siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs, Sidirect 494   925   1104   1605   1683  
Biltr, Sidirect 257   295   304   352   353   376   485   916   1009   1011   1015   1156   1192   1201   1543   1585   1602   1651   1654   1691  
1711   1716   1762   1887   1979   2036   2067   2076   2197   2288   2319   2384   2392  
Biltr, Rnaxs, Sidirect 284   301   343   344   348   367   412   905   922   924   931   932   939   1102   1105   1166   1177   1252   1309   1435  
1593   1598   1606   1612   1613   1618   1619   1635   1643   1644   1647   1657   1660   1684   1688   1737   1814   1842   1843   1853  
1854   1877   1894   1896   1897   1909   1975   1976   1983   2044   2053   2055   2057   2084   2130   2199   2208   2209   2214   2219  
2233   2235   2247   2281   2300   2311   2315   2369   2373   2378   2397   2401   2403   2404   2416   2428   2437   2438   2442   2452  
Biltr, Ernai, Sidirect 2063  
Biltr, Rnaxs 14   72   74   75   76   77   78   79   111   112   150   151   152   153   154   155   156   159   160   161  
162   163   167   168   169   173   174   175   183   191   218   219   220   221   244   245   251   252   253   258  
266   270   271   272   273   274   275   276   277   278   279   280   281   282   283   288   289   290   298   300  
302   303   316   332   333   334   335   336   337   338   342   357   366   378   385   408   409   410   411   420  
421   429   430   431   432   433   434   435   436   437   438   439   440   441   442   443   446   447   448   450  
451   452   453   454   455   456   457   458   459   460   461   470   471   481   482   483   484   488   489   490  
491   492   493   495   512   513   518   519   520   521   533   534   543   544   551   552   553   554   555   557  
558   559   560   576   582   583   584   585   586   587   588   590   591   596   597   598   610   611   612   635  
666   667   668   669   671   672   673   678   679   680   681   683   684   686   687   688   689   690   691   692  
693   694   696   697   698   699   700   717   718   719   722   723   728   729   732   733   734   735   737   738  
740   741   744   745   747   750   751   752   753   755   756   758   759   762   763   764   765   769   770   771  
773   774   777   780   783   784   785   786   787   788   789   790   792   793   794   795   796   797   798   801  
802   807   808   815   816   819   820   822   823   824   825   826   828   829   831   832   833   834   836   837  
838   843   844   846   847   849   850   851   852   855   856   857   860   861   865   866   867   868   869   870  
871   872   873   874   878   879   885   891   892   893   894   895   897   898   901   902   903   904   909   910  
911   912   913   919   920   921   923   926   927   928   933   934   938   940   941   946   947   948   949   950  
951   952   953   958   959   960   971   977   978   979   980   981   982   983   985   986   987   988   989   990  
991   992   993   994   995   996   997   999   1000   1001   1002   1003   1004   1005   1006   1007   1013   1017   1026   1042  
1043   1044   1045   1046   1049   1050   1051   1055   1056   1057   1058   1068   1070   1071   1072   1073   1093   1094   1095   1096  
1097   1098   1099   1100   1103   1117   1118   1120   1121   1122   1123   1125   1126   1127   1130   1131   1135   1136   1137   1141  
1143   1144   1145   1146   1152   1153   1154   1155   1162   1163   1164   1165   1167   1176   1184   1185   1186   1191   1207   1208  
1210   1211   1214   1233   1234   1235   1236   1237   1238   1239   1242   1243   1244   1245   1249   1250   1251   1264   1283   1304  
1305   1306   1343   1344   1350   1351   1352   1356   1357   1360   1361   1371   1372   1373   1375   1423   1424   1425   1426   1432  
1433   1434   1444   1445   1446   1453   1467   1468   1469   1473   1474   1475   1476   1482   1483   1486   1487   1488   1528   1562  
1586   1590   1591   1592   1597   1599   1604   1607   1608   1609   1610   1611   1616   1617   1620   1634   1638   1639   1640   1641  
1642   1645   1646   1648   1649   1650   1659   1668   1679   1680   1681   1682   1685   1686   1687   1701   1702   1703   1706   1712  
1714   1715   1721   1722   1723   1732   1733   1734   1735   1736   1759   1766   1767   1768   1787   1788   1789   1790   1810   1811  
1812   1813   1815   1834   1835   1838   1839   1840   1847   1848   1849   1850   1852   1855   1865   1866   1868   1871   1872   1873  
1874   1878   1879   1883   1884   1885   1892   1893   1895   1908   1918   1921   1922   1923   1927   1928   1931   1933   1954   1955  
1956   1960   1961   1962   1964   1967   1968   1969   1971   1972   1973   1974   1982   1985   1986   1994   1995   1996   1997   1998  
2025   2026   2027   2029   2030   2032   2033   2034   2035   2042   2043   2048   2051   2052   2054   2056   2066   2070   2071   2072  
2074   2075   2078   2079   2080   2081   2082   2083   2099   2109   2128   2129   2131   2135   2144   2146   2150   2177   2178   2180  
2181   2183   2188   2194   2195   2196   2198   2200   2206   2207   2212   2213   2218   2220   2221   2224   2228   2232   2234   2236  
2237   2238   2239   2245   2246   2248   2271   2272   2273   2274   2275   2276   2277   2285   2291   2292   2299   2304   2308   2309  
2310   2312   2313   2314   2316   2317   2318   2325   2329   2331   2332   2356   2357   2358   2359   2360   2361   2362   2363   2364  
2365   2366   2368   2370   2372   2376   2377   2382   2383   2388   2389   2390   2391   2394   2395   2396   2400   2402   2405   2409  
2413   2414   2415   2422   2423   2424   2426   2427   2431   2432   2433   2434   2436   2439   2440   2441   2443   2449   2450   2451  
2453   2454   2455   2456   2457   2458   2459   2460   2461  
Biltr, Ernai, Rnaxs 113   1101   1124   1841  


