGAGAGAGGCTAGCCTCTCTCTCCACACCT0.026300.002300.491400.500001.000001.00000


Target Position: 3553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3553CCCUGUGUGUGUGUAUGUG73.2899983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3923571CCCTGTGTGTGTGTATGTGCACATACACACACACAGGG0.075900.009600.698300.750001.000001.00000


Target Position: 3860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3860AUCCCUCUCCAACUGCCUA75.9249735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5483878ATCCCTCTCCAACTGCCTATAGGCAGTTGGAGAGGGAT0.086300.079400.508600.500001.000001.00000


Target Position: 3861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3861UCCCUCUCCAACUGCCUAA69.28861384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4993879TCCCTCTCCAACTGCCTAATTAGGCAGTTGGAGAGGGA0.040200.041800.836200.750001.000001.00000


Target Position: 2883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2883GGGGUCUGAGGAUGCAUUC67.43821605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4602901GGGGTCTGAGGATGCATTCGAATGCATCCTCAGACCCC0.155700.003900.819000.750001.000001.00000


Target Position: 3464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3464GCCUUUGGGUGUGUGGUGG56.07492934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5213482GCCTTTGGGTGTGTGGTGGCCACCACACACCCAAAGGC0.079000.015800.655200.500001.000001.00000


Target Position: 3895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3895GUGUCUUAAUACUGUCCUU89.1885107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4053913GTGTCTTAATACTGTCCTTAAGGACAGTATTAAGACAC0.218300.006100.655200.750001.000001.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834ACAGGACAGACAGGCUACA76.8008665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578852ACAGGACAGACAGGCTACATGTAGCCTGTCTGTCCTGT0.079600.032000.500000.500001.000001.00000


Target Position: 1038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038GCCAAGGGCCUCAACGUGA77.8217589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6091056GCCAAGGGCCTCAACGTGATCACGTTGAGGCCCTTGGC0.079800.001100.775900.750000.929300.62500


Target Position: 3898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3898UCUUAAUACUGUCCUUUUU74.8169837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3573916TCTTAATACTGTCCTTTTTAAAAAGGACAGTATTAAGA0.344600.009300.724100.750001.000001.00000


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828CUCAGCACAGGACAGACAG66.46041710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
601846CTCAGCACAGGACAGACAGCTGTCTGTCCTGTGCTGAG0.382400.073100.525900.500001.000001.00000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414ACUGAACUCCUUCCCCACU67.57341590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942432ACTGAACTCCTTCCCCACTAGTGGGGAAGGAGTTCAGT0.376000.215400.500000.500000.989100.87500


Target Position: 2518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2518CACCCUGCCCCUUGCCAUC60.21852470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3612536CACCCTGCCCCTTGCCATCGATGGCAAGGGGCAGGGTG0.097100.062300.612100.500000.972801.00000


Target Position: 4094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4094UCAGAAUCUGAUCAACAGU71.38921163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5114112TCAGAATCTGATCAACAGTACTGTTGATCAGATTCTGA0.748500.044900.517200.500000.934800.62500


Target Position: 3648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3648UGUUGUACAUUUCACCAUG71.04331198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4363666TGTTGTACATTTCACCATGCATGGTGAAATGTACAACA0.081100.030200.551700.500001.000001.00000


Target Position: 3224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3224CUCAUGAGGAGGGAAAAGA74.6122858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6003242CTCATGAGGAGGGAAAAGATCTTTTCCCTCCTCATGAG0.035600.001200.586200.500001.000001.00000


Target Position: 2739, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2739UGAGAGCGGGGAUGUGACA76.261711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5692757TGAGAGCGGGGATGTGACATGTCACATCCCCGCTCTCA0.066400.001700.517200.500001.000001.00000


Target Position: 3146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3146UGGCCUCCUUCCCCGUACU61.97972257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4393164TGGCCTCCTTCCCCGTACTAGTACGGGGAAGGAGGCCA0.649000.030300.637900.500000.923900.75000


Target Position: 2680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2680CUGAGGGACCCUUCGAGAU75.6391764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5622698CTGAGGGACCCTTCGAGATATCTCGAAGGGTCCCTCAG0.233600.001700.603400.750000.989100.87500


Target Position: 781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781UCCAGAUUGUCAACAACAC64.77981906

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414799TCCAGATTGTCAACAACACGTGTTGTTGACAATCTGGA0.244600.060600.577600.500001.000001.00000


Target Position: 2957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2957UGGAGGCAGAUGUGGGGCU59.17132578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822975TGGAGGCAGATGTGGGGCTAGCCCCACATCTGCCTCCA0.040600.002800.491400.500001.000001.00000


Target Position: 2692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2692UCGAGAUCAUCACUUCCUU75.1614803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2232710TCGAGATCATCACTTCCTTAAGGAAGTGATGATCTCGA0.291300.080800.655200.750001.000001.00000


Target Position: 4069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4069UUGUCUGAUUAAACACAAA84.3448252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5474087TTGTCTGATTAAACACAAATTTGTGTTTAATCAGACAA0.438600.001900.646600.500000.934800.62500


Target Position: 4049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4049GGUUGUAAAUACUUUGCAU97.009810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5914067GGTTGTAAATACTTTGCATATGCAAAGTATTTACAACC0.018800.008500.698301.000001.000001.00000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772GCGAGCGGCUCCAGAUUGU72.59951051

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
575790GCGAGCGGCTCCAGATTGTACAATCTGGAGCCGCTCGC0.054400.001600.715500.750000.962000.75000


Target Position: 645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
645GGCUUCAACUCCUCGGACA86.4016171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532663GGCTTCAACTCCTCGGACATGTCCGAGGAGTTGAAGCC0.032400.020100.793100.750001.000001.00000


Target Position: 3465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3465CCUUUGGGUGUGUGGUGGA77.4941610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6113483CCTTTGGGTGTGTGGTGGATCCACCACACACCCAAAGG0.071300.009800.474100.750001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502UGGAGCCCGCCGAGAACGU54.45683109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
623520TGGAGCCCGCCGAGAACGTACGTTCTCGGCGGGCTCCA0.052200.001000.569000.500000.913000.75000


Target Position: 3232, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3232GAGGGAAAAGAGUGCCUAA98.75937

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10323219GAGGGAAAAGAGTGCCTAA1/1/0/091.10SRCNM_198291.1+NM_005417.31+1NANANA20:36032954..36032972(+)00SRC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2783250GAGGGAAAAGAGTGCCTAATTAGGCACTCTTTTCCCTC0.139800.023900.775900.750001.000001.00000


Target Position: 3813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3813GUCCAUUCCAGUCAAAUCU73.8618922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3843831GTCCATTCCAGTCAAATCTAGATTTGACTGGAATGGAC0.118200.069300.594800.500001.000001.00000


Target Position: 2982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2982GGGAAUCAGGGUAAAAGGU74.799838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2913000GGGAATCAGGGTAAAAGGTACCTTTTACCCTGATTCCC0.250600.053800.637900.750001.000001.00000


Target Position: 2214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2214GGGGCUUCUGGACCUAGGG57.85932722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5572232GGGGCTTCTGGACCTAGGGCCCTAGGTCCAGAAGCCCC0.026300.002000.500000.500000.913000.75000


Target Position: 320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
320GGACACACAGCGGGGAGAG66.05721758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
423338GGACACACAGCGGGGAGAGCTCTCCCCGCTGTGTGTCC0.177400.069100.560300.750001.000001.00000


Target Position: 71, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
71CCCCUUUCCCCUCUAGCCU61.2932352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
25189CCCCTTTCCCCTCTAGCCTAGGCTAGAGGGGAAAGGGG0.224100.218300.646600.750001.000001.00000


Target Position: 2766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2766GCCACGGAGCAGUUCAGAG74.0751898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5902784GCCACGGAGCAGTTCAGAGCTCTGAACTGCTCCGTGGC0.065000.001400.689700.750001.000001.00000


Target Position: 1393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1393AGGUCAUGAAGAAGCUGAG73.7584934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071411AGGTCATGAAGAAGCTGAGCTCAGCTTCTTCATGACCT0.135700.013900.534500.500001.000001.00000


Target Position: 3339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3339CAGAGUCUGCCCCACAUGU77.8149591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5653357CAGAGTCTGCCCCACATGTACATGTGGGGCAGACTCTG0.247400.033600.577600.500000.913000.75000


Target Position: 4112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4112UUAAAAAAAAAAAAAAAAA75.4481777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5564130TTAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTAA0.994600.980000.534500.500001.000001.00000


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047CUCAACGUGAAGCACUACA76.7399672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831065CTCAACGTGAAGCACTACATGTAGTGCTTCACGTTGAG0.154300.053300.603400.500000.983701.00000


Target Position: 775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775AGCGGCUCCAGAUUGUCAA78.6054537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
587793AGCGGCTCCAGATTGTCAATTGACAATCTGGAGCCGCT0.094800.001500.706900.750001.000001.00000


Target Position: 3467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3467UUUGGGUGUGUGGUGGAUU60.31382460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5833485TTTGGGTGTGTGGTGGATTAATCCACCACACACCCAAA0.069800.005800.491400.500001.000001.00000


Target Position: 3257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3257GUGAAAGAGGACGUGUUAC68.15051515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6053275GTGAAAGAGGACGTGTTACGTAACACGTCCTCTTTCAC0.017200.004700.612100.500001.000001.00000


Target Position: 2132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2132CACUCUGCCUGCCUGCUGU78.6471535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392150CACTCTGCCTGCCTGCTGTACAGCAGGCAGGCAGAGTG0.086100.036700.586200.500000.951100.87500


Target Position: 72, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
72CCCUUUCCCCUCUAGCCUC60.29972463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
19690CCCTTTCCCCTCTAGCCTCGAGGCTAGAGGGGAAAGGG0.219300.212000.681000.750001.000001.00000


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319GGGACACACAGCGGGGAGA76.5686688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
223337GGGACACACAGCGGGGAGATCTCCCCGCTGTGTGTCCC0.178400.072300.767200.750001.000001.00000


Target Position: 3256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3256GGUGAAAGAGGACGUGUUA94.564822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5273274GGTGAAAGAGGACGTGTTATAACACGTCCTCTTTCACC0.033300.006700.819001.000001.000001.00000


Target Position: 122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
122AGCACAACCUGACCAUCCU76.6448680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
602140AGCACAACCTGACCATCCTAGGATGGTCAGGTTGTGCT0.083900.068000.508600.500001.000001.00000


Target Position: 3663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3663CAUGGCCCCCUCAUCAUAG70.4391265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943681CATGGCCCCCTCATCATAGCTATGATGAGGGGGCCATG0.451400.071100.482800.500001.000001.00000


Target Position: 3598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3598CGUCCAUAUUUAACAUGUA100.6734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3613616CGTCCATATTTAACATGTATACATGTTAAATATGGACG0.105900.031600.594801.000000.929300.75000


Target Position: 3635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3635CGUCCCCCAAACAUGUUGU69.78051335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5073653CGTCCCCCAAACATGTTGTACAACATGTTTGGGGGACG0.038800.040500.569000.750000.951100.87500


Target Position: 4108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4108ACAGUUAAAAAAAAAAAAA81.3939379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3304126ACAGTTAAAAAAAAAAAAATTTTTTTTTTTTTAACTGT0.986200.816200.706900.750001.000001.00000


Target Position: 2512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512GCCUGCCACCCUGCCCCUU59.20732570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1602530GCCTGCCACCCTGCCCCTTAAGGGGCAGGGTGGCAGGC0.284900.094900.862101.000000.956501.00000


Target Position: 2846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2846AGGCAUCAUGGAAAGACUG68.42431488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5202864AGGCATCATGGAAAGACTGCAGTCTTTCCATGATGCCT0.051400.009500.560300.500001.000001.00000


Target Position: 3004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3004GGUGUGGAGAGAGAGGCUU74.5869861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5773022GGTGTGGAGAGAGAGGCTTAAGCCTCTCTCTCCACACC0.021000.004800.715501.000001.000001.00000


Target Position: 3009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3009GGAGAGAGAGGCUUCAAUC81.3883380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5393027GGAGAGAGAGGCTTCAATCGATTGAAGCCTCTCTCTCC0.030600.006000.689700.750001.000001.00000


Target Position: 2047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2047GGGAGAACCUCUAGGCACA92.900133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4682065GGGAGAACCTCTAGGCACATGTGCCTAGAGGTTCTCCC0.049400.005100.784500.750000.907600.75000


Target Position: 3205, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3205CCAAGUCGGCACCCUUUAA85.6285197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3153223CCAAGTCGGCACCCTTTAATTAAAGGGTGCCGACTTGG0.116200.013300.810301.000000.962000.75000


Target Position: 184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
184UGUUCACUCCGGUUUUACA85.486207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574202TGTTCACTCCGGTTTTACATGTAAAACCGGAGTGAACA0.056000.001700.500000.500001.000001.00000


Target Position: 253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
253AGACAGAGCCAGGAUUUGA84.076266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
603271AGACAGAGCCAGGATTTGATCAAATCCTGGCTCTGTCT0.017300.001800.500000.500001.000001.00000


Target Position: 261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261CCAGGAUUUGAAACCAGAU84.22262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470279CCAGGATTTGAAACCAGATATCTGGTTTCAAATCCTGG0.050800.003500.663801.000000.967400.87500


Target Position: 3190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3190GCCCUGUUCUCCUCCCCAA84.705234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1073208GCCCTGTTCTCCTCCCCAATTGGGGAGGAGAACAGGGC0.434000.247900.853401.000001.000001.00000


Target Position: 2689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2689CCUUCGAGAUCAUCACUUC78.9869510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2922707CCTTCGAGATCATCACTTCGAAGTGATGATCTCGAAGG0.422500.092300.672400.750001.000001.00000


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822CACUCGCUCAGCACAGGAC72.71891037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
605840CACTCGCTCAGCACAGGACGTCCTGTGCTGAGCGAGTG0.130600.016700.474100.500000.962000.62500


Target Position: 2688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2688CCCUUCGAGAUCAUCACUU73.4312967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1482706CCCTTCGAGATCATCACTTAAGTGATGATCTCGAAGGG0.309000.094600.853401.000001.000001.00000


Target Position: 1103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1103CUCCCGCACCCAGUUCAAC58.38822667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3731121CTCCCGCACCCAGTTCAACGTTGAACTGGGTGCGGGAG0.094900.035800.663800.500000.907600.87500


Target Position: 3812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3812CGUCCAUUCCAGUCAAAUC79.4098485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3573830CGTCCATTCCAGTCAAATCGATTTGACTGGAATGGACG0.136300.084300.594800.750001.000001.00000


Target Position: 3092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3092CUGGAGGCAAUCAAGCAGA76.9322654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5883110CTGGAGGCAATCAAGCAGATCTGCTTGATTGCCTCCAG0.212600.054100.560300.500000.951100.87500


Target Position: 3929, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3929GUGUUUUGUAGAUUUCAGA85.8959191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5193947GTGTTTTGTAGATTTCAGATCTGAAATCTACAAAACAC0.231700.009700.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3927-3949CAGTGTTTTGTAGATTTCAGATGUCUGAAAUCUACAAAACACUGGUGUUUUGUAGAUUUCAGAUGU12.012.222


Target Position: 3148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3148GCCUCCUUCCCCGUACUUU70.06981311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
913166GCCTCCTTCCCCGTACTTTAAAGTACGGGGAAGGAGGC0.486100.105501.000001.000001.000001.00000


Target Position: 2426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426CCCCACUUCUGUGCCACCC48.70433595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182444CCCCACTTCTGTGCCACCCGGGTGGCACAGAAGTGGGG0.018500.014900.500000.500000.913000.87500


Target Position: 3206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3206CAAGUCGGCACCCUUUAAC62.92672138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5423224CAAGTCGGCACCCTTTAACGTTAAAGGGTGCCGACTTG0.098900.013100.500000.500000.962000.62500


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779GCUCCAGAUUGUCAACAAC79.7157460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
284797GCTCCAGATTGTCAACAACGTTGTTGACAATCTGGAGC0.157500.017000.706900.750001.000001.00000


Target Position: 2723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2723CCCAUGGGGAGACAGUUGA72.28911077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2792741CCCATGGGGAGACAGTTGATCAACTGTCTCCCCATGGG0.209800.017800.767200.750000.929300.62500


Target Position: 3909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3909UCCUUUUUUUUUUUUUAAC54.31293124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4543927TCCTTTTTTTTTTTTTAACGTTAAAAAAAAAAAAAGGA0.148200.113900.724100.500001.000001.00000


Target Position: 3137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3137CCCUGGUCCUGGCCUCCUU71.56571146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6183155CCCTGGTCCTGGCCTCCTTAAGGAGGCCAGGACCAGGG0.018300.001100.853401.000000.972801.00000