Target Position: 2183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2183UUCAUUUUUGUUACCUGAU62.88911759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162201TTCATTTTTGTTACCTGATATCAGGTAACAAAAATGAA0.029200.008600.491400.500001.000001.00000


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895GAAGAUGAGGGAGAAGAUG72.86991098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
626913GAAGATGAGGGAGAAGATGCATCTTCTCCCTCATCTTC0.753900.142100.517200.500001.000001.00000


Target Position: 2360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2360ACCUUGGAACCUUGUUUUG58.89321960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6222378ACCTTGGAACCTTGTTTTGCAAAACAAGGTTCCAAGGT0.168300.009800.706900.500001.000001.00000


Target Position: 2423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2423UGGUUGAAAACUCAGGAAU70.25351273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3872441TGGTTGAAAACTCAGGAATATTCCTGAGTTTTCAACCA0.359200.036900.836200.750001.000001.00000


Target Position: 376, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376CUUGAACUAAGCGAUAACA82.0392486

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
374-396AGCTTGAACTAAGCGATAACAGAUGUUAUCGCUUAGUUCAAGCUCUUGAACUAAGCGAUAACAGAU16.519.203


Target Position: 175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
175GAGAUGGGCAGACGGAUUC64.92211627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830193GAGATGGGCAGACGGATTCGAATCCGTCTGCCCATCTC0.015700.001100.637900.500001.000001.00000


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723AAAAAAUGAUGAGAGAAUU79.9281626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521741AAAAAATGATGAGAGAATTAATTCTCTCATCATTTTTT0.045300.020700.491400.500001.000001.00000


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824AGGUAGAUGACGAGGAAGA81.4953519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
619842AGGTAGATGACGAGGAAGATCTTCCTCGTCATCTACCT0.556600.066800.620700.500001.000001.00000


Target Position: 2048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2048UUUAUGUCUGUUUGUCAUU65.09261610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7492066TTTATGTCTGTTTGTCATTAATGACAAACAGACATAAA0.052700.005900.491400.500001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586UUGUUGUGUUAAGUUACAA78.2528741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981604TTGTTGTGTTAAGTTACAATTGTAACTTAACACAACAA0.033400.001900.500000.500001.000001.00000


Target Position: 1166, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1166GGUUUUUGUCCCUGUAAAU87.7772225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081184GGTTTTTGTCCCTGTAAATATTTACAGGGACAAAAACC0.116400.039600.844801.000000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1164-1186CCGGTTTTTGTCCCTGTAAATGCAUUUACAGGGACAAAAACCGGGGUUUUUGUCCCUGUAAAUGCU11.85.632


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788AGGAGGAGGAGGAUGAAGA81.4695520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
691806AGGAGGAGGAGGATGAAGATCTTCATCCTCCTCCTCCT0.870100.829500.620700.500001.000001.00000


Target Position: 1123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1123ACUGCCACUCUUUAUUUUU72.21431147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3081141ACTGCCACTCTTTATTTTTAAAAATAAAGAGTGGCAGT0.955000.251100.706900.750001.000001.00000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836AGGAAGAUGAAGAAGAGCU76.1528873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
753854AGGAAGATGAAGAAGAGCTAGCTCTTCTTCATCTTCCT0.052200.055600.491400.500001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420GGCAGAAAAGUGUCCGAAC75.3889931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
799438GGCAGAAAAGTGTCCGAACGTTCGGACACTTTTCTGCC0.023600.001800.853400.750000.934800.62500


Target Position: 2403, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2403CGUAUUGUAAAAAGAAUGU75.6919908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7682421CGTATTGTAAAAAGAATGTACATTCTTTTTACAATACG0.030100.018800.569000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2401-2423GTCGTATTGTAAAAAGAATGTATACAUUCUUUUUACAAUACGACCGUAUUGUAAAAAGAAUGUAUU12.014.622


Target Position: 2309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2309AAGUUACAGAGUUACUAAA91.6162106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7962327AAGTTACAGAGTTACTAAATTTAGTAACTCTGTAACTT0.366300.101200.637900.500001.000001.00000


Target Position: 1599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1599UUACAAGGAAAAUGGAUUU66.74381509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5911617TTACAAGGAAAATGGATTTAAATCCATTTTCCTTGTAA0.167900.021000.534500.500001.000001.00000


Target Position: 794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794AGGAGGAUGAAGAAGGUUA86.9059258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
416812AGGAGGATGAAGAAGGTTATAACCTTCTTCATCCTCCT0.169500.176400.810300.750001.000001.00000


Target Position: 1813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813UGGGUUUUUUUUUUCAUAC61.11291857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601831TGGGTTTTTTTTTTCATACGTATGAAAAAAAAAACCCA0.597900.004700.663800.500001.000001.00000


Target Position: 174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174GGAGAUGGGCAGACGGAUU83.3378422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801192GGAGATGGGCAGACGGATTAATCCGTCTGCCCATCTCC0.019000.010000.862101.000001.000001.00000


Target Position: 160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
160AGAGCGCGAGAGAUGGAGA83.0468435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
674178AGAGCGCGAGAGATGGAGATCTCCATCTCTCGCGCTCT0.252700.006900.500000.500001.000001.00000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219CUCUGAUGUGAAAGAACUU84.1923384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
762237CTCTGATGTGAAAGAACTTAAGTTCTTTCACATCAGAG0.046200.003100.672400.750001.000001.00000


Target Position: 2434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2434UCAGGAAUGUUUAUAAAAC69.56071312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8312452TCAGGAATGTTTATAAAACGTTTTATAAACATTCCTGA0.167700.029000.577600.500001.000001.00000


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878UGGAAAUCUGAAAUGACUG65.77281561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361896TGGAAATCTGAAATGACTGCAGTCATTTCAGATTTCCA0.078400.011100.560300.500000.967400.62500


Target Position: 1252, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252CUUACGUUUCCUGGUAUUU70.51491253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311270CTTACGTTTCCTGGTATTTAAATACCAGGAAACGTAAG0.227400.066600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1250-1272CTCTTACGTTTCCTGGTATTTCCAAAUACCAGGAAACGUAAGAGCUUACGUUUCCUGGUAUUUCCU20.015.033


Target Position: 925, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925GAAUAACCUAUUUUGAAAA95.341944

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_692519GAATAACCTATTTTGAAAA1/1/0/093.97ANP32ANM_006305.31NANANA15:35530268..35530286(+)|15:69072398..69072416(-)|4:165118104..165118122(-)00ANP32A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
374943GAATAACCTATTTTGAAAATTTTCAAAATAGGTTATTC0.407700.057900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
923-945TGGAATAACCTATTTTGAAAAATUUUUCAAAAUAGGUUAUUCCAGAAUAACCUAUUUUGAAAAAUU7.713.921


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831UGACGAGGAAGAUGAAGAA88.9498188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523849TGACGAGGAAGATGAAGAATTCTTCATCTTCCTCGTCA0.619600.123700.551700.750001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989CCCCCCUCCAAUCCUGCCC37.40892434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931007CCCCCCTCCAATCCTGCCCGGGCAGGATTGGAGGGGGG0.675500.639500.500000.500001.000001.00000


Target Position: 1598, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1598GUUACAAGGAAAAUGGAUU79.7307641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041616GTTACAAGGAAAATGGATTAATCCATTTTCCTTGTAAC0.179100.019400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1596-1618AAGTTACAAGGAAAATGGATTTGAAUCCAUUUUCCUUGUAACUUGUUACAAGGAAAAUGGAUUUGU20.111.821


Target Position: 1125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125UGCCACUCUUUAUUUUUUU67.89561428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2071143TGCCACTCTTTATTTTTTTAAAAAAATAAAGAGTGGCA0.966900.277700.853400.750001.000001.00000


Target Position: 446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446AUCUAAAUUUAAGUGGCAA81.3273528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
772464ATCTAAATTTAAGTGGCAATTGCCACTTAAATTTAGAT0.028500.025100.534500.500001.000001.00000


Target Position: 434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
434CGAACCUCACGCAUCUAAA92.894783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
156452CGAACCTCACGCATCTAAATTTAGATGCGTGAGGTTCG0.510500.164600.793101.000001.000001.00000


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551ACCUGAACGACUACCGAGA75.9835882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
806569ACCTGAACGACTACCGAGATCTCGGTAGTCGTTCAGGT0.440200.018600.629300.500001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756GGAGGAAGGUGAAGAGGAG82.9411441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510774GGAGGAAGGTGAAGAGGAGCTCCTCTTCACCTTCCTCC0.923500.716600.560300.750001.000001.00000


Target Position: 2440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2440AUGUUUAUAAAACAAAUUA82.1393481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8012458ATGTTTATAAAACAAATTATAATTTGTTTTATAAACAT0.129900.038200.620700.500000.972800.62500


Target Position: 1849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1849CUAACGCAAAAUUGUAUUU74.8063971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281867CTAACGCAAAATTGTATTTAAATACAATTTTGCGTTAG0.069900.059100.672400.750001.000001.00000


Target Position: 2070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2070AAAUUUCAAUAAAUCUUUU81.1833538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722088AAATTTCAATAAATCTTTTAAAAGATTTATTGAAATTT0.271800.025700.500000.500001.000001.00000


Target Position: 251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251GUCGGUCGAAUGAAGGCAA83.5092412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815269GTCGGTCGAATGAAGGCAATTGCCTTCATTCGACCGAC0.039000.001300.672400.750001.000001.00000


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892GACUGCAAAUUCCUAGUGA90.0586142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051910GACTGCAAATTCCTAGTGATCACTAGGAATTTGCAGTC0.018500.007800.594800.500001.000001.00000


Target Position: 494, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494CACUGAAAAAGUUAGAAAA96.360631

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_549419CACTGAAAAAGTTAGAAAA1/1/0/093.97ANP32ANM_006305.31NANANA7:29919893..29919911(-)00ANP32A(0.002)&ANP32D(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
554512CACTGAAAAAGTTAGAAAATTTTCTAACTTTTTCAGTG0.186300.015300.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
492-514GCCACTGAAAAAGTTAGAAAACCUUUUCUAACUUUUUCAGUGGCCACUGAAAAAGUUAGAAAACCU7.119.202


Target Position: 485, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485CAAUAGAGCCACUGAAAAA100.8698

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
483-505CACAATAGAGCCACTGAAAAAGTUUUUUCAGUGGCUCUAUUGUGCAAUAGAGCCACUGAAAAAGUU12.211.602