Target Position: 3143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3143UCCUGGCCUCCUUCCCCGU51.06853412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3603161TCCTGGCCTCCTTCCCCGTACGGGGAAGGAGGCCAGGA0.381600.010800.594800.500000.923900.87500


Target Position: 3152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3152CCUUCCCCGUACUUUGUCC60.45362447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6153170CCTTCCCCGTACTTTGTCCGGACAAAGTACGGGGAAGG0.396900.275300.474100.500001.000001.00000


Target Position: 3588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3588UCUCCAUGUGCGUCCAUAU78.1563563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4303606TCTCCATGTGCGTCCATATATATGGACGCACATGGAGA0.231700.004900.681000.750000.923900.62500


Target Position: 2889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2889UGAGGAUGCAUUCGAGAUG64.43881945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4932907TGAGGATGCATTCGAGATGCATCTCGAATGCATCCTCA0.042200.024300.569000.500001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719GGCCCUCUAUGACUAUGAG81.341383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513737GGCCCTCTATGACTATGAGCTCATAGTCATAGAGGGCC0.037700.004400.689700.750000.945700.62500


Target Position: 3204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3204CCCAAGUCGGCACCCUUUA73.3272978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3663222CCCAAGTCGGCACCCTTTATAAAGGGTGCCGACTTGGG0.162300.008300.956901.000000.962000.87500


Target Position: 4033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4033GGGGGUAUCCAGAAUUGGU81.6326371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4394051GGGGGTATCCAGAATTGGTACCAATTCTGGATACCCCC0.121300.004700.637900.750000.923900.62500


Target Position: 3886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3886UUGUGUAAGGUGUCUUAAU74.9303820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6163904TTGTGTAAGGTGTCTTAATATTAAGACACCTTACACAA0.022400.001100.637900.500000.978300.75000


Target Position: 4111, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4111GUUAAAAAAAAAAAAAAAA84.4533248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2544129GTTAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTAAC0.993200.971500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4109-4131CAGTTAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUAACUGGUUAAAAAAAAAAAAAAAAAAU-11.3-9.100


Target Position: 76, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
76UUCCCCUCUAGCCUCAGUU57.07992805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
62294TTCCCCTCTAGCCTCAGTTAACTGAGGCTAGAGGGGAA0.195800.165000.525900.500001.000001.00000


Target Position: 3552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3552UCCCUGUGUGUGUGUAUGU66.45391711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4083570TCCCTGTGTGTGTGTATGTACATACACACACACAGGGA0.098200.010900.663800.500001.000001.00000


Target Position: 3776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3776UUCCUUUCAUACGUCUUUA73.9476911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4193794TTCCTTTCATACGTCTTTATAAAGACGTATGAAAGGAA0.498000.206700.637900.500001.000001.00000


Target Position: 2740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2740GAGAGCGGGGAUGUGACAU75.7211756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602758GAGAGCGGGGATGTGACATATGTCACATCCCCGCTCTC0.048300.001800.655200.750001.000001.00000


Target Position: 774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774GAGCGGCUCCAGAUUGUCA92.574244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567792GAGCGGCTCCAGATTGTCATGACAATCTGGAGCCGCTC0.086000.001700.586200.500001.000001.00000


Target Position: 215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
215GAAGCUCAGAGAAGUGAAG76.0926725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
624233GAAGCTCAGAGAAGTGAAGCTTCACTTCTCTGAGCTTC0.012600.001800.534500.500000.994600.62500


Target Position: 67, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
67GCAGCCCCUUUCCCCUCUA77.7349596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
17785GCAGCCCCTTTCCCCTCTATAGAGGGGAAAGGGGCTGC0.331000.066900.681001.000001.000001.00000


Target Position: 2436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2436GUGCCACCCCCGGUCUAUG62.77292158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5702454GTGCCACCCCCGGTCTATGCATAGACCGGGGGTGGCAC0.022600.010700.637900.500000.929300.87500


Target Position: 4113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4113UAAAAAAAAAAAAAAAAAA80.6168412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4624131TAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTA0.996700.980700.534500.500001.000001.00000


Target Position: 3097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3097GGCAAUCAAGCAGACAUAG72.52551060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1313115GGCAATCAAGCAGACATAGCTATGTCTGCTTGATTGCC0.378500.149400.827600.750000.951100.75000


Target Position: 3209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3209GUCGGCACCCUUUAACUCA80.5547415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6053227GTCGGCACCCTTTAACTCATGAGTTAAAGGGTGCCGAC0.086300.012500.594800.500001.000001.00000


Target Position: 105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
105AGAGCUACCAUUCAUCUAG73.671945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
581123AGAGCTACCATTCATCTAGCTAGATGAATGGTAGCTCT0.403900.009500.551700.500001.000001.00000


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636UGGUGGGAGAGAACCUGGU62.82722153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5841654TGGTGGGAGAGAACCTGGTACCAGGTTCTCTCCCACCA0.191300.001600.491400.500000.913000.62500


Target Position: 3640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3640CCCAAACAUGUUGUACAUU75.7144758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2813658CCCAAACATGTTGTACATTAATGTACAACATGTTTGGG0.128100.027700.982801.000000.994600.62500


Target Position: 2131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2131CCACUCUGCCUGCCUGCUG61.38932339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4092149CCACTCTGCCTGCCTGCTGCAGCAGGCAGGCAGAGTGG0.122100.043000.560300.750000.951100.75000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773CGAGCGGCUCCAGAUUGUC66.4311717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
615791CGAGCGGCTCCAGATTGTCGACAATCTGGAGCCGCTCG0.081000.001100.474100.750000.962000.62500


Target Position: 73, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
73CCUUUCCCCUCUAGCCUCA76.0084731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32491CCTTTCCCCTCTAGCCTCATGAGGCTAGAGGGGAAAGG0.203400.200600.620700.750001.000001.00000


Target Position: 3924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3924UAACAGUGUUUUGUAGAUU74.2609882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6103942TAACAGTGTTTTGTAGATTAATCTACAAAACACTGTTA0.140500.001100.525900.500001.000001.00000


Target Position: 351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351CUCUAUUUCGAGACCCCUG66.831667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
529369CTCTATTTCGAGACCCCTGCAGGGGTCTCGAAATAGAG0.033100.005300.525900.500000.918500.62500


Target Position: 352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
352UCUAUUUCGAGACCCCUGA64.26881969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
598370TCTATTTCGAGACCCCTGATCAGGGGTCTCGAAATAGA0.161500.006700.500000.500001.000001.00000


Target Position: 778, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778GGCUCCAGAUUGUCAACAA98.40359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414796GGCTCCAGATTGTCAACAATTGTTGACAATCTGGAGCC0.115300.005500.853401.000001.000001.00000


Target Position: 976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976UCGUGCGAGAAAGUGAGAC51.77723350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
599994TCGTGCGAGAAAGTGAGACGTCTCACTTTCTCGCACGA0.077400.007600.474100.500001.000001.00000


Target Position: 3363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3363UGGCCUCUGCAACUGCUCA76.4296696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4503381TGGCCTCTGCAACTGCTCATGAGCAGTTGCAGAGGCCA0.333300.004300.620700.500000.956500.87500


Target Position: 194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
194GGUUUUACAGAACAGAGAA96.626912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
346212GGTTTTACAGAACAGAGAATTCTCTGTTCTGTAAAACC0.104900.010200.681001.000001.000001.00000


Target Position: 3027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3027CGGCUUGUGGGUGAUGUUU72.71821038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5423045CGGCTTGTGGGTGATGTTTAAACATCACCCACAAGCCG0.062200.002000.913801.000001.000001.00000


Target Position: 3662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3662CCAUGGCCCCCUCAUCAUA85.5871200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1123680CCATGGCCCCCTCATCATATATGATGAGGGGGCCATGG0.594000.073000.801701.000001.000001.00000


Target Position: 3625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3625CCCCCCGCUCCGUCCCCCA59.12952584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2353643CCCCCCGCTCCGTCCCCCATGGGGGACGGAGCGGGGGG0.801400.672300.646600.750001.000001.00000


Target Position: 2886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2886GUCUGAGGAUGCAUUCGAG83.0182310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072904GTCTGAGGATGCATTCGAGCTCGAATGCATCCTCAGAC0.130700.007800.508600.500001.000001.00000


Target Position: 3251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3251GCGGGGGUGAAAGAGGACG52.22333311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5493269GCGGGGGTGAAAGAGGACGCGTCCTCTTTCACCCCCGC0.435200.006400.646600.500001.000001.00000


Target Position: 2946, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2946UGGGAACAGCAUGGAGGCA69.50541359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802964TGGGAACAGCATGGAGGCATGCCTCCATGCTGTTCCCA0.078500.002800.491400.500001.000001.00000


Target Position: 4051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4051UUGUAAAUACUUUGCAUAU75.6598762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5534069TTGTAAATACTTTGCATATATATGCAAAGTATTTACAA0.027900.010900.603400.500001.000001.00000


Target Position: 3107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3107CAGACAUAGAAGAGCCAAG77.8448587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5923125CAGACATAGAAGAGCCAAGCTTGGCTCTTCTATGTCTG0.018700.006700.646600.500000.902200.62500


Target Position: 260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
260GCCAGGAUUUGAAACCAGA86.5666164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469278GCCAGGATTTGAAACCAGATCTGGTTTCAAATCCTGGC0.051800.003500.775900.750000.967400.87500


Target Position: 4034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4034GGGGUAUCCAGAAUUGGUU80.8078404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4974052GGGGTATCCAGAATTGGTTAACCAATTCTGGATACCCC0.040400.002900.844801.000000.923900.75000


Target Position: 379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
379CUGGUGUUUGUGCCAAGAC64.22431977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
623397CTGGTGTTTGTGCCAAGACGTCTTGGCACAAACACCAG0.078900.001100.465500.500000.918500.62500


Target Position: 2845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2845GAGGCAUCAUGGAAAGACU90.104379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6242863GAGGCATCATGGAAAGACTAGTCTTTCCATGATGCCTC0.074100.001000.603400.500001.000001.00000


Target Position: 2196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2196CUCUUUGGUGGCAUGGAAG66.40481721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6202214CTCTTTGGTGGCATGGAAGCTTCCATGCCACCAAAGAG0.025100.001100.672400.500001.000001.00000


Target Position: 274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
274CCAGAUGAGGACGCUGAGG57.78962733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561292CCAGATGAGGACGCTGAGGCCTCAGCGTCCTCATCTGG0.029600.003400.500000.500000.994600.75000


Target Position: 2833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2833AACAAUUCGUCGGAGGCAU68.44151487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5852851AACAATTCGTCGGAGGCATATGCCTCCGACGAATTGTT0.044600.006600.491400.500001.000001.00000


Target Position: 2648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2648GAGUACCCCCUCAAACCCU74.9123824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6212666GAGTACCCCCTCAAACCCTAGGGTTTGAGGGGGTACTC0.029900.002300.465500.500000.913000.62500


Target Position: 128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
128ACCUGACCAUCCUCACACU80.3689420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
383146ACCTGACCATCCTCACACTAGTGTGAGGATGGTCAGGT0.150800.017100.646600.500000.945700.62500


Target Position: 3106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3106GCAGACAUAGAAGAGCCAA86.7241160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5473124GCAGACATAGAAGAGCCAATTGGCTCTTCTATGTCTGC0.029600.012100.706901.000000.902200.62500


Target Position: 4042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4042CAGAAUUGGUUGUAAAUAC80.1231433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5174060CAGAATTGGTTGTAAATACGTATTTACAACCAATTCTG0.036400.005400.603400.500001.000001.00000


Target Position: 2216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2216GGCUUCUGGACCUAGGGUG64.45111944

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6012234GGCTTCTGGACCTAGGGTGCACCCTAGGTCCAGAAGCC0.019000.001200.706900.750000.956500.62500


Target Position: 102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
102GCAAGAGCUACCAUUCAUC76.0021732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445120GCAAGAGCTACCATTCATCGATGAATGGTAGCTCTTGC0.742100.004400.672400.750000.994600.75000


Target Position: 4082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4082CACAAACAGACCUCAGAAU84.5014247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3874100CACAAACAGACCTCAGAATATTCTGAGGTCTGTTTGTG0.201100.006800.784500.750001.000001.00000


Target Position: 3888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3888GUGUAAGGUGUCUUAAUAC80.5745414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5993906GTGTAAGGTGTCTTAATACGTATTAAGACACCTTACAC0.018100.001300.612100.500000.978300.87500


Target Position: 3674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3674CAUCAUAGCAAUAACAUUC77.6067602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5933692CATCATAGCAATAACATTCGAATGTTATTGCTATGATG0.804600.401500.482800.500000.978300.62500


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827GCUCAGCACAGGACAGACA89.2657103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
290845GCTCAGCACAGGACAGACATGTCTGTCCTGTGCTGAGC0.390100.037700.646600.750001.000001.00000


Target Position: 3150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3150CUCCUUCCCCGUACUUUGU65.14951861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5643168CTCCTTCCCCGTACTTTGTACAAAGTACGGGGAAGGAG0.475600.171000.603400.500001.000001.00000


Target Position: 3007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3007GUGGAGAGAGAGGCUUCAA87.2924145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733025GTGGAGAGAGAGGCTTCAATTGAAGCCTCTCTCTCCAC0.021500.002100.646600.750001.000001.00000


Target Position: 2306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2306CUCCCUGCACUCCCUCCUG59.81842504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6202324CTCCCTGCACTCCCTCCTGCAGGAGGGAGTGCAGGGAG0.013700.014100.525900.500001.000001.00000


Target Position: 1442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1442GGUUUCAGAGGAGCCCAUU75.0049811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6191460GGTTTCAGAGGAGCCCATTAATGGGCTCCTCTGAAACC0.045400.001100.844801.000000.951100.62500


Target Position: 3801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3801AAGUCUUCUCCCGUCCAUU74.0467899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3893819AAGTCTTCTCCCGTCCATTAATGGACGGGAGAAGACTT0.776200.561600.629300.500001.000001.00000


Target Position: 4048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4048UGGUUGUAAAUACUUUGCA74.7152846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5884066TGGTTGTAAATACTTTGCATGCAAAGTATTTACAACCA0.019700.006200.491400.500001.000001.00000


Target Position: 1447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1447CAGAGGAGCCCAUUUACAU88.146126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901465CAGAGGAGCCCATTTACATATGTAAATGGGCTCCTCTG0.043900.014500.629300.750001.000001.00000


Target Position: 4043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4043AGAAUUGGUUGUAAAUACU82.0063357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5384061AGAATTGGTTGTAAATACTAGTATTTACAACCAATTCT0.031600.004900.517200.500001.000001.00000


Target Position: 2018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2018CACGUCCACCGAGCCCCAG55.39073010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5402036CACGTCCACCGAGCCCCAGCTGGGGCTCGGTGGACGTG0.140200.038800.508600.500000.983700.75000


Target Position: 3775, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3775UUUCCUUUCAUACGUCUUU61.07052376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5383793TTTCCTTTCATACGTCTTTAAAGACGTATGAAAGGAAA0.340700.158300.500000.500001.000001.00000


Target Position: 1722, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1722GCCAAAUUCCCCAUCAAGU74.2552885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3111740GCCAAATTCCCCATCAAGTACTTGATGGGGAATTTGGC0.109700.071600.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1720-1742GTGCCAAATTCCCCATCAAGTGGACUUGAUGGGGAAUUUGGCACGCCAAAUUCCCCAUCAAGUGGU18.111.321


Target Position: 2989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2989AGGGUAAAAGGUGCAGGUG60.52542440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6063007AGGGTAAAAGGTGCAGGTGCACCTGCACCTTTTACCCT0.017200.016400.551700.500001.000001.00000


Target Position: 3668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3668CCCCCUCAUCAUAGCAAUA87.2997144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
843686CCCCCTCATCATAGCAATATATTGCTATGATGAGGGGG0.511800.286900.948301.000001.000001.00000


Target Position: 3769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3769UCAACUUUUCCUUUCAUAC62.72972163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6193787TCAACTTTTCCTTTCATACGTATGAAAGGAAAAGTTGA0.300800.154400.543100.500001.000001.00000


Target Position: 123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
123GCACAACCUGACCAUCCUC73.2308985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
448141GCACAACCTGACCATCCTCGAGGATGGTCAGGTTGTGC0.081200.056500.543100.750001.000001.00000


Target Position: 453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
453GGUAGCAACAAGAGCAAGC64.93481887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
616471GGTAGCAACAAGAGCAAGCGCTTGCTCTTGTTGCTACC0.080800.007400.500000.500000.923900.75000