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584UCCUCCCGCAACUCACAUA74.7026978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
634602TCCTCCCGCAACTCACATATATGTGAGTTGCGGGAGGA0.084500.009100.827600.750001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049ACGAGAGGGGAAGAGUGUA79.7614638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361067ACGAGAGGGGAAGAGTGTATACACTCTTCCCCTCTCGT0.228000.061400.594800.750001.000001.00000


Target Position: 802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
802GAAGAAGGUUAUAACGAUG83.3479420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
631820GAAGAAGGTTATAACGATGCATCGTTATAACCTTCTTC0.140900.084000.517200.500001.000001.00000


Target Position: 1650, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1650ACUUCAACUUCUUUAAAAG75.8048897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7571668ACTTCAACTTCTTTAAAAGCTTTTAAAGAAGTTGAAGT0.127400.100000.569000.500001.000001.00000


Target Position: 2314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2314ACAGAGUUACUAAAAAAAC68.73371371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5292332ACAGAGTTACTAAAAAAACGTTTTTTTAGTAACTCTGT0.612800.212600.560300.500001.000001.00000


Target Position: 456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
456AAGUGGCAACAAAAUUAAA88.6371197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
731474AAGTGGCAACAAAATTAAATTTAATTTTGTTGCCACTT0.846400.015400.637900.500001.000001.00000


Target Position: 790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
790GAGGAGGAGGAUGAAGAAG70.65631243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
649808GAGGAGGAGGATGAAGAAGCTTCTTCATCCTCCTCCTC0.837800.795600.672400.500001.000001.00000


Target Position: 280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280CUCACAGAUGAAUUUGAAG73.6971046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807298CTCACAGATGAATTTGAAGCTTCAAATTCATCTGTGAG0.110100.019900.672400.500001.000001.00000


Target Position: 288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
288UGAAUUUGAAGAACUGGAA79.9586623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
726306TGAATTTGAAGAACTGGAATTCCAGTTCTTCAAATTCA0.041200.013400.551700.750001.000001.00000


Target Position: 2196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2196CCUGAUAGAAUAGCUUUUC64.76491634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352214CCTGATAGAATAGCTTTTCGAAAAGCTATTCTATCAGG0.060300.004000.672400.750001.000001.00000


Target Position: 933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
933UAUUUUGAAAAAUUCCUAU74.38841002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
675951TATTTTGAAAAATTCCTATATAGGAATTTTTCAAAATA0.210300.089900.500000.500001.000001.00000


Target Position: 2451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2451ACAAAUUAUUUCACAAAAA87.4785237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3442469ACAAATTATTTCACAAAAATTTTTGTGAAATAATTTGT0.210800.174600.706900.750001.000001.00000


Target Position: 2428, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2428GAAAACUCAGGAAUGUUUA89.1183181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712446GAAAACTCAGGAATGTTTATAAACATTCCTGAGTTTTC0.089100.018900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2426-2448TTGAAAACTCAGGAATGTTTATAUAAACAUUCCUGAGUUUUCAAGAAAACUCAGGAAUGUUUAUAU5.313.312


Target Position: 2383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2383UCUUUCAUUGUUUUGUUUG54.97832102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4642401TCTTTCATTGTTTTGTTTGCAAACAAAACAATGAAAGA0.145400.023300.577600.500001.000001.00000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879GCGAAAACGAGAACCUGAA87.4447238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836897GCGAAAACGAGAACCTGAATTCAGGTTCTCGTTTTCGC0.011800.009000.750001.000001.000001.00000


Target Position: 2235, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2235GAUACUAUGUUUGGAUAUU86.8291262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6712253GATACTATGTTTGGATATTAATATCCAAACATAGTATC0.056000.016500.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2233-2255GTGATACTATGTTTGGATATTTTAAUAUCCAAACAUAGUAUCACGAUACUAUGUUUGGAUAUUUUU21.26.122


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911AUGAUGACUAAGUGGAAUA83.3878418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
613929ATGATGACTAAGTGGAATATATTCCACTTAGTCATCAT0.074200.072900.612100.500001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051GAGAGGGGAAGAGUGUACU77.0924803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131069GAGAGGGGAAGAGTGTACTAGTACACTCTTCCCCTCTC0.142700.018600.603400.500001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591GUGUUAAGUUACAAGGAAA99.11915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6011609GTGTTAAGTTACAAGGAAATTTCCTTGTAACTTAACAC0.091600.011100.793100.750001.000001.00000


Target Position: 552, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
552CCUGAACGACUACCGAGAA88.5248199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366570CCTGAACGACTACCGAGAATTCTCGGTAGTCGTTCAGG0.440800.040000.672401.000001.000001.00000


Target Position: 1068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068CUGGGGGUUGCGGGGGGAG43.76262373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841086CTGGGGGTTGCGGGGGGAGCTCCCCCCGCAACCCCCAG0.173600.011200.474100.500001.000001.00000


Target Position: 2055, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2055CUGUUUGUCAUUGAUAAAU75.1445946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082073CTGTTTGTCATTGATAAATATTTATCAATGACAAACAG0.018100.003600.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2053-2075GTCTGTTTGTCATTGATAAATTTAUUUAUCAAUGACAAACAGACCUGUUUGUCAUUGAUAAAUUUU8.919.332


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005CCCCCUGAAACUUAUUUUU72.96511091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001023CCCCCTGAAACTTATTTTTAAAAATAAGTTTCAGGGGG0.178200.155000.991401.000001.000001.00000


Target Position: 2247, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2247GGAUAUUUUUGGUCUUAAA102.1233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112265GGATATTTTTGGTCTTAAATTTAAGACCAAAAATATCC0.017400.004100.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2245-2267TTGGATATTTTTGGTCTTAAAGCUUUAAGACCAAAAAUAUCCAAGGAUAUUUUUGGUCUUAAAGCU14.61.831


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441CACGCAUCUAAAUUUAAGU78.5705723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
642459CACGCATCTAAATTTAAGTACTTAAATTTAGATGCGTG0.064000.045600.586200.500001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793GAGGAGGAUGAAGAAGGUU79.1892677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
394811GAGGAGGATGAAGAAGGTTAACCTTCTTCATCCTCCTC0.179800.186200.663800.750001.000001.00000


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512ACCUCAAGAGCUUAGACCU75.806896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
649530ACCTCAAGAGCTTAGACCTAGGTCTAAGCTCTTGAGGT0.192900.012100.508600.500001.000001.00000


Target Position: 2237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2237UACUAUGUUUGGAUAUUUU81.4277522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6952255TACTATGTTTGGATATTTTAAAATATCCAAACATAGTA0.057800.016200.681000.500001.000001.00000


Target Position: 440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
440UCACGCAUCUAAAUUUAAG66.49991526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
553458TCACGCATCTAAATTTAAGCTTAAATTTAGATGCGTGA0.096000.062500.586200.500001.000001.00000


Target Position: 1026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1026CUGAUUGUAACGUUGCUGU71.57221191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7781044CTGATTGTAACGTTGCTGTACAGCAACGTTACAATCAG0.345000.002400.577600.500001.000001.00000


Target Position: 2074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2074UUCAAUAAAUCUUUUUAUA80.0841615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4572092TTCAATAAATCTTTTTATATATAAAAAGATTTATTGAA0.523900.058200.629300.500001.000001.00000


Target Position: 789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789GGAGGAGGAGGAUGAAGAA99.423714

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184807GGAGGAGGAGGATGAAGAATTCTTCATCCTCCTCCTCC0.846200.800800.698301.000001.000001.00000


Target Position: 2052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2052UGUCUGUUUGUCAUUGAUA85.3699331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922070TGTCTGTTTGTCATTGATATATCAATGACAAACAGACA0.022300.002500.663800.750001.000001.00000


Target Position: 159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
159GAGAGCGCGAGAGAUGGAG63.95221686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
706177GAGAGCGCGAGAGATGGAGCTCCATCTCTCGCGCTCTC0.258300.006900.500000.500001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979CCCUCUCCCCCCCCCCUCC40.36412416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
587997CCCTCTCCCCCCCCCCTCCGGAGGGGGGGGGGAGAGGG0.859300.831800.620700.500001.000001.00000


Target Position: 1177, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1177CUGUAAAUGCGAUAGCUAA95.933838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8291195CTGTAAATGCGATAGCTAATTAGCTATCGCATTTACAG0.013400.001200.750000.750000.962000.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1175-1197CCCTGTAAATGCGATAGCTAAGTUUAGCUAUCGCAUUUACAGGGCUGUAAAUGCGAUAGCUAAGUU19.56.933


Target Position: 183, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
183CAGACGGAUUCAUUUAGAG80.0416619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
804201CAGACGGATTCATTTAGAGCTCTAAATGAATCCGTCTG0.022600.012900.474100.500001.000001.00000


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368ACCUUGUUUUGAAUAUCUU77.8346763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632386ACCTTGTTTTGAATATCTTAAGATATTCAAAACAAGGT0.231800.094500.715500.750001.000001.00000


Target Position: 1435, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1435CAACCUAAAGGCGUAUUUU81.2538533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7531453CAACCTAAAGGCGTATTTTAAAATACGCCTTTAGGTTG0.046500.003200.646600.750000.929300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1433-1455AGCAACCTAAAGGCGTATTTTGGAAAAUACGCCUUUAGGUUGCUCAACCUAAAGGCGUAUUUUGGU6.918.633


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823GAGGUAGAUGACGAGGAAG75.1626945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
570841GAGGTAGATGACGAGGAAGCTTCCTCGTCATCTACCTC0.151600.078700.672400.500001.000001.00000


Target Position: 947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
947CCUAUUGUGAUUUGACUGU71.82671175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332965CCTATTGTGATTTGACTGTACAGTCAAATCACAATAGG0.318700.065100.637900.750001.000001.00000


Target Position: 2455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455AUUAUUUCACAAAAAAAAA79.896629

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7372473ATTATTTCACAAAAAAAAATTTTTTTTTGTGAAATAAT0.984100.193300.508600.500001.000001.00000


Target Position: 2248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2248GAUAUUUUUGGUCUUAAAG74.0271027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8212266GATATTTTTGGTCTTAAAGCTTTAAGACCAAAAATATC0.015100.002900.543100.500001.000001.00000


Target Position: 2198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2198UGAUAGAAUAGCUUUUCUU80.8069560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6552216TGATAGAATAGCTTTTCTTAAGAAAAGCTATTCTATCA0.072800.008100.586200.750000.956500.62500


Target Position: 596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
596UCACAUAUCUCGACGGCUA83.9124391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519614TCACATATCTCGACGGCTATAGCCGTCGAGATATGTGA0.122800.030200.551700.750001.000001.00000


Target Position: 2220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2220AGAUAUAUAUAAUGUGAUA103.2182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4072238AGATATATATAATGTGATATATCACATTATATATATCT0.265100.102500.681000.750001.000001.00000