Target Position: 1192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1192GCCCCACGUCCAAGCCGCA77.5708604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3551210GCCCCACGTCCAAGCCGCATGCGGCTTGGACGTGGGGC0.323100.009400.646600.750000.907600.62500


Target Position: 97, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
97UCACCGCAAGAGCUACCAU73.0801996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521115TCACCGCAAGAGCTACCATATGGTAGCTCTTGCGGTGA0.204900.002400.569000.750000.929301.00000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972AGCGGCCCACCUUCGAGUA73.359974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731990AGCGGCCCACCTTCGAGTATACTCGAAGGTGGGCCGCT0.113900.001700.672400.750000.956500.75000


Target Position: 1803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1803GGGAUCCUGCUGACUGAGC60.31732458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5981821GGGATCCTGCTGACTGAGCGCTCAGTCAGCAGGATCCC0.052600.001300.637900.500000.913000.62500


Target Position: 2842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2842UCGGAGGCAUCAUGGAAAG58.46272659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6122860TCGGAGGCATCATGGAAAGCTTTCCATGATGCCTCCGA0.462000.030900.655200.500001.000001.00000


Target Position: 2249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2249UGGGUAUGCGAGACCAGCA79.6566467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5872267TGGGTATGCGAGACCAGCATGCTGGTCTCGCATACCCA0.057300.001500.491400.500000.945700.62500


Target Position: 3603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3603AUAUUUAACAUGUAAAAAU80.8922401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4933621ATATTTAACATGTAAAAATATTTTTACATGTTAAATAT0.085600.030200.534500.500001.000001.00000


Target Position: 3166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3166UGUCCCGUGGCAUUUCAAU67.83651555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3203184TGTCCCGTGGCATTTCAATATTGAAATGCCACGGGACA0.590000.013000.698300.750001.000001.00000


Target Position: 2145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145UGCUGUUGGUCCUCUCUCU76.6846677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4332163TGCTGTTGGTCCTCTCTCTAGAGAGAGGACCAACAGCA0.186900.004800.629300.500001.000001.00000


Target Position: 3638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3638CCCCCAAACAUGUUGUACA85.5784201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4833656CCCCCAAACATGTTGTACATGTACAACATGTTTGGGGG0.045900.030400.784500.750000.951100.87500


Target Position: 2536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536CCAUUCUGGAAACACCUGU68.63841457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2902554CCATTCTGGAAACACCTGTACAGGTGTTTCCAGAATGG0.381900.023500.637900.750000.962000.87500


Target Position: 4038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4038UAUCCAGAAUUGGUUGUAA85.1973221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6214056TATCCAGAATTGGTTGTAATTACAACCAATTCTGGATA0.013600.004800.508600.500000.923900.87500


Target Position: 3170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3170CCGUGGCAUUUCAAUUCCU78.0627570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3923188CCGTGGCATTTCAATTCCTAGGAATTGAAATGCCACGG0.617400.010600.569000.750001.000001.00000


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654UCCUCGGACACCGUCACCU57.67712747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520672TCCTCGGACACCGTCACCTAGGTGACGGTGTCCGAGGA0.084000.002400.525900.500000.923901.00000


Target Position: 3554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3554CCUGUGUGUGUGUAUGUGU80.2907425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4203572CCTGTGTGTGTGTATGTGTACACATACACACACACAGG0.064100.017900.637900.750001.000001.00000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219CUCAGAGAAGUGAAGCAAC72.30821075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
615237CTCAGAGAAGTGAAGCAACGTTGCTTCACTTCTCTGAG0.017800.003400.663800.500001.000001.00000


Target Position: 2762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762CAAGGCCACGGAGCAGUUC58.7672623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6082780CAAGGCCACGGAGCAGTTCGAACTGCTCCGTGGCCTTG0.082400.003400.474100.500000.962001.00000


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389GCCCAGGUCAUGAAGAAGC59.23392565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171407GCCCAGGTCATGAAGAAGCGCTTCTTCATGACCTGGGC0.100200.010400.646600.500001.000001.00000


Target Position: 240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
240GCCCAGCUAUGAGAGACAG71.25971177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466258GCCCAGCTATGAGAGACAGCTGTCTCTCATAGCTGGGC0.105100.003700.715500.750000.951100.62500


Target Position: 3550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3550GGUCCCUGUGUGUGUGUAU86.286179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2913568GGTCCCTGTGTGTGTGTATATACACACACACAGGGACC0.141900.016000.810301.000001.000001.00000


Target Position: 2729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729GGGAGACAGUUGAGAGCGG70.97751209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6122747GGGAGACAGTTGAGAGCGGCCGCTCTCAACTGTCTCCC0.015300.002600.577600.500001.000001.00000


Target Position: 1399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399UGAAGAAGCUGAGGCAUGA80.6805410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5581417TGAAGAAGCTGAGGCATGATCATGCCTCAGCTTCTTCA0.065000.001800.500000.500001.000001.00000


Target Position: 77, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
77UCCCCUCUAGCCUCAGUUU65.94881776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
10695TCCCCTCTAGCCTCAGTTTAAACTGAGGCTAGAGGGGA0.529900.154600.870700.750001.000001.00000


Target Position: 2693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2693CGAGAUCAUCACUUCCUUG82.1139353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2492711CGAGATCATCACTTCCTTGCAAGGAAGTGATGATCTCG0.280100.078500.646600.750001.000001.00000


Target Position: 2979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2979CUGGGGAAUCAGGGUAAAA82.6567326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2202997CTGGGGAATCAGGGTAAAATTTTACCCTGATTCCCCAG0.182200.073800.784500.750000.967400.62500


Target Position: 4092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4092CCUCAGAAUCUGAUCAACA93.591827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4564110CCTCAGAATCTGATCAACATGTTGATCAGATTCTGAGG0.052200.046400.637900.750000.918500.75000


Target Position: 1642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1642GAGAGAACCUGGUGUGCAA101.2353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441660GAGAGAACCTGGTGTGCAATTGCACACCAGGTTCTCTC0.055700.047100.663800.750001.000001.00000


Target Position: 1025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1025UGACUUCGACAACGCCAAG63.3322086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5661043TGACTTCGACAACGCCAAGCTTGGCGTTGTCGAAGTCA0.038800.001700.586200.500000.902200.62500


Target Position: 80, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
80CCUCUAGCCUCAGUUUAUC69.65131344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
26298CCTCTAGCCTCAGTTTATCGATAAACTGAGGCTAGAGG0.601000.123900.663800.750001.000001.00000


Target Position: 3028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3028GGCUUGUGGGUGAUGUUUG72.97741009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3833046GGCTTGTGGGTGATGTTTGCAAACATCACCCACAAGCC0.325000.006800.853400.750001.000001.00000


Target Position: 3556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3556UGUGUGUGUGUAUGUGUGU71.08431191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5433574TGTGTGTGTGTATGTGTGTACACACATACACACACACA0.047300.031300.500000.500001.000001.00000


Target Position: 2445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2445CCGGUCUAUGUCGAGAGCU66.74541674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272463CCGGTCTATGTCGAGAGCTAGCTCTCGACATAGACCGG0.011600.001100.560300.750001.000001.00000


Target Position: 3211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3211CGGCACCCUUUAACUCAUG67.66221580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4353229CGGCACCCTTTAACTCATGCATGAGTTAAAGGGTGCCG0.058400.012600.758600.750001.000001.00000


Target Position: 2834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2834ACAAUUCGUCGGAGGCAUC61.67552293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812852ACAATTCGTCGGAGGCATCGATGCCTCCGACGAATTGT0.049600.006700.525900.500001.000001.00000


Target Position: 3764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3764AAAUUUCAACUUUUCCUUU75.7117759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5313782AAATTTCAACTTTTCCTTTAAAGGAAAAGTTGAAATTT0.211100.090700.500000.500001.000001.00000


Target Position: 2081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081GCUUCUCGGCUUGGAUCCU69.11651405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972099GCTTCTCGGCTTGGATCCTAGGATCCAAGCCGAGAAGC0.028300.001300.508600.750001.000001.00000


Target Position: 3180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3180UCAAUUCCUGGCCCUGUUC50.14163493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5933198TCAATTCCTGGCCCTGTTCGAACAGGGCCAGGAATTGA0.193100.056700.551700.500001.000001.00000


Target Position: 2968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2968GUGGGGCUGAGCUGGGGAA76.6934676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522986GTGGGGCTGAGCTGGGGAATTCCCCAGCTCAGCCCCAC0.085200.001900.620700.750001.000001.00000


Target Position: 1970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1970GGAGCGGCCCACCUUCGAG70.26391283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5591988GGAGCGGCCCACCTTCGAGCTCGAAGGTGGGCCGCTCC0.084600.001800.560300.750000.956500.75000


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895AGGAGUGGUAUUUUGGCAA81.8172362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608913AGGAGTGGTATTTTGGCAATTGCCAAAATACCACTCCT0.081200.001100.698300.750001.000001.00000


Target Position: 3797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3797ACCCAAGUCUUCUCCCGUC62.90012142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5013815ACCCAAGTCTTCTCCCGTCGACGGGAGAAGACTTGGGT0.824900.572000.534500.500000.929300.62500


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048UCAACGUGAAGCACUACAA82.219344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801066TCAACGTGAAGCACTACAATTGTAGTGCTTCACGTTGA0.187500.041200.577600.750000.983701.00000


Target Position: 3843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3843CCCCAGCGAGCUCUCAAAU73.699939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2973861CCCCAGCGAGCTCTCAAATATTTGAGAGCTCGCTGGGG0.717200.015000.982801.000000.967400.62500


Target Position: 264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
264GGAUUUGAAACCAGAUGAG78.0319573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523282GGATTTGAAACCAGATGAGCTCATCTGGTTTCAAATCC0.035400.013500.560300.750001.000001.00000


Target Position: 3900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3900UUAAUACUGUCCUUUUUUU72.23851084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4593918TTAATACTGTCCTTTTTTTAAAAAAAGGACAGTATTAA0.926400.159100.534500.500001.000001.00000


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258GAGCCAGGAUUUGAAACCA88.3402122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
626276GAGCCAGGATTTGAAACCATGGTTTCAAATCCTGGCTC0.051900.001400.465500.500000.967400.75000


Target Position: 1105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105CCCGCACCCAGUUCAACAG65.21751855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121123CCCGCACCCAGTTCAACAGCTGTTGAACTGGGTGCGGG0.070200.010100.706900.750000.907600.62500


Target Position: 4065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4065CAUAUUGUCUGAUUAAACA95.968515

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4063-4085TGCATATTGTCTGATTAAACACAUGUUUAAUCAGACAAUAUGCACAUAUUGUCUGAUUAAACACAU-0.36.732


Target Position: 2873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2873CAGGAAACAAGGGGUCUGA79.2828492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6262891CAGGAAACAAGGGGTCTGATCAGACCCCTTGTTTCCTG0.011800.009100.560300.500001.000001.00000


Target Position: 1640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640GGGAGAGAACCUGGUGUGC61.57882305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631658GGGAGAGAACCTGGTGTGCGCACACCAGGTTCTCTCCC0.063300.061100.637900.500000.972800.75000


Target Position: 3008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008UGGAGAGAGAGGCUUCAAU76.6031685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813026TGGAGAGAGAGGCTTCAATATTGAAGCCTCTCTCTCCA0.020600.004100.836200.750001.000001.00000


Target Position: 200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
200ACAGAACAGAGAACAGAAG69.61381348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
446218ACAGAACAGAGAACAGAAGCTTCTGTTCTCTGTTCTGT0.305500.004300.569000.500001.000001.00000


Target Position: 3789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3789UCUUUAUUACCCAAGUCUU74.195888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3683807TCTTTATTACCCAAGTCTTAAGACTTGGGTAATAAAGA0.623600.578700.586200.750000.994600.62500


Target Position: 2504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504CCCCGCCUGCCUGCCACCC36.08044038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5332522CCCCGCCTGCCTGCCACCCGGGTGGCAGGCAGGCGGGG0.250900.030800.500000.500000.940200.75000


Target Position: 2959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2959GAGGCAGAUGUGGGGCUGA80.2153429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5952977GAGGCAGATGTGGGGCTGATCAGCCCCACATCTGCCTC0.041000.002800.586200.500001.000001.00000


Target Position: 2947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947GGGAACAGCAUGGAGGCAG62.67312171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772965GGGAACAGCATGGAGGCAGCTGCCTCCATGCTGTTCCC0.113800.003300.706900.750001.000001.00000


Target Position: 3590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3590UCCAUGUGCGUCCAUAUUU66.80741670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3963608TCCATGTGCGTCCATATTTAAATATGGACGCACATGGA0.437600.006600.870700.750000.923900.62500


Target Position: 2130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2130CCCACUCUGCCUGCCUGCU62.24522222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3012148CCCACTCTGCCTGCCTGCTAGCAGGCAGGCAGAGTGGG0.134100.042900.637900.750000.951100.75000


Target Position: 3779, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3779CUUUCAUACGUCUUUAUUA95.087518

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3377919CTTTCATACGTCTTTATTA1/1/0/093.97SRCNM_198291.1+NM_005417.31+1NANANA20:36033501..36033519(+)00SRC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3493797CTTTCATACGTCTTTATTATAATAAAGACGTATGAAAG0.682500.225700.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3777-3799TCCTTTCATACGTCTTTATTACCUAAUAAAGACGUAUGAAAGGACUUUCAUACGUCUUUAUUACCU-4.38.922


Target Position: 213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
213CAGAAGCUCAGAGAAGUGA81.6425370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
530231CAGAAGCTCAGAGAAGTGATCACTTCTCTGAGCTTCTG0.033100.004900.560300.500001.000001.00000


Target Position: 3213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3213GCACCCUUUAACUCAUGAG72.46831061

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5193231GCACCCTTTAACTCATGAGCTCATGAGTTAAAGGGTGC0.036300.003400.543100.750001.000001.00000


Target Position: 1539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1539CCUCAGCUGGUGGACAUGG57.71112743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5481557CCTCAGCTGGTGGACATGGCCATGTCCACCAGCTGAGG0.119700.006600.500000.500001.000001.00000


Target Position: 2403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2403CUACUCCGCUCACUGAACU73.7936929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6202421CTACTCCGCTCACTGAACTAGTTCAGTGAGCGGAGTAG0.447000.250400.465500.500000.918500.62500


Target Position: 3642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3642CAAACAUGUUGUACAUUUC80.7559408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6003660CAAACATGTTGTACATTTCGAAATGTACAACATGTTTG0.135100.024900.474100.500000.994600.87500


Target Position: 2821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2821UCCUCAGGAACCAACAAUU71.66061139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1932839TCCTCAGGAACCAACAATTAATTGTTGGTTCCTGAGGA0.224800.071500.862100.750001.000001.00000


Target Position: 3788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3788GUCUUUAUUACCCAAGUCU76.2465714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6033806GTCTTTATTACCCAAGTCTAGACTTGGGTAATAAAGAC0.619500.574700.594800.500000.994600.62500


Target Position: 3591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3591CCAUGUGCGUCCAUAUUUA96.895111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3693609CCATGTGCGTCCATATTTATAAATATGGACGCACATGG0.482400.008100.810301.000000.923900.62500


Target Position: 2657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2657CUCAAACCCUGCCCUCCUU71.11261187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5252675CTCAAACCCTGCCCTCCTTAAGGAGGGCAGGGTTTGAG0.034600.003600.672400.750001.000001.00000


Target Position: 4097, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4097GAAUCUGAUCAACAGUUAA101.3642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2804115GAATCTGATCAACAGTTAATTAACTGTTGATCAGATTC0.773000.047000.637900.750000.934801.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4095-4117CAGAATCTGATCAACAGTTAAAAUUAACUGUUGAUCAGAUUCUGGAAUCUGAUCAACAGUUAAAAU19.020.4


Target Position: 717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717GUGGCCCUCUAUGACUAUG66.48141707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511735GTGGCCCTCTATGACTATGCATAGTCATAGAGGGCCAC0.059600.002600.637900.500000.945700.87500


Target Position: 3790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3790CUUUAUUACCCAAGUCUUC67.83171557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6173808CTTTATTACCCAAGTCTTCGAAGACTTGGGTAATAAAG0.626200.580300.465500.500001.000001.00000


Target Position: 3624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3624CCCCCCCGCUCCGUCCCCC34.89124054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6043642CCCCCCCGCTCCGTCCCCCGGGGGACGGAGCGGGGGGG0.795000.671900.500000.500001.000001.00000


Target Position: 2302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2302GCCUCUCCCUGCACUCCCU75.8314746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4092320GCCTCTCCCTGCACTCCCTAGGGAGTGCAGGGAGAGGC0.071100.056600.655200.750001.000001.00000


Target Position: 1719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1719GGUGCCAAAUUCCCCAUCA84.3528251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931737GGTGCCAAATTCCCCATCATGATGGGGAATTTGGCACC0.289600.003000.629300.750001.000001.00000


Target Position: 2045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2045CGGGGAGAACCUCUAGGCA84.3017255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272063CGGGGAGAACCTCTAGGCATGCCTAGAGGTTCTCCCCG0.035100.001000.560300.750000.934800.62500


Target Position: 2329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2329UCUGUGGGUCUCUGGAAGA72.38441069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5472347TCTGTGGGTCTCTGGAAGATCTTCCAGAGACCCACAGA0.063900.005100.500000.500001.000001.00000


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503GCCCCGCCUGCCUGCCACC49.88413510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4092521GCCCCGCCTGCCTGCCACCGGTGGCAGGCAGGCGGGGC0.235700.015400.646600.500000.940200.75000


Target Position: 263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
263AGGAUUUGAAACCAGAUGA78.7208530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533281AGGATTTGAAACCAGATGATCATCTGGTTTCAAATCCT0.032200.014900.620700.500000.967400.75000


Target Position: 3589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3589CUCCAUGUGCGUCCAUAUU74.9855813

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4133607CTCCATGTGCGTCCATATTAATATGGACGCACATGGAG0.417600.005500.801700.750000.923900.62500


Target Position: 3936, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3936GUAGAUUUCAGAUGACUAU87.8187132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3013954GTAGATTTCAGATGACTATATAGTCATCTGAAATCTAC0.117900.049100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3934-3956TTGTAGATTTCAGATGACTATGCAUAGUCAUCUGAAAUCUACAAGUAGAUUUCAGAUGACUAUGCU20.36.922


Target Position: 3669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3669CCCCUCAUCAUAGCAAUAA78.7366527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
793687CCCCTCATCATAGCAATAATTATTGCTATGATGAGGGG0.545100.323200.956901.000001.000001.00000


Target Position: 3161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3161UACUUUGUCCCGUGGCAUU68.32611498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6073179TACTTTGTCCCGTGGCATTAATGCCACGGGACAAAGTA0.021100.014300.672400.500001.000001.00000


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144CUGCUGUUGGUCCUCUCUC63.15382105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6142162CTGCTGTTGGTCCTCTCTCGAGAGAGGACCAACAGCAG0.188700.002300.474100.500001.000001.00000


Target Position: 1644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644GAGAACCUGGUGUGCAAAG69.36261373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5581662GAGAACCTGGTGTGCAAAGCTTTGCACACCAGGTTCTC0.057200.029200.672400.500001.000001.00000


Target Position: 2819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2819CAUCCUCAGGAACCAACAA89.538693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5242837CATCCTCAGGAACCAACAATTGTTGGTTCCTGAGGATG0.547600.075300.508600.750000.967400.75000


Target Position: 3845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3845CCAGCGAGCUCUCAAAUCC68.93531427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6123863CCAGCGAGCTCTCAAATCCGGATTTGAGAGCTCGCTGG0.893400.021300.474100.500001.000001.00000


Target Position: 4110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4110AGUUAAAAAAAAAAAAAAA86.4808168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1244128AGTTAAAAAAAAAAAAAAATTTTTTTTTTTTTTTAACT0.990600.919100.706900.750001.000001.00000


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288GCUUUGGCGAGGUGUGGAU75.7953748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251306GCTTTGGCGAGGTGTGGATATCCACACCTCGCCAAAGC0.043800.002300.672401.000001.000001.00000


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433UCUGUGCCACCCCCGGUCU53.64943198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6042451TCTGTGCCACCCCCGGTCTAGACCGGGGGTGGCACAGA0.025400.001200.500000.500000.929300.87500


Target Position: 2977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2977AGCUGGGGAAUCAGGGUAA80.267428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3312995AGCTGGGGAATCAGGGTAATTACCCTGATTCCCCAGCT0.135700.011500.819000.750000.945700.75000


Target Position: 4101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4101CUGAUCAACAGUUAAAAAA84.7672232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2864119CTGATCAACAGTTAAAAAATTTTTTAACTGTTGATCAG0.884800.191300.784500.750000.967400.62500


Target Position: 2885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2885GGUCUGAGGAUGCAUUCGA86.5187166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4242903GGTCTGAGGATGCATTCGATCGAATGCATCCTCAGACC0.143000.005200.560300.750001.000001.00000


Target Position: 1104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104UCCCGCACCCAGUUCAACA71.521153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751122TCCCGCACCCAGTTCAACATGTTGAACTGGGTGCGGGA0.053800.016500.663800.500000.907600.75000


Target Position: 2525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2525CCCCUUGCCAUCCAUUCUG58.32762671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5592543CCCCTTGCCATCCATTCTGCAGAATGGATGGCAAGGGG0.025700.015200.706900.750001.000001.00000


Target Position: 3586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3586UGUCUCCAUGUGCGUCCAU68.06191525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4633604TGTCTCCATGTGCGTCCATATGGACGCACATGGAGACA0.060400.003700.551700.750000.972800.62500


Target Position: 3902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3902AAUACUGUCCUUUUUUUUU75.2454793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5103920AATACTGTCCTTTTTTTTTAAAAAAAAAGGACAGTATT0.940900.141300.508600.500001.000001.00000


Target Position: 3854, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3854UCUCAAAUCCCUCUCCAAC61.80092280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5763872TCTCAAATCCCTCTCCAACGTTGGAGAGGGATTTGAGA0.702400.647100.577600.500001.000001.00000


Target Position: 3595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3595GUGCGUCCAUAUUUAACAU87.8053133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5743613GTGCGTCCATATTTAACATATGTTAAATATGGACGCAC0.075000.001600.637900.750001.000001.00000


Target Position: 3758, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3758CCUAUGAAAUUUCAACUUU81.8717359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1553776CCTATGAAATTTCAACTTTAAAGTTGAAATTTCATAGG0.794600.050900.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3756-3778TGCCTATGAAATTTCAACTTTTCAAAGUUGAAAUUUCAUAGGCACCUAUGAAAUUUCAACUUUUCU19.213.422


Target Position: 3601, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3601CCAUAUUUAACAUGUAAAA91.52749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3903619CCATATTTAACATGTAAAATTTTACATGTTAAATATGG0.076300.031300.844801.000000.929300.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3599-3621GTCCATATTTAACATGTAAAAATUUUUACAUGUUAAAUAUGGACCCAUAUUUAACAUGUAAAAAUU6.9-1.831


Target Position: 2844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2844GGAGGCAUCAUGGAAAGAC70.28331281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6282862GGAGGCATCATGGAAAGACGTCTTTCCATGATGCCTCC0.091000.001000.551700.750000.994600.62500


Target Position: 3145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3145CUGGCCUCCUUCCCCGUAC54.51183097

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4303163CTGGCCTCCTTCCCCGTACGTACGGGGAAGGAGGCCAG0.637200.014300.603400.500000.923900.75000


Target Position: 4096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4096AGAAUCUGAUCAACAGUUA89.413998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2314114AGAATCTGATCAACAGTTATAACTGTTGATCAGATTCT0.772700.046800.689700.750000.934800.87500


Target Position: 3659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3659UCACCAUGGCCCCCUCAUC56.09032930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5433677TCACCATGGCCCCCTCATCGATGAGGGGGCCATGGTGA0.468400.067100.543100.500001.000001.00000


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824CUCGCUCAGCACAGGACAG68.76421445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483842CTCGCTCAGCACAGGACAGCTGTCCTGTGCTGAGCGAG0.208900.022000.525900.500000.978300.62500


Target Position: 3755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3755CUGCCUAUGAAAUUUCAAC69.44091368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5023773CTGCCTATGAAATTTCAACGTTGAAATTTCATAGGCAG0.275600.031200.637900.500001.000001.00000


Target Position: 78, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
78CCCCUCUAGCCUCAGUUUA77.4284618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8096CCCCTCTAGCCTCAGTTTATAAACTGAGGCTAGAGGGG0.536900.143900.956901.000001.000001.00000


Target Position: 3734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3734GGGAAGGAGGCCAAGCAGU71.5851145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5853752GGGAAGGAGGCCAAGCAGTACTGCTTGGCCTCCTTCCC0.282100.001500.784500.750001.000001.00000


Target Position: 1767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767GGCCGCUUCACCAUCAAGU71.86381120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151785GGCCGCTTCACCATCAAGTACTTGATGGTGAAGCGGCC0.125900.002400.793100.750000.918500.62500


Target Position: 3099, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3099CAAUCAAGCAGACAUAGAA101.4321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6013117CAATCAAGCAGACATAGAATTCTATGTCTGCTTGATTG0.200800.110100.474100.750000.989100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3097-3119GGCAATCAAGCAGACATAGAAGAUUCUAUGUCUGCUUGAUUGCCCAAUCAAGCAGACAUAGAAGAU20.312.022


Target Position: 273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
273ACCAGAUGAGGACGCUGAG65.11871866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
542291ACCAGATGAGGACGCTGAGCTCAGCGTCCTCATCTGGT0.030600.003300.543100.500000.962000.75000


Target Position: 3626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3626CCCCCGCUCCGUCCCCCAA67.08051645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
323644CCCCCGCTCCGTCCCCCAATTGGGGGACGGAGCGGGGG0.854300.671700.844801.000001.000001.00000


Target Position: 3245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3245GCCUAAGCGGGGGUGAAAG61.32642345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3623263GCCTAAGCGGGGGTGAAAGCTTTCACCCCCGCTTAGGC0.084500.045900.862100.750000.967400.75000


Target Position: 1346, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1346CCUGAAGCCUGGCACGAUG70.26461282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431364CCTGAAGCCTGGCACGATGCATCGTGCCAGGCTTCAGG0.035500.002000.689700.750001.000001.00000


Target Position: 4093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4093CUCAGAAUCUGAUCAACAG80.9477398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4854111CTCAGAATCTGATCAACAGCTGTTGATCAGATTCTGAG0.232300.045400.525900.500000.918500.62500


Target Position: 2702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2702CACUUCCUUGCCCCCAUUU67.78321562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3982720CACTTCCTTGCCCCCATTTAAATGGGGGCAAGGAAGTG0.074100.028600.793100.750001.000001.00000


Target Position: 2127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2127UGCCCCACUCUGCCUGCCU55.73652967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5932145TGCCCCACTCTGCCTGCCTAGGCAGGCAGAGTGGGGCA0.132100.001400.508600.500000.962000.75000


Target Position: 4071, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4071GUCUGAUUAAACACAAACA90.993859

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4069-4091TTGTCTGATTAAACACAAACAGAUGUUUGUGUUUAAUCAGACAAGUCUGAUUAAACACAAACAGAU19.320.421


Target Position: 3095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3095GAGGCAAUCAAGCAGACAU89.480395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2263113GAGGCAATCAAGCAGACATATGTCTGCTTGATTGCCTC0.328500.055200.655200.750000.951100.87500


Target Position: 3778, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3778CCUUUCAUACGUCUUUAUU78.4057553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
733796CCTTTCATACGTCTTTATTAATAAAGACGTATGAAAGG0.591100.223900.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3776-3798TTCCTTTCATACGTCTTTATTACAAUAAAGACGUAUGAAAGGAACCUUUCAUACGUCUUUAUUACU6.912.033


Target Position: 1101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101ACCUCCCGCACCCAGUUCA66.90311659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451119ACCTCCCGCACCCAGTTCATGAACTGGGTGCGGGAGGT0.127600.053300.629300.500000.907601.00000


Target Position: 3853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3853CUCUCAAAUCCCUCUCCAA92.686441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2133871CTCTCAAATCCCTCTCCAATTGGAGAGGGATTTGAGAG0.716200.664400.663800.750001.000001.00000


Target Position: 712, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712CCUUUGUGGCCCUCUAUGA82.3886336

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
710-732CACCTTTGTGGCCCTCTATGACTUCAUAGAGGGCCACAAAGGUGCCUUUGUGGCCCUCUAUGACUU17.816.722


Target Position: 3549, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3549GGGUCCCUGUGUGUGUGUA88.5762116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2763567GGGTCCCTGTGTGTGTGTATACACACACACAGGGACCC0.167000.018100.810301.000001.000001.00000


Target Position: 1639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639UGGGAGAGAACCUGGUGUG61.26932354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311657TGGGAGAGAACCTGGTGTGCACACCAGGTTCTCTCCCA0.096600.066600.551700.500000.972800.75000


Target Position: 752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
752AGACCUGUCCUUCAAGAAA88.1761125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514770AGACCTGTCCTTCAAGAAATTTCTTGAAGGACAGGTCT0.313700.002500.724100.750000.951100.75000


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821CCACUCGCUCAGCACAGGA79.5616474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
616839CCACTCGCTCAGCACAGGATCCTGTGCTGAGCGAGTGG0.118000.014200.474100.750000.962000.75000


Target Position: 3633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3633UCCGUCCCCCAAACAUGUU57.16422797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4723651TCCGTCCCCCAAACATGTTAACATGTTTGGGGGACGGA0.048500.045900.724100.750001.000001.00000


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415CUGAACUCCUUCCCCACUU69.01251419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2372433CTGAACTCCTTCCCCACTTAAGTGGGGAAGGAGTTCAG0.238100.198400.646600.750000.989100.75000


Target Position: 3315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3315GGCCCCUGCUGUCUCUCUG68.93831426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5683333GGCCCCTGCTGTCTCTCTGCAGAGAGACAGCAGGGGCC0.023100.005100.715500.750000.989100.75000


Target Position: 3367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3367CUCUGCAACUGCUCAGCUC70.30851278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6273385CTCTGCAACTGCTCAGCTCGAGCTGAGCAGTTGCAGAG0.064600.004800.500000.500000.929300.62500


Target Position: 2882, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2882AGGGGUCUGAGGAUGCAUU75.7947749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892900AGGGGTCTGAGGATGCATTAATGCATCCTCAGACCCCT0.147700.003100.836200.750001.000001.00000


Target Position: 259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
259AGCCAGGAUUUGAAACCAG70.11911305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497277AGCCAGGATTTGAAACCAGCTGGTTTCAAATCCTGGCT0.046100.002800.569000.500000.967400.75000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645AGAACCUGGUGUGCAAAGU66.92581656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971663AGAACCTGGTGTGCAAAGTACTTTGCACACCAGGTTCT0.050200.020700.517200.500001.000001.00000


Target Position: 3499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3499AGUGUGCCCAUCUGUAAAG67.18751630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5663517AGTGTGCCCATCTGTAAAGCTTTACAGATGGGCACACT0.237600.002300.569000.500001.000001.00000


Target Position: 2760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2760CCCAAGGCCACGGAGCAGU57.04042811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2242778CCCAAGGCCACGGAGCAGTACTGCTCCGTGGCCTTGGG0.177900.036700.784500.750000.902200.62500


Target Position: 3735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3735GGAAGGAGGCCAAGCAGUG73.1463991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6263753GGAAGGAGGCCAAGCAGTGCACTGCTTGGCCTCCTTCC0.013500.001000.577600.750001.000001.00000


Target Position: 3808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3808CUCCCGUCCAUUCCAGUCA72.57371054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5973826CTCCCGTCCATTCCAGTCATGACTGGAATGGACGGGAG0.164500.144300.586200.500000.913000.75000


Target Position: 2818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2818UCAUCCUCAGGAACCAACA72.82321028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4992836TCATCCTCAGGAACCAACATGTTGGTTCCTGAGGATGA0.143500.078600.517200.500000.967400.87500


Target Position: 1971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1971GAGCGGCCCACCUUCGAGU71.24081181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5701989GAGCGGCCCACCTTCGAGTACTCGAAGGTGGGCCGCTC0.100200.001700.603400.500000.956500.62500


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052CGUGAAGCACUACAAGAUC75.4634776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561070CGTGAAGCACTACAAGATCGATCTTGTAGTGCTTCACG0.347200.034400.594800.750000.983700.62500


Target Position: 2437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2437UGCCACCCCCGGUCUAUGU57.44272773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6002455TGCCACCCCCGGTCTATGTACATAGACCGGGGGTGGCA0.188700.010900.646600.500000.929300.75000


Target Position: 2124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2124GCUUGCCCCACUCUGCCUG58.1752685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5782142GCTTGCCCCACTCTGCCTGCAGGCAGAGTGGGGCAAGC0.213300.001600.569000.750000.962000.87500


Target Position: 2980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2980UGGGGAAUCAGGGUAAAAG62.09822241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4992998TGGGGAATCAGGGTAAAAGCTTTTACCCTGATTCCCCA0.306300.051500.706900.500001.000001.00000


Target Position: 2840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2840CGUCGGAGGCAUCAUGGAA92.160746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3482858CGTCGGAGGCATCATGGAATTCCATGATGCCTCCGACG0.454900.021700.603401.000001.000001.00000