Target Position: 1562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562GCCAGAGAGCUGAAAACCG68.94091354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771580GCCAGAGAGCTGAAAACCGCGGTTTTCAGCTCTCTGGC0.294600.021600.586200.500000.956500.62500


Target Position: 1931, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1931GUCCCUCUUCUGGUUGCUU71.69751181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191949GTCCCTCTTCTGGTTGCTTAAGCAACCAGAAGAGGGAC0.015800.007000.681000.750000.945700.87500


Target Position: 737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
737AGGAGGACGAGGAUGAGGA78.9061690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
796755AGGAGGACGAGGATGAGGATCCTCATCCTCGTCCTCCT0.672500.384500.474100.500001.000001.00000


Target Position: 855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
855UGGUGAAGAAGAAAGGGGU67.83881432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
765873TGGTGAAGAAGAAAGGGGTACCCCTTTCTTCTTCACCA0.167100.066300.491400.500001.000001.00000


Target Position: 2391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2391UGUUUUGUUUGUCGUAUUG63.43711719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6772409TGTTTTGTTTGTCGTATTGCAATACGACAAACAAAACA0.386100.042700.560300.500001.000001.00000


Target Position: 300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
300ACUGGAAUUCUUAAGUACA86.9412256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
728318ACTGGAATTCTTAAGTACATGTACTTAAGAATTCCAGT0.179500.029300.500000.500001.000001.00000


Target Position: 2315, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2315CAGAGUUACUAAAAAAACA95.33946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6842333CAGAGTTACTAAAAAAACATGTTTTTTTAGTAACTCTG0.596900.207300.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2313-2335TACAGAGTTACTAAAAAAACAAGUGUUUUUUUAGUAACUCUGUACAGAGUUACUAAAAAAACAAGU-1.818.921


Target Position: 1608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1608AAAUGGAUUUGGUAAUUAA98.475219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241626AAATGGATTTGGTAATTAATTAATTACCAAATCCATTT0.222100.091000.465500.500001.000001.00000


Target Position: 2358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2358CAACCUUGGAACCUUGUUU78.7812703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5452376CAACCTTGGAACCTTGTTTAAACAAGGTTCCAAGGTTG0.295300.016000.646600.750001.000001.00000


Target Position: 2135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2135GAUCUUUUCAAGAUGCAUU85.8117314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352153GATCTTTTCAAGATGCATTAATGCATCTTGAAAAGATC0.039400.012800.672400.750000.962000.62500


Target Position: 1908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1908UGAAUGUACAGGUUUGCUU73.21891076

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7641926TGAATGTACAGGTTTGCTTAAGCAAACCTGTACATTCA0.031700.003100.586200.750001.000001.00000


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461GCAACAAAAUUAAAGACCU83.6465404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
641479GCAACAAAATTAAAGACCTAGGTCTTTAATTTTGTTGC0.714700.715900.508600.750001.000001.00000


Target Position: 447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
447UCUAAAUUUAAGUGGCAAC59.23411948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783465TCTAAATTTAAGTGGCAACGTTGCCACTTAAATTTAGA0.037100.025200.577600.500001.000001.00000


Target Position: 342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
342CGCAAACUUACCAAAGUUA89.607162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
700360CGCAAACTTACCAAAGTTATAACTTTGGTAAGTTTGCG0.049200.021600.887901.000000.923900.62500


Target Position: 1843, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843GAAAAACUAACGCAAAAUU82.1612479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251861GAAAAACTAACGCAAAATTAATTTTGCGTTAGTTTTTC0.561600.260000.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1841-1863CGGAAAAACTAACGCAAAATTGTAAUUUUGCGUUAGUUUUUCCGGAAAAACUAACGCAAAAUUGUU14.03.232


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838GAAGAUGAAGAAGAGCUUG73.70951044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
756856GAAGATGAAGAAGAGCTTGCAAGCTCTTCTTCATCTTC0.031800.033400.525900.500001.000001.00000


Target Position: 2422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2422AUGGUUGAAAACUCAGGAA79.1257681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752440ATGGTTGAAAACTCAGGAATTCCTGAGTTTTCAACCAT0.080100.038800.482800.500001.000001.00000


Target Position: 1184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1184UGCGAUAGCUAAGUACACA83.2947426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231202TGCGATAGCTAAGTACACATGTGTACTTAGCTATCGCA0.052300.004800.646600.500000.962000.75000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469ACAUUCCCCAUCUCUCAUC59.71751918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7951487ACATTCCCCATCTCTCATCGATGAGAGATGGGGAATGT0.401600.005500.525900.500001.000001.00000


Target Position: 1855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1855CAAAAUUGUAUUUUCUUAC72.34351136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251873CAAAATTGTATTTTCTTACGTAAGAAAATACAATTTTG0.052100.024700.465500.500000.994600.62500


Target Position: 1099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1099GGGGUGGAAUAAAAUACUA96.652626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6981117GGGGTGGAATAAAATACTATAGTATTTTATTCCACCCC0.326500.005800.819001.000001.000001.00000


Target Position: 1647, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1647CAAACUUCAACUUCUUUAA90.1454138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121665CAAACTTCAACTTCTTTAATTAAAGAAGTTGAAGTTTG0.175500.151100.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1645-1667TTCAAACTTCAACTTCTTTAAAAUUAAAGAAGUUGAAGUUUGAACAAACUUCAACUUCUUUAAAAU7.113.320


Target Position: 2239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2239CUAUGUUUGGAUAUUUUUG72.58421119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7572257CTATGTTTGGATATTTTTGCAAAAATATCCAAACATAG0.031800.005900.525900.500001.000001.00000