Target Position: 1106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106CCGCACCCAGUUCAACAGC51.74523353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111124CCGCACCCAGTTCAACAGCGCTGTTGAACTGGGTGCGG0.164900.010500.560300.500000.967400.62500


Target Position: 1448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1448AGAGGAGCCCAUUUACAUC73.7259938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371466AGAGGAGCCCATTTACATCGATGTAAATGGGCTCCTCT0.045800.011000.543100.500001.000001.00000


Target Position: 3658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3658UUCACCAUGGCCCCCUCAU53.48783214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5573676TTCACCATGGCCCCCTCATATGAGGGGGCCATGGTGAA0.480400.063000.517200.500001.000001.00000


Target Position: 2420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2420CUCCUUCCCCACUUCUGUG66.01341764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5692438CTCCTTCCCCACTTCTGTGCACAGAAGTGGGGAAGGAG0.022700.020200.517200.500000.918500.62500


Target Position: 2146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2146GCUGUUGGUCCUCUCUCUG70.95611214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6212164GCTGTTGGTCCTCTCTCTGCAGAGAGAGGACCAACAGC0.046600.001100.569000.750001.000001.00000


Target Position: 3647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647AUGUUGUACAUUUCACCAU73.9407912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6103665ATGTTGTACATTTCACCATATGGTGAAATGTACAACAT0.119300.026200.500000.500001.000001.00000


Target Position: 3903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3903AUACUGUCCUUUUUUUUUU72.28881078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4463921ATACTGTCCTTTTTTTTTTAAAAAAAAAAGGACAGTAT0.964500.140500.543100.500001.000001.00000


Target Position: 900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900UGGUAUUUUGGCAAGAUCA80.8247403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482918TGGTATTTTGGCAAGATCATGATCTTGCCAAAATACCA0.178500.003200.620700.500001.000001.00000


Target Position: 3096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3096AGGCAAUCAAGCAGACAUA89.920882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3323114AGGCAATCAAGCAGACATATATGTCTGCTTGATTGCCT0.298700.060900.801700.750000.951100.75000


Target Position: 3810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3810CCCGUCCAUUCCAGUCAAA82.0664354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2443828CCCGTCCATTCCAGTCAAATTTGACTGGAATGGACGGG0.150600.120600.991401.000000.913000.62500


Target Position: 3904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3904UACUGUCCUUUUUUUUUUU71.74971130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3553922TACTGTCCTTTTTTTTTTTAAAAAAAAAAAGGACAGTA0.966500.177800.681000.500001.000001.00000


Target Position: 2658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2658UCAAACCCUGCCCUCCUUA66.95151653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372676TCAAACCCTGCCCTCCTTATAAGGAGGGCAGGGTTTGA0.031800.024900.689700.750001.000001.00000


Target Position: 3005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3005GUGUGGAGAGAGAGGCUUC74.0974896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6093023GTGTGGAGAGAGAGGCTTCGAAGCCTCTCTCTCCACAC0.016300.002600.620700.500001.000001.00000


Target Position: 182, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
182CAUGUUCACUCCGGUUUUA86.7744157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465200CATGTTCACTCCGGTTTTATAAAACCGGAGTGAACATG0.056400.003700.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
180-202GCCATGTTCACTCCGGTTTTACAUAAAACCGGAGUGAACAUGGCCAUGUUCACUCCGGUUUUACAU19.420.523


Target Position: 3171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3171CGUGGCAUUUCAAUUCCUG72.58441053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5783189CGTGGCATTTCAATTCCTGCAGGAATTGAAATGCCACG0.508200.007100.491400.750001.000001.00000


Target Position: 2724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2724CCAUGGGGAGACAGUUGAG74.9293821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4632742CCATGGGGAGACAGTTGAGCTCAACTGTCTCCCCATGG0.212900.022500.534500.750001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CAACGUGAAGCACUACAAG78.1694562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111067CAACGTGAAGCACTACAAGCTTGTAGTGCTTCACGTTG0.298700.036300.508600.500000.983701.00000


Target Position: 2700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700AUCACUUCCUUGCCCCCAU66.00241768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6092718ATCACTTCCTTGCCCCCATATGGGGGCAAGGAAGTGAT0.051900.037300.525900.500001.000001.00000


Target Position: 32, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
32CUGGCUUCUGCUGUUGACU68.17021509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
58650CTGGCTTCTGCTGTTGACTAGTCAACAGCAGAAGCCAG0.093100.004000.577600.500000.983700.87500


Target Position: 2537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2537CAUUCUGGAAACACCUGUA94.104426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6102555CATTCTGGAAACACCTGTATACAGGTGTTTCCAGAATG0.377500.027000.474100.750000.962001.00000


Target Position: 2820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2820AUCCUCAGGAACCAACAAU68.33461497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182838ATCCTCAGGAACCAACAATATTGTTGGTTCCTGAGGAT0.295400.072200.672400.500000.967400.62500


Target Position: 2887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2887UCUGAGGAUGCAUUCGAGA73.04731000

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5492905TCTGAGGATGCATTCGAGATCTCGAATGCATCCTCAGA0.153400.013800.500000.500001.000001.00000


Target Position: 2632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2632GGUGGGUGGGUGGGAUGAG66.16921746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5392650GGTGGGTGGGTGGGATGAGCTCATCCCACCCACCCACC0.033100.002000.543100.750001.000001.00000


Target Position: 3632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3632CUCCGUCCCCCAAACAUGU67.19711629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5843650CTCCGTCCCCCAAACATGTACATGTTTGGGGGACGGAG0.050700.048200.603400.500000.983700.62500


Target Position: 360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
360GAGACCCCUGACUCCACAC70.18171289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498378GAGACCCCTGACTCCACACGTGTGGAGTCAGGGGTCTC0.125700.049400.517200.500000.951100.62500


Target Position: 3255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3255GGGUGAAAGAGGACGUGUU87.4747142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4343273GGGTGAAAGAGGACGTGTTAACACGTCCTCTTTCACCC0.058600.017900.844801.000001.000001.00000


Target Position: 3168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3168UCCCGUGGCAUUUCAAUUC52.00973329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5773186TCCCGTGGCATTTCAATTCGAATTGAAATGCCACGGGA0.746900.013100.698300.500001.000001.00000


Target Position: 2524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2524GCCCCUUGCCAUCCAUUCU71.34981173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4272542GCCCCTTGCCATCCATTCTAGAATGGATGGCAAGGGGC0.060700.030100.775900.750001.000001.00000


Target Position: 3254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3254GGGGUGAAAGAGGACGUGU73.9693908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3863272GGGGTGAAAGAGGACGTGTACACGTCCTCTTTCACCCC0.088500.006800.784500.750001.000001.00000


Target Position: 2998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2998GGUGCAGGUGUGGAGAGAG76.5458689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5863016GGTGCAGGTGTGGAGAGAGCTCTCTCCACACCTGCACC0.226100.001500.543100.750001.000001.00000


Target Position: 3368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3368UCUGCAACUGCUCAGCUCU69.37041372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5563386TCTGCAACTGCTCAGCTCTAGAGCTGAGCAGTTGCAGA0.044700.004200.500000.500000.929300.62500


Target Position: 2401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2401GCCUACUCCGCUCACUGAA83.2573300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1222419GCCTACTCCGCTCACTGAATTCAGTGAGCGGAGTAGGC0.382900.103300.827601.000001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783CAGAUUGUCAACAACACAG76.8445662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
558801CAGATTGTCAACAACACAGCTGTGTTGTTGACAATCTG0.089800.026900.500000.500000.983700.62500


Target Position: 4109, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4109CAGUUAAAAAAAAAAAAAA91.098958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2674127CAGTTAAAAAAAAAAAAAATTTTTTTTTTTTTTAACTG0.988500.915000.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4107-4129AACAGTTAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUAACUGUUCAGUUAAAAAAAAAAAAAAAAU-11.34.900


Target Position: 2406, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2406CUCCGCUCACUGAACUCCU70.99571204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6252424CTCCGCTCACTGAACTCCTAGGAGTTCAGTGAGCGGAG0.458000.263700.465500.500000.918501.00000


Target Position: 3667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3667GCCCCCUCAUCAUAGCAAU78.9935508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
883685GCCCCCTCATCATAGCAATATTGCTATGATGAGGGGGC0.491800.284500.991401.000001.000001.00000


Target Position: 4095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4095CAGAAUCUGAUCAACAGUU84.2734256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2694113CAGAATCTGATCAACAGTTAACTGTTGATCAGATTCTG0.746200.044900.637900.750000.934800.75000


Target Position: 1978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1978CCACCUUCGAGUACCUGCA80.988397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5771996CCACCTTCGAGTACCTGCATGCAGGTACTCGAAGGTGG0.077600.071500.491400.750000.989100.62500


Target Position: 3852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3852GCUCUCAAAUCCCUCUCCA84.5872242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5223870GCTCTCAAATCCCTCTCCATGGAGAGGGATTTGAGAGC0.741900.500700.508600.750001.000001.00000


Target Position: 922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922GACGGGAGUCAGAGCGGUU83.6335279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
580940GACGGGAGTCAGAGCGGTTAACCGCTCTGACTCCCGTC0.021500.001500.672400.750000.978300.62500


Target Position: 1166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1166CCUGUGCCACCGCCUCACC56.07022935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5891184CCTGTGCCACCGCCTCACCGGTGAGGCGGTGGCACAGG0.246000.003300.491400.500000.913001.00000


Target Position: 3029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3029GCUUGUGGGUGAUGUUUGA89.430696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4303047GCTTGTGGGTGATGTTTGATCAAACATCACCCACAAGC0.059900.007300.629300.750001.000001.00000


Target Position: 4041, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4041CCAGAAUUGGUUGUAAAUA86.493167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5344059CCAGAATTGGTTGTAAATATATTTACAACCAATTCTGG0.031900.006100.801701.000000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4039-4061ATCCAGAATTGGTTGTAAATACTUAUUUACAACCAAUUCUGGAUCCAGAAUUGGUUGUAAAUACUU6.912.032


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638GUGGGAGAGAACCUGGUGU71.85781121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101656GTGGGAGAGAACCTGGTGTACACCAGGTTCTCTCCCAC0.106200.006400.586200.500000.972800.87500


Target Position: 4044, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4044GAAUUGGUUGUAAAUACUU86.3704174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5204062GAATTGGTTGTAAATACTTAAGTATTTACAACCAATTC0.036200.004300.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4042-4064CAGAATTGGTTGTAAATACTTTGAAGUAUUUACAACCAAUUCUGGAAUUGGUUGUAAAUACUUUGU4.618.823


Target Position: 2465, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465GCCAAAGAGCCUUUCCAAA85.9604189

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9246519GCCAAAGAGCCTTTCCAAA1/1/0/091.10SRCNM_198291.1+NM_005417.31+1NANANA20:36032187..36032205(+)00SRC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2632483GCCAAAGAGCCTTTCCAAATTTGGAAAGGCTCTTTGGC0.146800.022101.000001.000001.000001.00000


Target Position: 60, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
60ACCUCAAGCAGCCCCUUUC58.8182618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
56378ACCTCAAGCAGCCCCTTTCGAAAGGGGCTGCTTGAGGT0.238000.115600.681000.500000.978300.75000


Target Position: 4081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4081ACACAAACAGACCUCAGAA91.503950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4584099ACACAAACAGACCTCAGAATTCTGAGGTCTGTTTGTGT0.099100.006800.534500.750001.000001.00000


Target Position: 4050, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4050GUUGUAAAUACUUUGCAUA91.317955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5834068GTTGTAAATACTTTGCATATATGCAAAGTATTTACAAC0.020400.010000.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4048-4070TGGTTGTAAATACTTTGCATATTUAUGCAAAGUAUUUACAACCAGUUGUAAAUACUUUGCAUAUUU20.07.231


Target Position: 4035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4035GGGUAUCCAGAAUUGGUUG74.2058886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5824053GGGTATCCAGAATTGGTTGCAACCAATTCTGGATACCC0.020500.001900.844800.750000.923900.87500


Target Position: 3138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3138CCUGGUCCUGGCCUCCUUC61.43232331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5943156CCTGGTCCTGGCCTCCTTCGAAGGAGGCCAGGACCAGG0.060500.001400.672400.750000.972800.87500


Target Position: 1089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089GGCUUCUACAUCACCUCCC61.31412349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171107GGCTTCTACATCACCTCCCGGGAGGTGATGTAGAAGCC0.344600.060200.508600.500000.972800.62500


Target Position: 3189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3189GGCCCUGUUCUCCUCCCCA79.6865464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2683207GGCCCTGTTCTCCTCCCCATGGGGAGGAGAACAGGGCC0.519600.157000.655200.750001.000001.00000


Target Position: 2960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2960AGGCAGAUGUGGGGCUGAG64.83231896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5962978AGGCAGATGTGGGGCTGAGCTCAGCCCCACATCTGCCT0.046700.002700.534500.500001.000001.00000


Target Position: 3786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3786ACGUCUUUAUUACCCAAGU69.77481336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5003804ACGTCTTTATTACCCAAGTACTTGGGTAATAAAGACGT0.609600.470400.569000.500000.994600.62500


Target Position: 2843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2843CGGAGGCAUCAUGGAAAGA79.9055446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3182861CGGAGGCATCATGGAAAGATCTTTCCATGATGCCTCCG0.462800.044700.689700.750001.000001.00000


Target Position: 3094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3094GGAGGCAAUCAAGCAGACA86.0842186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2093112GGAGGCAATCAAGCAGACATGTCTGCTTGATTGCCTCC0.322700.054300.663800.750000.951101.00000


Target Position: 4073, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4073CUGAUUAAACACAAACAGA87.9027130

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4071-4093GTCTGATTAAACACAAACAGACCUCUGUUUGUGUUUAAUCAGACCUGAUUAAACACAAACAGACCU16.78.922


Target Position: 1585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585ACGUGGAGCGGAUGAACUA86.3063176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001603ACGTGGAGCGGATGAACTATAGTTCATCCGCTCCACGT0.255500.002800.603400.750001.000001.00000


Target Position: 3144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3144CCUGGCCUCCUUCCCCGUA70.54311258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3263162CCTGGCCTCCTTCCCCGTATACGGGGAAGGAGGCCAGG0.619700.012300.663801.000000.923900.87500


Target Position: 1759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759CCCUCUAUGGCCGCUUCAC60.03012489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861777CCCTCTATGGCCGCTTCACGTGAAGCGGCCATAGAGGG0.079300.003100.698300.750000.972800.75000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782CCAGAUUGUCAACAACACA91.370354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
292800CCAGATTGTCAACAACACATGTGTTGTTGACAATCTGG0.243700.064700.637900.750000.994600.62500


Target Position: 3548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3548AGGGUCCCUGUGUGUGUGU64.49571940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4783566AGGGTCCCTGTGTGTGTGTACACACACACAGGGACCCT0.248700.032600.637900.500001.000001.00000


Target Position: 2046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2046GGGGAGAACCUCUAGGCAC73.3345976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5282064GGGGAGAACCTCTAGGCACGTGCCTAGAGGTTCTCCCC0.083600.002300.698300.750000.907600.62500


Target Position: 4105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4105UCAACAGUUAAAAAAAAAA79.6873463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3094123TCAACAGTTAAAAAAAAAATTTTTTTTTTAACTGTTGA0.983500.799500.724100.750001.000001.00000


Target Position: 2765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2765GGCCACGGAGCAGUUCAGA75.5805768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6252783GGCCACGGAGCAGTTCAGATCTGAACTGCTCCGTGGCC0.090600.001000.775900.750000.962000.62500


Target Position: 3757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3757GCCUAUGAAAUUUCAACUU78.1815561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2073775GCCTATGAAATTTCAACTTAAGTTGAAATTTCATAGGC0.791000.035600.862101.000001.000001.00000


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255ACAGAGCCAGGAUUUGAAA83.1584302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532273ACAGAGCCAGGATTTGAAATTTCAAATCCTGGCTCTGT0.135900.002200.706900.750001.000001.00000


Target Position: 2048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2048GGAGAACCUCUAGGCACAG73.1565990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4312066GGAGAACCTCTAGGCACAGCTGTGCCTAGAGGTTCTCC0.059600.008100.586200.750000.907600.75000


Target Position: 3026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3026UCGGCUUGUGGGUGAUGUU69.44871367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5893044TCGGCTTGTGGGTGATGTTAACATCACCCACAAGCCGA0.072800.001400.646600.750001.000001.00000


Target Position: 3634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3634CCGUCCCCCAAACAUGUUG57.16672796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4953652CCGTCCCCCAAACATGTTGCAACATGTTTGGGGGACGG0.040900.040800.767200.750000.967400.75000


Target Position: 3179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3179UUCAAUUCCUGGCCCUGUU60.4342449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5283197TTCAATTCCTGGCCCTGTTAACAGGGCCAGGAATTGAA0.095700.058600.525900.500001.000001.00000


Target Position: 3551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3551GUCCCUGUGUGUGUGUAUG69.67241340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3623569GTCCCTGTGTGTGTGTATGCATACACACACACAGGGAC0.109200.011000.663800.500001.000001.00000


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790UCAACAACACAGAGGGAGA77.966579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
615808TCAACAACACAGAGGGAGATCTCCCTCTGTGTTGTTGA0.015100.005900.500000.500001.000001.00000


Target Position: 2505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505CCCGCCUGCCUGCCACCCU56.93882820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2382523CCCGCCTGCCTGCCACCCTAGGGTGGCAGGCAGGCGGG0.421600.032400.646600.750000.940200.75000


Target Position: 2523, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2523UGCCCCUUGCCAUCCAUUC49.8193514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6202541TGCCCCTTGCCATCCATTCGAATGGATGGCAAGGGGCA0.075800.041200.681000.500000.972800.75000


Target Position: 3777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3777UCCUUUCAUACGUCUUUAU71.03261200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1293795TCCTTTCATACGTCTTTATATAAAGACGTATGAAAGGA0.506600.214600.827600.750001.000001.00000


Target Position: 4103, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4103GAUCAACAGUUAAAAAAAA98.95936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2074121GATCAACAGTTAAAAAAAATTTTTTTTAACTGTTGATC0.967900.770200.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4101-4123CTGATCAACAGTTAAAAAAAAAAUUUUUUUUAACUGUUGAUCAGGAUCAACAGUUAAAAAAAAAAU-11.320.5


Target Position: 715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715UUGUGGCCCUCUAUGACUA79.1068504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
613733TTGTGGCCCTCTATGACTATAGTCATAGAGGGCCACAA0.146400.001700.474100.500000.945700.75000


Target Position: 2687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2687ACCCUUCGAGAUCAUCACU69.98651318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3802705ACCCTTCGAGATCATCACTAGTGATGATCTCGAAGGGT0.427500.112500.646600.500001.000001.00000


Target Position: 2408, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2408CCGCUCACUGAACUCCUUC62.83552150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2832426CCGCTCACTGAACTCCTTCGAAGGAGTTCAGTGAGCGG0.724600.303500.741400.750000.918500.75000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819GCCCACUCGCUCAGCACAG64.77111908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475837GCCCACTCGCTCAGCACAGCTGTGCTGAGCGAGTGGGC0.047600.008400.715500.750000.913000.62500


Target Position: 1451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1451GGAGCCCAUUUACAUCGUC70.9421216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6061469GGAGCCCATTTACATCGTCGACGATGTAAATGGGCTCC0.049200.001200.551700.750001.000001.00000


Target Position: 4100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4100UCUGAUCAACAGUUAAAAA86.5654165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1564118TCTGATCAACAGTTAAAAATTTTTAACTGTTGATCAGA0.793100.050800.724100.750000.934800.62500


Target Position: 2761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2761CCAAGGCCACGGAGCAGUU75.528774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2132779CCAAGGCCACGGAGCAGTTAACTGCTCCGTGGCCTTGG0.192800.038700.698301.000000.962001.00000


Target Position: 3636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3636GUCCCCCAAACAUGUUGUA77.6861598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5023654GTCCCCCAAACATGTTGTATACAACATGTTTGGGGGAC0.039800.036200.637900.750000.951100.75000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825UCGCUCAGCACAGGACAGA63.7972028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393843TCGCTCAGCACAGGACAGATCTGTCCTGTGCTGAGCGA0.304400.026500.569000.500001.000001.00000


Target Position: 2303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2303CCUCUCCCUGCACUCCCUC55.25953021

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4672321CCTCTCCCTGCACTCCCTCGAGGGAGTGCAGGGAGAGG0.066700.049100.534500.750001.000001.00000


Target Position: 3901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3901UAAUACUGUCCUUUUUUUU72.11781095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4943919TAATACTGTCCTTTTTTTTAAAAAAAAGGACAGTATTA0.928900.148900.534500.500001.000001.00000


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397CAUGAAGAAGCUGAGGCAU79.0466506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6161415CATGAAGAAGCTGAGGCATATGCCTCAGCTTCTTCATG0.014700.001700.500000.750001.000001.00000


Target Position: 3109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3109GACAUAGAAGAGCCAAGAG78.4554550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6263127GACATAGAAGAGCCAAGAGCTCTTGGCTCTTCTATGTC0.019100.006400.508600.500000.967400.62500


Target Position: 2413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2413CACUGAACUCCUUCCCCAC74.3269876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5572431CACTGAACTCCTTCCCCACGTGGGGAAGGAGTTCAGTG0.486000.229500.500000.500000.989101.00000


Target Position: 1538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1538GCCUCAGCUGGUGGACAUG67.65481581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381556GCCTCAGCTGGTGGACATGCATGTCCACCAGCTGAGGC0.112300.004700.844800.750000.972800.75000


Target Position: 70, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
70GCCCCUUUCCCCUCUAGCC56.57872857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
54688GCCCCTTTCCCCTCTAGCCGGCTAGAGGGGAAAGGGGC0.234400.226400.500000.500001.000001.00000


Target Position: 751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
751CAGACCUGUCCUUCAAGAA90.795464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
591769CAGACCTGTCCTTCAAGAATTCTTGAAGGACAGGTCTG0.105100.001400.612100.750000.951100.75000


Target Position: 3185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3185UCCUGGCCCUGUUCUCCUC55.00233045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5083203TCCTGGCCCTGTTCTCCTCGAGGAGAACAGGGCCAGGA0.563900.053500.560300.500001.000001.00000


Target Position: 3930, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3930UGUUUUGUAGAUUUCAGAU78.7695524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4883948TGTTTTGTAGATTTCAGATATCTGAAATCTACAAAACA0.240600.047200.525900.750001.000001.00000


Target Position: 3754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3754CCUGCCUAUGAAAUUUCAA85.2828217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5533772CCTGCCTATGAAATTTCAATTGAAATTTCATAGGCAGG0.130100.001900.698301.000001.000001.00000


Target Position: 1643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1643AGAGAACCUGGUGUGCAAA84.5711243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861661AGAGAACCTGGTGTGCAAATTTGCACACCAGGTTCTCT0.044700.038100.724100.750001.000001.00000


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777CGGCUCCAGAUUGUCAACA74.9906812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
488795CGGCTCCAGATTGTCAACATGTTGACAATCTGGAGCCG0.105700.003100.706900.750001.000001.00000


Target Position: 3885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3885UUUGUGUAAGGUGUCUUAA72.70181041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6243903TTTGTGTAAGGTGTCTTAATTAAGACACCTTACACAAA0.028000.001500.465500.500000.978300.62500


Target Position: 59, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
59CACCUCAAGCAGCCCCUUU71.74371131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
20477CACCTCAAGCAGCCCCTTTAAAGGGGCTGCTTGAGGTG0.209300.104400.793100.750000.978300.62500


Target Position: 2439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439CCACCCCCGGUCUAUGUCG56.44012884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412457CCACCCCCGGTCTATGTCGCGACATAGACCGGGGGTGG0.043800.005300.551700.500000.956500.75000


Target Position: 4084, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4084CAAACAGACCUCAGAAUCU87.0097151

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4082-4104CACAAACAGACCTCAGAATCTGAAGAUUCUGAGGUCUGUUUGUGCAAACAGACCUCAGAAUCUGAU20.419.2


Target Position: 1165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1165GCCUGUGCCACCGCCUCAC59.20622572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131183GCCTGTGCCACCGCCTCACGTGAGGCGGTGGCACAGGC0.077200.002500.706900.750000.913001.00000


Target Position: 2516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2516GCCACCCUGCCCCUUGCCA65.59271817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2282534GCCACCCTGCCCCTTGCCATGGCAAGGGGCAGGGTGGC0.425000.197000.655200.750000.972800.75000


Target Position: 2134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134CUCUGCCUGCCUGCUGUUG54.9463055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6072152CTCTGCCTGCCTGCTGTTGCAACAGCAGGCAGGCAGAG0.017200.007300.663800.500000.951101.00000


Target Position: 2522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2522CUGCCCCUUGCCAUCCAUU68.11391520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3972540CTGCCCCTTGCCATCCATTAATGGATGGCAAGGGGCAG0.074500.036900.775900.750000.972800.75000


Target Position: 1394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394GGUCAUGAAGAAGCUGAGG64.3081963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151412GGTCATGAAGAAGCTGAGGCCTCAGCTTCTTCATGACC0.097800.003000.508600.500001.000001.00000


Target Position: 4036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4036GGUAUCCAGAAUUGGUUGU69.91751322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6044054GGTATCCAGAATTGGTTGTACAACCAATTCTGGATACC0.017300.002400.646600.750000.923901.00000


Target Position: 2703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2703ACUUCCUUGCCCCCAUUUC52.46873290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652721ACTTCCTTGCCCCCATTTCGAAATGGGGGCAAGGAAGT0.061000.024000.534500.500001.000001.00000


Target Position: 2517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2517CCACCCUGCCCCUUGCCAU70.53761259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2532535CCACCCTGCCCCTTGCCATATGGCAAGGGGCAGGGTGG0.144300.088800.689701.000000.972800.87500


Target Position: 3230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230AGGAGGGAAAAGAGUGCCU67.58591588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5353248AGGAGGGAAAAGAGTGCCTAGGCACTCTTTTCCCTCCT0.110700.003000.500000.500001.000001.00000


Target Position: 3905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3905ACUGUCCUUUUUUUUUUUU66.41551719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2773923ACTGTCCTTTTTTTTTTTTAAAAAAAAAAAAGGACAGT0.966300.198900.706900.750001.000001.00000


Target Position: 3252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3252CGGGGGUGAAAGAGGACGU69.93161321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4583270CGGGGGTGAAAGAGGACGTACGTCCTCTTTCACCCCCG0.414300.004000.637900.750001.000001.00000


Target Position: 2143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2143CCUGCUGUUGGUCCUCUCU73.3166981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182161CCTGCTGTTGGTCCTCTCTAGAGAGGACCAACAGCAGG0.039800.002400.620700.750001.000001.00000


Target Position: 4040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4040UCCAGAAUUGGUUGUAAAU73.0517999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5844058TCCAGAATTGGTTGTAAATATTTACAACCAATTCTGGA0.020200.006100.862100.750000.923900.62500


Target Position: 644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644AGGCUUCAACUCCUCGGAC62.97092132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
617662AGGCTTCAACTCCTCGGACGTCCGAGGAGTTGAAGCCT0.034600.003200.525900.500000.940200.62500


Target Position: 2328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2328CUCUGUGGGUCUCUGGAAG69.09441409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5052346CTCTGTGGGTCTCTGGAAGCTTCCAGAGACCCACAGAG0.055800.002700.672400.500001.000001.00000


Target Position: 3231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3231GGAGGGAAAAGAGUGCCUA87.5053140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4413249GGAGGGAAAAGAGTGCCTATAGGCACTCTTTTCCCTCC0.128100.004700.698301.000001.000001.00000


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344ACCCUGAAGCCUGGCACGA62.66362173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561362ACCCTGAAGCCTGGCACGATCGTGCCAGGCTTCAGGGT0.036400.001800.560300.500000.956500.62500


Target Position: 2817, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2817GUCAUCCUCAGGAACCAAC63.34252084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3482835GTCATCCTCAGGAACCAACGTTGGTTCCTGAGGATGAC0.106400.080000.672400.500000.967401.00000


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109CACCCAGUUCAACAGCCUG71.59811142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201127CACCCAGTTCAACAGCCTGCAGGCTGTTGAACTGGGTG0.114600.006400.508600.500000.913000.62500


Target Position: 1102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102CCUCCCGCACCCAGUUCAA78.5197545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701120CCTCCCGCACCCAGTTCAATTGAACTGGGTGCGGGAGG0.134200.056500.698301.000000.907601.00000


Target Position: 3167, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3167GUCCCGUGGCAUUUCAAUU76.9605651

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7316719GTCCCGTGGCATTTCAATT1/1/0/091.46SRCNM_198291.1+NM_005417.31+1NANANA20:36032889..36032907(+)00SRC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3163185GTCCCGTGGCATTTCAATTAATTGAAATGCCACGGGAC0.769400.013200.810300.750001.000001.00000


Target Position: 2631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2631UGGUGGGUGGGUGGGAUGA63.02052125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5432649TGGTGGGTGGGTGGGATGATCATCCCACCCACCCACCA0.030200.002900.620700.500001.000001.00000


Target Position: 2888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2888CUGAGGAUGCAUUCGAGAU82.336339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3462906CTGAGGATGCATTCGAGATATCTCGAATGCATCCTCAG0.115500.042300.603400.750001.000001.00000


Target Position: 3444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3444CUGGGCUCUGGCUCUGUUC60.31512459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5383462CTGGGCTCTGGCTCTGTTCGAACAGAGCCAGAGCCCAG0.179700.002000.612100.500001.000001.00000


Target Position: 2440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2440CACCCCCGGUCUAUGUCGA76.1999717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5512458CACCCCCGGTCTATGTCGATCGACATAGACCGGGGGTG0.049000.004000.500000.500000.956500.62500


Target Position: 3147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3147GGCCUCCUUCCCCGUACUU68.57291468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1313165GGCCTCCTTCCCCGTACTTAAGTACGGGGAAGGAGGCC0.656900.061700.862101.000001.000001.00000


Target Position: 1289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1289CUUUGGCGAGGUGUGGAUG60.79382403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5921307CTTTGGCGAGGTGTGGATGCATCCACACCTCGCCAAAG0.032600.001900.482800.500001.000001.00000


Target Position: 2427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2427CCCACUUCUGUGCCACCCC53.66333196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6012445CCCACTTCTGTGCCACCCCGGGGTGGCACAGAAGTGGG0.017900.009000.500000.500000.913000.75000


Target Position: 2407, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2407UCCGCUCACUGAACUCCUU69.59021352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2762425TCCGCTCACTGAACTCCTTAAGGAGTTCAGTGAGCGGA0.602800.271600.732800.750000.918500.87500


Target Position: 2728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2728GGGGAGACAGUUGAGAGCG64.42071947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5802746GGGGAGACAGTTGAGAGCGCGCTCTCAACTGTCTCCCC0.020600.001700.569000.500001.000001.00000


Target Position: 4037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4037GUAUCCAGAAUUGGUUGUA81.7867364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6114055GTATCCAGAATTGGTTGTATACAACCAATTCTGGATAC0.015400.002300.500000.750000.923901.00000


Target Position: 2841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2841GUCGGAGGCAUCAUGGAAA87.0055152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2842859GTCGGAGGCATCATGGAAATTTCCATGATGCCTCCGAC0.418900.028300.819000.750001.000001.00000


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221CAGAGAAGUGAAGCAACUU84.6482237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
536239CAGAGAAGTGAAGCAACTTAAGTTGCTTCACTTCTCTG0.031900.003800.646600.750001.000001.00000


Target Position: 61, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
61CCUCAAGCAGCCCCUUUCC56.14242923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
60279CCTCAAGCAGCCCCTTTCCGGAAAGGGGCTGCTTGAGG0.470100.126400.474100.500000.978300.87500


Target Position: 3768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3768UUCAACUUUUCCUUUCAUA73.9225913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4423786TTCAACTTTTCCTTTCATATATGAAAGGAAAAGTTGAA0.290800.131400.629300.500001.000001.00000


Target Position: 2520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2520CCCUGCCCCUUGCCAUCCA70.14381300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3892538CCCTGCCCCTTGCCATCCATGGATGGCAAGGGGCAGGG0.077100.049400.646600.750000.972801.00000


Target Position: 3925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3925AACAGUGUUUUGUAGAUUU81.8408361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6173943AACAGTGTTTTGTAGATTTAAATCTACAAAACACTGTT0.128800.001100.646600.500001.000001.00000


Target Position: 3935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3935UGUAGAUUUCAGAUGACUA93.267430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4753953TGTAGATTTCAGATGACTATAGTCATCTGAAATCTACA0.244900.063000.534500.750001.000001.00000


Target Position: 3592, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3592CAUGUGCGUCCAUAUUUAA95.474616

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8359219CATGTGCGTCCATATTTAA1/1/0/091.46SRCNM_198291.1+NM_005417.31+1NANANA20:36033314..36033332(+)00SRC(0.002)