Target Position: 1487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487CCCUUUUCCCCCUUCACAG64.31581662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5821505CCCTTTTCCCCCTTCACAGCTGTGAAGGGGGAAAAGGG0.085500.089600.706900.750001.000001.00000


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844GAAGAAGAGCUUGGUGAAG71.34711209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
696862GAAGAAGAGCTTGGTGAAGCTTCACCAAGCTCTTCTTC0.049900.017500.534500.500001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969CUGAACCCAUGUUUCAUCU73.94861031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931987CTGAACCCATGTTTCATCTAGATGAAACATGGGTTCAG0.212000.031100.560300.500001.000001.00000


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819UGGAGAGGUAGAUGACGAG69.81031296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
583837TGGAGAGGTAGATGACGAGCTCGTCATCTACCTCTCCA0.117900.058400.534500.500001.000001.00000


Target Position: 2392, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2392GUUUUGUUUGUCGUAUUGU70.69341240

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2390-2412TTGTTTTGTTTGTCGTATTGTAAACAAUACGACAAACAAAACAAGUUUUGUUUGUCGUAUUGUAAU13.75.622


Target Position: 2221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2221GAUAUAUAUAAUGUGAUAC79.3924661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452239GATATATATAATGTGATACGTATCACATTATATATATC0.244800.089600.500000.500001.000001.00000


Target Position: 2288, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2288CAUUAAAAGCUUCCUUUAA92.132699

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2286-2308TTCATTAAAAGCTTCCTTTAAAAUUAAAGGAAGCUUUUAAUGAACAUUAAAAGCUUCCUUUAAAAU19.9-9.722


Target Position: 891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891ACCUGAAGAUGAGGGAGAA86.061295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
421909ACCTGAAGATGAGGGAGAATTCTCCCTCATCTTCAGGT0.206300.028700.681000.750000.972800.62500


Target Position: 1644, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1644CUUCAAACUUCAACUUCUU82.2809475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6811662CTTCAAACTTCAACTTCTTAAGAAGTTGAAGTTTGAAG0.204200.030700.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1642-1664ACCTTCAAACTTCAACTTCTTTAAAGAAGUUGAAGUUUGAAGGUCUUCAAACUUCAACUUCUUUAU17.714.922


Target Position: 2382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2382AUCUUUCAUUGUUUUGUUU72.81071101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6342400ATCTTTCATTGTTTTGTTTAAACAAAACAATGAAAGAT0.141100.023800.681000.500001.000001.00000


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712CUUUGUUUUACAAAAAAUG67.43711462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7691730CTTTGTTTTACAAAAAATGCATTTTTTGTAAAACAAAG0.090600.024300.482800.500000.962000.62500


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847GAAGAGCUUGGUGAAGAAG72.42691131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761865GAAGAGCTTGGTGAAGAAGCTTCTTCACCAAGCTCTTC0.229000.014600.534500.500001.000001.00000


Target Position: 1762, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1762CUUAGAACAUUUUUACGGA84.4661376

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1760-1782TGCTTAGAACATTTTTACGGACCUCCGUAAAAAUGUUCUAAGCACUUAGAACAUUUUUACGGACCU20.614.632


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688GAUGAGGAUGAGGAGGAGU76.0617879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
806706GATGAGGATGAGGAGGAGTACTCCTCCTCATCCTCATC0.185000.160800.474100.500001.000001.00000


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378UGAACUAAGCGAUAACAGA84.5687370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
698396TGAACTAAGCGATAACAGATCTGTTATCGCTTAGTTCA0.100000.013400.500000.500001.000001.00000


Target Position: 270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
270ACUCGAAGGCCUCACAGAU80.1164611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
668288ACTCGAAGGCCTCACAGATATCTGTGAGGCCTTCGAGT0.073900.007200.525900.750001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686AGGAUGAGGAUGAGGAGGA76.6065840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
803704AGGATGAGGATGAGGAGGATCCTCCTCATCCTCATCCT0.226200.199500.474100.500001.000001.00000


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978CCCCUCUCCCCCCCCCCUC36.3182437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
324996CCCCTCTCCCCCCCCCCTCGAGGGGGGGGGGAGAGGGG0.983600.956400.681000.750001.000001.00000


Target Position: 941, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
941AAAAUUCCUAUUGUGAUUU67.51491454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
671959AAAATTCCTATTGTGATTTAAATCACAATAGGAATTTT0.105700.036600.500000.500001.000001.00000


Target Position: 2285, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2285CUUCAUUAAAAGCUUCCUU74.8213970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7332303CTTCATTAAAAGCTTCCTTAAGGAAGCTTTTAATGAAG0.136300.112700.500000.750001.000001.00000


Target Position: 2317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2317GAGUUACUAAAAAAACAAG79.998622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6302335GAGTTACTAAAAAAACAAGCTTGTTTTTTTAGTAACTC0.274900.186900.672400.500001.000001.00000


Target Position: 1613, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613GAUUUGGUAAUUAAAAUUA92.525588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2951631GATTTGGTAATTAAAATTATAATTTTAATTACCAAATC0.287400.130400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1611-1633TGGATTTGGTAATTAAAATTAGAUAAUUUUAAUUACCAAAUCCAGAUUUGGUAAUUAAAAUUAGAU-9.718.822