Target Position: 104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
104AAGAGCUACCAUUCAUCUA86.7739158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
619122AAGAGCTACCATTCATCTATAGATGAATGGTAGCTCTT0.414900.005700.465500.500001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108GCACCCAGUUCAACAGCCU77.1763640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211126GCACCCAGTTCAACAGCCTAGGCTGTTGAACTGGGTGC0.149900.013900.508600.750001.000001.00000


Target Position: 2709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2709UUGCCCCCAUUUCACCCAU55.74972964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5882727TTGCCCCCATTTCACCCATATGGGTGAAATGGGGGCAA0.029400.017300.491400.500001.000001.00000


Target Position: 68, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
68CAGCCCCUUUCCCCUCUAG64.49171941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
43186CAGCCCCTTTCCCCTCTAGCTAGAGGGGAAAGGGGCTG0.259300.029300.612100.500001.000001.00000


Target Position: 1287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1287UGCUUUGGCGAGGUGUGGA67.10691642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5951305TGCTTTGGCGAGGTGTGGATCCACACCTCGCCAAAGCA0.056400.003000.482800.500000.983700.75000


Target Position: 3250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3250AGCGGGGGUGAAAGAGGAC59.07322592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5363268AGCGGGGGTGAAAGAGGACGTCCTCTTTCACCCCCGCT0.427600.009700.534500.500001.000001.00000


Target Position: 3763, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3763GAAAUUUCAACUUUUCCUU78.8325518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4763781GAAATTTCAACTTTTCCTTAAGGAAAAGTTGAAATTTC0.224300.104900.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3761-3783ATGAAATTTCAACTTTTCCTTTCAAGGAAAAGUUGAAAUUUCAUGAAAUUUCAACUUUUCCUUUCU18.70.422


Target Position: 2976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2976GAGCUGGGGAAUCAGGGUA82.5717329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5062994GAGCTGGGGAATCAGGGTATACCCTGATTCCCCAGCTC0.130400.002700.629300.750000.945700.87500


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901GGUAUUUUGGCAAGAUCAC70.7231239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471919GGTATTTTGGCAAGATCACGTGATCTTGCCAAAATACC0.048800.008000.560300.750001.000001.00000


Target Position: 3524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3524CUGACAGUUUGUGGCAUCU75.079808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6003542CTGACAGTTTGTGGCATCTAGATGCCACAAACTGTCAG0.018000.003100.560300.500001.000001.00000


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345CCCUGAAGCCUGGCACGAU78.3908554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5341363CCCTGAAGCCTGGCACGATATCGTGCCAGGCTTCAGGG0.039500.002100.810301.000000.962000.75000


Target Position: 3006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3006UGUGGAGAGAGAGGCUUCA74.2554884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5973024TGTGGAGAGAGAGGCTTCATGAAGCCTCTCTCTCCACA0.018700.002400.482800.500001.000001.00000


Target Position: 254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
254GACAGAGCCAGGAUUUGAA95.460717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
565272GACAGAGCCAGGATTTGAATTCAAATCCTGGCTCTGTC0.023600.002100.646600.750001.000001.00000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836AGGACAGACAGGCUACAUC71.44211159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512854AGGACAGACAGGCTACATCGATGTAGCCTGTCTGTCCT0.037800.029100.663800.500001.000001.00000


Target Position: 4099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4099AUCUGAUCAACAGUUAAAA81.2241389

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4404117ATCTGATCAACAGTTAAAATTTTAACTGTTGATCAGAT0.779000.048700.681000.500000.934800.75000


Target Position: 3098, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3098GCAAUCAAGCAGACAUAGA87.7276134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3073116GCAATCAAGCAGACATAGATCTATGTCTGCTTGATTGC0.371100.152700.629300.750000.989100.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3096-3118AGGCAATCAAGCAGACATAGAAGUCUAUGUCUGCUUGAUUGCCUGCAAUCAAGCAGACAUAGAAGU20.313.822


Target Position: 2701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2701UCACUUCCUUGCCCCCAUU65.03611876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3602719TCACTTCCTTGCCCCCATTAATGGGGGCAAGGAAGTGA0.085000.033000.715500.750001.000001.00000


Target Position: 2128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128GCCCCACUCUGCCUGCCUG67.81531560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4812146GCCCCACTCTGCCTGCCTGCAGGCAGGCAGAGTGGGGC0.099300.003300.715500.750001.000001.00000


Target Position: 3637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3637UCCCCCAAACAUGUUGUAC50.54393454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5093655TCCCCCAAACATGTTGTACGTACAACATGTTTGGGGGA0.038300.031900.689700.500000.951100.75000


Target Position: 3555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3555CUGUGUGUGUGUAUGUGUG78.1177566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5903573CTGTGTGTGTGTATGTGTGCACACATACACACACACAG0.052700.020800.491400.500001.000001.00000


Target Position: 362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
362GACCCCUGACUCCACACCU74.9373817

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
604380GACCCCTGACTCCACACCTAGGTGTGGAGTCAGGGGTC0.018200.008300.474100.500001.000001.00000


Target Position: 1721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721UGCCAAAUUCCCCAUCAAG63.83422023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911739TGCCAAATTCCCCATCAAGCTTGATGGGGAATTTGGCA0.205600.012200.715500.500001.000001.00000


Target Position: 3703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3703GGGUUCUUGAGCCAGCCAG64.90491889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5873721GGGTTCTTGAGCCAGCCAGCTGGCTGGCTCAAGAACCC0.019800.015500.706900.750001.000001.00000


Target Position: 100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
100CCGCAAGAGCUACCAUUCA83.1419303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496118CCGCAAGAGCTACCATTCATGAATGGTAGCTCTTGCGG0.512100.002900.689700.750000.929300.75000


Target Position: 195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
195GUUUUACAGAACAGAGAAC72.08551096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554213GTTTTACAGAACAGAGAACGTTCTCTGTTCTGTAAAAC0.120400.014000.500000.500001.000001.00000


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877CCGACUCCAUCCAGGCUGA80.3189423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452895CCGACTCCATCCAGGCTGATCAGCCTGGATGGAGTCGG0.052600.005100.689700.750000.945701.00000


Target Position: 3931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3931GUUUUGUAGAUUUCAGAUG68.4871479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6143949GTTTTGTAGATTTCAGATGCATCTGAAATCTACAAAAC0.245200.055600.491400.500001.000001.00000


Target Position: 2435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2435UGUGCCACCCCCGGUCUAU61.66462295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5822453TGTGCCACCCCCGGTCTATATAGACCGGGGGTGGCACA0.023800.001500.663800.750000.929301.00000


Target Position: 4106, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4106CAACAGUUAAAAAAAAAAA89.856784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3104124CAACAGTTAAAAAAAAAAATTTTTTTTTTTAACTGTTG0.983900.799900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
4104-4126ATCAACAGTTAAAAAAAAAAAAAUUUUUUUUUUUAACUGUUGAUCAACAGUUAAAAAAAAAAAAAU-11.317.80


Target Position: 4102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4102UGAUCAACAGUUAAAAAAA89.794985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3244120TGATCAACAGTTAAAAAAATTTTTTTAACTGTTGATCA0.898000.760100.724100.750001.000001.00000


Target Position: 3149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3149CCUCCUUCCCCGUACUUUG68.04421527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2293167CCTCCTTCCCCGTACTTTGCAAAGTACGGGGAAGGAGG0.404500.102400.698300.750001.000001.00000


Target Position: 101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
101CGCAAGAGCUACCAUUCAU88.7545112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454119CGCAAGAGCTACCATTCATATGAATGGTAGCTCTTGCG0.750700.004100.767201.000000.929300.75000


Target Position: 3641, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3641CCAAACAUGUUGUACAUUU83.4404294

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4364119CCAAACATGTTGTACATTT1/1/0/093.71SRCNM_198291.1+NM_005417.31+1NANANA20:36033363..36033381(+)00SRC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2793659CCAAACATGTTGTACATTTAAATGTACAACATGTTTGG0.129000.026600.844801.000000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3639-3661CCCCAAACATGTTGTACATTTCAAAAUGUACAACAUGUUUGGGGCCAAACAUGUUGUACAUUUCAU14.612.122


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770AGGCGAGCGGCUCCAGAUU68.98921422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
599788AGGCGAGCGGCTCCAGATTAATCTGGAGCCGCTCGCCT0.086000.001300.836200.750000.962001.00000


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220UCAGAGAAGUGAAGCAACU73.00991006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563238TCAGAGAAGTGAAGCAACTAGTTGCTTCACTTCTCTGA0.024400.003600.517200.500001.000001.00000


Target Position: 2999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2999GUGCAGGUGUGGAGAGAGA86.4147170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6023017GTGCAGGTGTGGAGAGAGATCTCTCTCCACACCTGCAC0.072800.001200.569000.500001.000001.00000


Target Position: 181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
181CCAUGUUCACUCCGGUUUU77.5562606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
428199CCATGTTCACTCCGGTTTTAAAACCGGAGTGAACATGG0.064000.005000.844801.000001.000001.00000


Target Position: 214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
214AGAAGCUCAGAGAAGUGAA89.422697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567232AGAAGCTCAGAGAAGTGAATTCACTTCTCTGAGCTTCT0.023500.003700.551700.750001.000001.00000


Target Position: 3910, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3910CCUUUUUUUUUUUUUAACA81.552374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4103928CCTTTTTTTTTTTTTAACATGTTAAAAAAAAAAAAAGG0.070400.049800.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3908-3930GTCCTTTTTTTTTTTTTAACAGTUGUUAAAAAAAAAAAAAGGACCCUUUUUUUUUUUUUAACAGUU0.0-5.901


Target Position: 3702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3702GGGGUUCUUGAGCCAGCCA80.0055437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4983720GGGGTTCTTGAGCCAGCCATGGCTGGCTCAAGAACCCC0.040300.010600.646600.750001.000001.00000


Target Position: 193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
193CGGUUUUACAGAACAGAGA85.1069224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442211CGGTTTTACAGAACAGAGATCTCTGTTCTGTAAAACCG0.075300.004500.689700.750001.000001.00000


Target Position: 2958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2958GGAGGCAGAUGUGGGGCUG64.61181927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082976GGAGGCAGATGTGGGGCTGCAGCCCCACATCTGCCTCC0.038500.002800.586200.750001.000001.00000


Target Position: 3169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3169CCCGUGGCAUUUCAAUUCC56.50022874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4863187CCCGTGGCATTTCAATTCCGGAATTGAAATGCCACGGG0.672700.011300.620700.500001.000001.00000


Target Position: 3599, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3599GUCCAUAUUUAACAUGUAA94.857419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3383617GTCCATATTTAACATGTAATTACATGTTAAATATGGAC0.095600.035400.784500.750000.929300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3597-3619GCGTCCATATTTAACATGTAAAAUUACAUGUUAAAUAUGGACGCGUCCAUAUUUAACAUGUAAAAU20.421.222


Target Position: 2521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2521CCUGCCCCUUGCCAUCCAU71.35911171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4142539CCTGCCCCTTGCCATCCATATGGATGGCAAGGGGCAGG0.069100.042800.689701.000000.972800.87500


Target Position: 2409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409CGCUCACUGAACUCCUUCC69.24491390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232427CGCTCACTGAACTCCTTCCGGAAGGAGTTCAGTGAGCG0.819000.320500.551700.500000.918500.62500


Target Position: 1637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1637GGUGGGAGAGAACCUGGUG72.21241087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5311655GGTGGGAGAGAACCTGGTGCACCAGGTTCTCTCCCACC0.119700.002200.560300.750000.972801.00000


Target Position: 2466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466CCAAAGAGCCUUUCCAAAG68.88251433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3202484CCAAAGAGCCTTTCCAAAGCTTTGGAAAGGCTCTTTGG0.145000.022700.706900.750001.000001.00000


Target Position: 4107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4107AACAGUUAAAAAAAAAAAA81.2938386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4904125AACAGTTAAAAAAAAAAAATTTTTTTTTTTTAACTGTT0.984500.802200.646600.500001.000001.00000


Target Position: 2981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2981GGGGAAUCAGGGUAAAAGG68.9711424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5292999GGGGAATCAGGGTAAAAGGCCTTTTACCCTGATTCCCC0.309700.058600.646600.500001.000001.00000


Target Position: 3253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3253GGGGGUGAAAGAGGACGUG64.51491939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4803271GGGGGTGAAAGAGGACGTGCACGTCCTCTTTCACCCCC0.401100.003300.698300.750001.000001.00000


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975CUCGUGCGAGAAAGUGAGA76.884659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
492993CTCGTGCGAGAAAGTGAGATCTCACTTTCTCGCACGAG0.146400.009300.586200.500000.972800.62500


Target Position: 3673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3673UCAUCAUAGCAAUAACAUU83.1004305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1273691TCATCATAGCAATAACATTAATGTTATTGCTATGATGA0.832500.397500.715500.750000.978300.62500


Target Position: 1615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615ACCUUCGUGCAGCCAACAU68.03181529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4451633ACCTTCGTGCAGCCAACATATGTTGGCTGCACGAAGGT0.054600.012700.698300.750000.994600.87500


Target Position: 3896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3896UGUCUUAAUACUGUCCUUU70.79641231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4023914TGTCTTAATACTGTCCTTTAAAGGACAGTATTAAGACA0.256200.006200.706900.750001.000001.00000


Target Position: 3844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3844CCCAGCGAGCUCUCAAAUC62.71762164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2753862CCCAGCGAGCTCTCAAATCGATTTGAGAGCTCGCTGGG0.748500.018100.810300.750001.000001.00000


Target Position: 2851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2851UCAUGGAAAGACUGGGACA79.054505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182869TCATGGAAAGACTGGGACATGTCCCAGTCTTTCCATGA0.013900.013400.517200.500001.000001.00000


Target Position: 3809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3809UCCCGUCCAUUCCAGUCAA76.1674718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2403827TCCCGTCCATTCCAGTCAATTGACTGGAATGGACGGGA0.154100.132400.724100.750000.913000.75000


Target Position: 3897, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3897GUCUUAAUACUGUCCUUUU86.1638183

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1389719GTCTTAATACTGTCCTTTT1/1/0/097.75SRCNM_198291.1+NM_005417.31+1NANANA20:36033619..36033637(+)00SRC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3973915GTCTTAATACTGTCCTTTTAAAAGGACAGTATTAAGAC0.278300.006500.819000.750001.000001.00000


Target Position: 2983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2983GGAAUCAGGGUAAAAGGUG69.32051379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3883001GGAATCAGGGTAAAAGGTGCACCTTTTACCCTGATTCC0.100700.041400.577600.750001.000001.00000


Target Position: 2400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400AGCCUACUCCGCUCACUGA84.1872264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3942418AGCCTACTCCGCTCACTGATCAGTGAGCGGAGTAGGCT0.373400.076500.629300.500000.902200.62500


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723CCAAAUUCCCCAUCAAGUG67.76121567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6101741CCAAATTCCCCATCAAGTGCACTTGATGGGGAATTTGG0.016100.016600.551700.750001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586CGUGGAGCGGAUGAACUAC71.90141117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5551604CGTGGAGCGGATGAACTACGTAGTTCATCCGCTCCACG0.139100.001800.594800.750001.000001.00000


Target Position: 2825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2825CAGGAACCAACAAUUCGUC69.26311386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6222843CAGGAACCAACAATTCGTCGACGAATTGTTGGTTCCTG0.070400.017800.465500.500000.978300.75000


Target Position: 2387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2387CUUUUCCAGCCUCAGCCUA75.0891807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6272405CTTTTCCAGCCTCAGCCTATAGGCTGAGGCTGGAAAAG0.020200.003400.465500.750000.951100.75000


Target Position: 3557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3557GUGUGUGUGUAUGUGUGUG75.3564787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6083575GTGTGTGTGTATGTGTGTGCACACACATACACACACAC0.017200.015500.500000.500001.000001.00000


Target Position: 646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646GCUUCAACUCCUCGGACAC71.80941125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
585664GCTTCAACTCCTCGGACACGTGTCCGAGGAGTTGAAGC0.020200.012900.560300.750001.000001.00000


Target Position: 1450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1450AGGAGCCCAUUUACAUCGU66.72571678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821468AGGAGCCCATTTACATCGTACGATGTAAATGGGCTCCT0.046100.004300.569000.500001.000001.00000


Target Position: 2659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2659CAAACCCUGCCCUCCUUAG65.75271800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6032677CAAACCCTGCCCTCCTTAGCTAAGGAGGGCAGGGTTTG0.030600.024500.474100.500001.000001.00000


Target Position: 1347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1347CUGAAGCCUGGCACGAUGU68.62511458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5791365CTGAAGCCTGGCACGATGTACATCGTGCCAGGCTTCAG0.120500.007800.577600.500001.000001.00000


Target Position: 252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
252GAGACAGAGCCAGGAUUUG71.90711116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
622270GAGACAGAGCCAGGATTTGCAAATCCTGGCTCTGTCTC0.013500.001900.663800.500001.000001.00000


Target Position: 2575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2575GACCCUCUGCCGCUGCUUC66.51781701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4482593GACCCTCTGCCGCTGCTTCGAAGCAGCGGCAGAGGGTC0.158800.008800.646600.500000.962000.87500


Target Position: 3899, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3899CUUAAUACUGUCCUUUUUU77.304629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2713917CTTAATACTGTCCTTTTTTAAAAAAGGACAGTATTAAG0.928400.022600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3897-3919GTCTTAATACTGTCCTTTTTTTTAAAAAAGGACAGUAUUAAGACCUUAAUACUGUCCUUUUUUUUU9.51.422


Target Position: 79, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79CCCUCUAGCCUCAGUUUAU85.327215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7897CCCTCTAGCCTCAGTTTATATAAACTGAGGCTAGAGGG0.549500.133000.948301.000001.000001.00000


Target Position: 1145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1145CUACUCCAAACACGCCGAU67.68051577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751163CTACTCCAAACACGCCGATATCGGCGTGTTTGGAGTAG0.039300.040000.491400.750001.000001.00000


Target Position: 4032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4032GGGGGGUAUCCAGAAUUGG61.59682302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6284050GGGGGGTATCCAGAATTGGCCAATTCTGGATACCCCCC0.102300.003400.646600.500000.923900.62500


Target Position: 3906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3906CUGUCCUUUUUUUUUUUUU71.78391129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1073924CTGTCCTTTTTTTTTTTTTAAAAAAAAAAAAAGGACAG0.970500.265100.784500.750001.000001.00000


Target Position: 3862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3862CCCUCUCCAACUGCCUAAG59.54692528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5983880CCCTCTCCAACTGCCTAAGCTTAGGCAGTTGGAGAGGG0.018100.020000.853400.750001.000001.00000


Target Position: 262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262CAGGAUUUGAAACCAGAUG67.51081598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514280CAGGATTTGAAACCAGATGCATCTGGTTTCAAATCCTG0.037000.004400.629300.500000.967400.75000


Target Position: 3811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3811CCGUCCAUUCCAGUCAAAU75.4128780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2483829CCGTCCATTCCAGTCAAATATTTGACTGGAATGGACGG0.147700.109200.905201.000000.972800.62500


Target Position: 1452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452GAGCCCAUUUACAUCGUCA92.591642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6121470GAGCCCATTTACATCGTCATGACGATGTAAATGGGCTC0.057100.001100.586200.500001.000001.00000


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768GCCGCUUCACCAUCAAGUC68.29531499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5451786GCCGCTTCACCATCAAGTCGACTTGATGGTGAAGCGGC0.151700.002000.681000.750000.983700.62500


Target Position: 3203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3203CCCCAAGUCGGCACCCUUU70.95981211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3773221CCCCAAGTCGGCACCCTTTAAAGGGTGCCGACTTGGGG0.124000.007500.991401.000000.907600.75000


Target Position: 1616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616CCUUCGUGCAGCCAACAUC68.93071428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5091634CCTTCGTGCAGCCAACATCGATGTTGGCTGCACGAAGG0.048500.002600.663800.750000.994600.87500


Target Position: 4039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4039AUCCAGAAUUGGUUGUAAA87.1479147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6284057ATCCAGAATTGGTTGTAAATTTACAACCAATTCTGGAT0.011600.001900.681000.500000.923900.75000


Target Position: 256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256CAGAGCCAGGAUUUGAAAC67.03361647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568274CAGAGCCAGGATTTGAAACGTTTCAAATCCTGGCTCTG0.083800.001700.637900.500001.000001.00000


Target Position: 2215, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2215GGGCUUCUGGACCUAGGGU71.06921194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6132233GGGCTTCTGGACCTAGGGTACCCTAGGTCCAGAAGCCC0.015300.001500.637900.750000.913000.62500


Target Position: 3756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3756UGCCUAUGAAAUUUCAACU70.95771212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3883774TGCCTATGAAATTTCAACTAGTTGAAATTTCATAGGCA0.912400.034500.646600.500001.000001.00000


Target Position: 1641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1641GGAGAGAACCUGGUGUGCA89.339100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041659GGAGAGAACCTGGTGTGCATGCACACCAGGTTCTCTCC0.063600.052800.517200.750001.000001.00000


Target Position: 3105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3105AGCAGACAUAGAAGAGCCA82.8506316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5543123AGCAGACATAGAAGAGCCATGGCTCTTCTATGTCTGCT0.027500.011600.508600.500000.902200.62500


Target Position: 2978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2978GCUGGGGAAUCAGGGUAAA82.8328318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2382996GCTGGGGAATCAGGGTAAATTTACCCTGATTCCCCAGC0.165900.029300.853401.000000.945700.62500


Target Position: 4098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4098AAUCUGAUCAACAGUUAAA89.3154101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5084116AATCTGATCAACAGTTAAATTTAACTGTTGATCAGATT0.774300.047700.508600.500000.934800.87500


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832GCACAGGACAGACAGGCUA87.6241137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
330850GCACAGGACAGACAGGCTATAGCCTGTCTGTCCTGTGC0.099000.017000.681001.000001.000001.00000


Target Position: 1100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100CACCUCCCGCACCCAGUUC56.81262833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271118CACCTCCCGCACCCAGTTCGAACTGGGTGCGGGAGGTG0.121200.049600.620700.500000.907600.87500


Target Position: 242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
242CCAGCUAUGAGAGACAGAG72.85511025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484260CCAGCTATGAGAGACAGAGCTCTGTCTCTCATAGCTGG0.071700.003200.534500.750001.000001.00000


Target Position: 1454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1454GCCCAUUUACAUCGUCACG64.08391990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721472GCCCATTTACATCGTCACGCGTGACGATGTAAATGGGC0.072700.004200.724100.500001.000001.00000


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876UCCGACUCCAUCCAGGCUG44.40913809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450894TCCGACTCCATCCAGGCTGCAGCCTGGATGGAGTCGGA0.053100.005200.586200.500000.923900.62500


Target Position: 3193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3193CUGUUCUCCUCCCCAAGUC61.31562347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6183211CTGTTCTCCTCCCCAAGTCGACTTGGGGAGGAGAACAG0.377200.273300.465500.500000.989100.75000


Target Position: 3210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3210UCGGCACCCUUUAACUCAU71.45781156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3723228TCGGCACCCTTTAACTCATATGAGTTAAAGGGTGCCGA0.119400.007800.637900.750001.000001.00000


Target Position: 2434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434CUGUGCCACCCCCGGUCUA73.5787952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5952452CTGTGCCACCCCCGGTCTATAGACCGGGGGTGGCACAG0.025700.001300.612100.750000.929301.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476UACAUGAGCAAGGGGAGUU63.42342069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161494TACATGAGCAAGGGGAGTTAACTCCCCTTGCTCATGTA0.082400.002400.534500.500001.000001.00000


Target Position: 3000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000UGCAGGUGUGGAGAGAGAG61.83552274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6253018TGCAGGTGTGGAGAGAGAGCTCTCTCTCCACACCTGCA0.058100.006900.543100.500001.000001.00000


Target Position: 3672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3672CUCAUCAUAGCAAUAACAU79.3334489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2963690CTCATCATAGCAATAACATATGTTATTGCTATGATGAG0.665100.381600.655200.750000.978300.62500


Target Position: 547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
547CCGCCUCGCAGACCCCCAG56.07772933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312565CCGCCTCGCAGACCCCCAGCTGGGGGTCTGCGAGGCGG0.382000.020000.629300.750000.902200.75000


Target Position: 1720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1720GUGCCAAAUUCCCCAUCAA90.889162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451738GTGCCAAATTCCCCATCAATTGATGGGGAATTTGGCAC0.260600.010300.646600.750001.000001.00000


Target Position: 2133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2133ACUCUGCCUGCCUGCUGUU70.34661274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4302151ACTCTGCCTGCCTGCTGTTAACAGCAGGCAGGCAGAGT0.075700.030500.560300.750000.951101.00000


Target Position: 3597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3597GCGUCCAUAUUUAACAUGU79.6624466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3413615GCGTCCATATTTAACATGTACATGTTAAATATGGACGC0.093300.033900.715500.750000.929300.62500


Target Position: 3602, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3602CAUAUUUAACAUGUAAAAA91.381252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3600-3622TCCATATTTAACATGTAAAAATGUUUUUACAUGUUAAAUAUGGACAUAUUUAACAUGUAAAAAUGU7.2-8.032


Target Position: 4104, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4104AUCAACAGUUAAAAAAAAA80.8993400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6064122ATCAACAGTTAAAAAAAAATTTTTTTTTAACTGTTGAT0.983300.797700.681000.500001.000001.00000


Target Position: 3289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3289CCAGGACUGGCUGUGUAAC66.84381666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4803307CCAGGACTGGCTGTGTAACGTTACACAGCCAGTCCTGG0.046200.005400.698300.750000.940200.62500


Target Position: 888, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888CAGGCUGAGGAGUGGUAUU82.271340

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_688819CAGGCTGAGGAGTGGTATT1/1/0/091.46SRCNM_198291.1+NM_005417.31+1NANANANA00SRC(0.002)


Target Position: 222, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
222AGAGAAGUGAAGCAACUUG72.62421045

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608240AGAGAAGTGAAGCAACTTGCAAGTTGCTTCACTTCTCT0.039700.003900.577600.500001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776GCGGCUCCAGAUUGUCAAC69.00811420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544794GCGGCTCCAGATTGTCAACGTTGACAATCTGGAGCCGC0.099400.002000.775900.750001.000001.00000


Target Position: 3165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3165UUGUCCCGUGGCAUUUCAA71.96721111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5803183TTGTCCCGTGGCATTTCAATTGAAATGCCACGGGACAA0.129500.013200.500000.500001.000001.00000


Target Position: 3160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3160GUACUUUGUCCCGUGGCAU75.4276778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5793178GTACTTTGTCCCGTGGCATATGCCACGGGACAAAGTAC0.020600.014600.525900.750001.000001.00000


Target Position: 3093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3093UGGAGGCAAUCAAGCAGAC64.03511994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5913111TGGAGGCAATCAAGCAGACGTCTGCTTGATTGCCTCCA0.308100.053100.525900.500000.951101.00000


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453AGCCCAUUUACAUCGUCAC65.27031850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6071471AGCCCATTTACATCGTCACGTGACGATGTAAATGGGCT0.076100.001200.560300.500001.000001.00000


Target Position: 789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789GUCAACAACACAGAGGGAG59.33342552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
617807GTCAACAACACAGAGGGAGCTCCCTCTGTGTTGTTGAC0.013900.005300.508600.500001.000001.00000


Target Position: 3163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3163CUUUGUCCCGUGGCAUUUC58.41512665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6283181CTTTGTCCCGTGGCATTTCGAAATGCCACGGGACAAAG0.020900.013500.465500.500001.000001.00000


Target Position: 3162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3162ACUUUGUCCCGUGGCAUUU64.16561983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5663180ACTTTGTCCCGTGGCATTTAAATGCCACGGGACAAAGT0.023600.014000.706900.750001.000001.00000


Target Position: 1446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1446UCAGAGGAGCCCAUUUACA76.782667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6211464TCAGAGGAGCCCATTTACATGTAAATGGGCTCCTCTGA0.082100.018800.517200.500001.000001.00000


Target Position: 3108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3108AGACAUAGAAGAGCCAAGA80.3867418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5753126AGACATAGAAGAGCCAAGATCTTGGCTCTTCTATGTCT0.021100.006700.500000.500000.902200.62500


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452GGGUAGCAACAAGAGCAAG74.2591883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376470GGGTAGCAACAAGAGCAAGCTTGCTCTTGTTGCTACCC0.082000.007600.853400.750000.962000.87500


Target Position: 923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923ACGGGAGUCAGAGCGGUUA73.5846951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555941ACGGGAGTCAGAGCGGTTATAACCGCTCTGACTCCCGT0.026700.001900.741400.750001.000001.00000


Target Position: 3110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3110ACAUAGAAGAGCCAAGAGU73.04651001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5993128ACATAGAAGAGCCAAGAGTACTCTTGGCTCTTCTATGT0.021400.006700.500000.500001.000001.00000


Target Position: 199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
199UACAGAACAGAGAACAGAA91.378453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514217TACAGAACAGAGAACAGAATTCTGTTCTCTGTTCTGTA0.120400.030200.508600.500001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318AGGGACACACAGCGGGGAG57.93262710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
461336AGGGACACACAGCGGGGAGCTCCCCGCTGTGTGTCCCT0.165400.058600.534500.500001.000001.00000


Target Position: 2526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2526CCCUUGCCAUCCAUUCUGG61.7832282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5942544CCCTTGCCATCCATTCTGGCCAGAATGGATGGCAAGGG0.018600.005900.646600.500000.945700.62500


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771GGCGAGCGGCUCCAGAUUG67.15891633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
579789GGCGAGCGGCTCCAGATTGCAATCTGGAGCCGCTCGCC0.037900.001600.853400.750000.962000.87500


Target Position: 3802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3802AGUCUUCUCCCGUCCAUUC66.51521702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4643820AGTCTTCTCCCGTCCATTCGAATGGACGGGAGAAGACT0.253000.200600.534500.500001.000001.00000


Target Position: 2847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2847GGCAUCAUGGAAAGACUGG62.61182181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672865GGCATCATGGAAAGACTGGCCAGTCTTTCCATGATGCC0.040000.016600.655200.500001.000001.00000


Target Position: 3369, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3369CUGCAACUGCUCAGCUCUG70.15721296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6133387CTGCAACTGCTCAGCTCTGCAGAGCTGAGCAGTTGCAG0.025600.002400.500000.500000.956500.75000


Target Position: 716, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
716UGUGGCCCUCUAUGACUAU73.9498910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
541734TGTGGCCCTCTATGACTATATAGTCATAGAGGGCCACA0.137000.002000.663800.750000.945700.87500


Target Position: 3151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3151UCCUUCCCCGUACUUUGUC45.09353781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4453169TCCTTCCCCGTACTTTGTCGACAAAGTACGGGGAAGGA0.467900.211900.551700.500001.000001.00000


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780CUCCAGAUUGUCAACAACA86.6576162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
553798CTCCAGATTGTCAACAACATGTTGTTGACAATCTGGAG0.167700.031800.603400.500001.000001.00000


Target Position: 2997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2997AGGUGCAGGUGUGGAGAGA76.8937658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6053015AGGTGCAGGTGTGGAGAGATCTCTCCACACCTGCACCT0.109000.001200.620700.500001.000001.00000


Target Position: 1443, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1443GUUUCAGAGGAGCCCAUUU79.1636502

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2144319GTTTCAGAGGAGCCCATTT1/1/0/094.96SRCNM_198291.1+NM_005417.31+1NANANA20:36028652..36028670(+)00SRC(0.002)&RBM9(0.007)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6031461GTTTCAGAGGAGCCCATTTAAATGGGCTCCTCTGAAAC0.085200.001200.646600.750001.000001.00000


Target Position: 3927, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3927CAGUGUUUUGUAGAUUUCA87.5012141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5633945CAGTGTTTTGTAGATTTCATGAAATCTACAAAACACTG0.130900.001700.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3925-3947AACAGTGTTTTGTAGATTTCAGAUGAAAUCUACAAAACACUGUUCAGUGUUUUGUAGAUUUCAGAU14.817.811


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506CCGCCUGCCUGCCACCCUG61.18632363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3092524CCGCCTGCCTGCCACCCTGCAGGGTGGCAGGCAGGCGG0.268000.017400.629300.750000.945700.75000


Target Position: 4045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
4045AAUUGGUUGUAAAUACUUU84.2653259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5354063AATTGGTTGTAAATACTTTAAAGTATTTACAACCAATT0.031900.004000.508600.500001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051ACGUGAAGCACUACAAGAU83.5031290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621069ACGTGAAGCACTACAAGATATCTTGTAGTGCTTCACGT0.369500.038200.594800.750000.983700.75000


Target Position: 1588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588UGGAGCGGAUGAACUACGU66.01041766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371606TGGAGCGGATGAACTACGTACGTAGTTCATCCGCTCCA0.036500.002000.569000.500001.000001.00000


Target Position: 2438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438GCCACCCCCGGUCUAUGUC55.742966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4492456GCCACCCCCGGTCTATGTCGACATAGACCGGGGGTGGC0.053200.010400.681000.750000.929300.62500


Target Position: 124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
124CACAACCUGACCAUCCUCA81.2454387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555142CACAACCTGACCATCCTCATGAGGATGGTCAGGTTGTG0.080800.046800.569000.500000.972800.62500