Target Position: 576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
576GUUCAAGCUCCUCCCGCAA81.0661550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
716594GTTCAAGCTCCTCCCGCAATTGCGGGAGGAGCTTGAAC0.087700.035400.500000.750000.951100.75000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787GAGGAGGAGGAGGAUGAAG70.51611252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
629805GAGGAGGAGGAGGATGAAGCTTCATCCTCCTCCTCCTC0.867600.805200.672400.500001.000001.00000


Target Position: 284, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
284CAGAUGAAUUUGAAGAACU85.9235307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
564302CAGATGAATTTGAAGAACTAGTTCTTCAAATTCATCTG0.090700.023400.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
282-304CACAGATGAATTTGAAGAACTGGAGUUCUUCAAAUUCAUCUGUGCAGAUGAAUUUGAAGAACUGGU21.520.402


Target Position: 1642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1642ACCUUCAAACUUCAACUUC58.82481965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5931660ACCTTCAAACTTCAACTTCGAAGTTGAAGTTTGAAGGT0.222500.028000.681000.500001.000001.00000


Target Position: 2081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2081AAUCUUUUUAUACAAUUUU73.46271057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6722099AATCTTTTTATACAATTTTAAAATTGTATAAAAAGATT0.522000.247800.508600.500001.000001.00000


Target Position: 1735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1735GAGAAUUCUUCCACAUGUA98.966917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741753GAGAATTCTTCCACATGTATACATGTGGAAGAATTCTC0.252700.065200.629300.750001.000001.00000


Target Position: 1070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070GGGGGUUGCGGGGGGAGGG42.512388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131088GGGGGTTGCGGGGGGAGGGCCCTCCCCCCGCAACCCCC0.383600.013700.500000.500001.000001.00000


Target Position: 1136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136AUUUUUUUCCCCUACUUUU70.32241268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6451154ATTTTTTTCCCCTACTTTTAAAAGTAGGGGAAAAAAAT0.568000.562300.508600.500001.000001.00000


Target Position: 1702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1702UAUUAGAACGCUUUGUUUU72.66241112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241720TATTAGAACGCTTTGTTTTAAAACAAAGCGTTCTAATA0.108100.001200.543100.500001.000001.00000


Target Position: 1887, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887GAAAUGACUGCAAAUUCCU78.3158737

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1885-1907CTGAAATGACTGCAAATTCCTAGAGGAAUUUGCAGUCAUUUCAGGAAAUGACUGCAAAUUCCUAGU14.214.822


Target Position: 872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
872GUCAGAAGCGAAAACGAGA85.0121341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
781890GTCAGAAGCGAAAACGAGATCTCGTTTTCGCTTCTGAC0.507100.207900.594800.500001.000001.00000


Target Position: 1096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1096GUGGGGGUGGAAUAAAAUA87.0815250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791114GTGGGGGTGGAATAAAATATATTTTATTCCACCCCCAC0.125200.006800.750000.750001.000001.00000


Target Position: 112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
112CGGGGUUUAUUGAUUGAAU86.8346261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
765130CGGGGTTTATTGATTGAATATTCAATCAATAAACCCCG0.059500.003000.905201.000001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586CUCCCGCAACUCACAUAUC67.80711434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
714604CTCCCGCAACTCACATATCGATATGTGAGTTGCGGGAG0.067500.009800.629300.500001.000001.00000


Target Position: 903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903GGGAGAAGAUGAUGACUAA108.1271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
288921GGGAGAAGATGATGACTAATTAGTCATCATCTTCTCCC0.258900.234200.956901.000001.000001.00000


Target Position: 981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981CUCUCCCCCCCCCCUCCAA63.92081688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
258999CTCTCCCCCCCCCCTCCAATTGGAGGGGGGGGGGAGAG0.852600.836300.663800.750001.000001.00000


Target Position: 2292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2292AAAAGCUUCCUUUAAAAAA80.8949557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862310AAAAGCTTCCTTTAAAAAATTTTTTAAAGGAAGCTTTT0.162600.060400.500000.500000.972800.62500


Target Position: 2129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2129GCCAUUGAUCUUUUCAAGA82.377468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7712147GCCATTGATCTTTTCAAGATCTTGAAAAGATCAATGGC0.062200.002600.775900.750000.983700.75000


Target Position: 2232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2232UGUGAUACUAUGUUUGGAU79.3217668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7212250TGTGATACTATGTTTGGATATCCAAACATAGTATCACA0.043400.010600.525900.750001.000001.00000


Target Position: 221, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
221CUGAUGUGAAAGAACUUGU74.9804959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
708239CTGATGTGAAAGAACTTGTACAAGTTCTTTCACATCAG0.058200.005500.577600.500001.000001.00000


Target Position: 2424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2424GGUUGAAAACUCAGGAAUG81.7395506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6452442GGTTGAAAACTCAGGAATGCATTCCTGAGTTTTCAACC0.062900.028900.698300.750001.000001.00000


Target Position: 2439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2439AAUGUUUAUAAAACAAAUU74.9358961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6942457AATGTTTATAAAACAAATTAATTTGTTTTATAAACATT0.142000.041400.500000.500000.972800.75000


Target Position: 439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
439CUCACGCAUCUAAAUUUAA87.7813224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
258457CTCACGCATCTAAATTTAATTAAATTTAGATGCGTGAG0.314700.115900.775900.750001.000001.00000


Target Position: 2450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2450AACAAAUUAUUUCACAAAA85.9451303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8152468AACAAATTATTTCACAAAATTTTGTGAAATAATTTGTT0.196300.110200.646600.500001.000001.00000


Target Position: 169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
169GAGAUGGAGAUGGGCAGAC64.99121621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760187GAGATGGAGATGGGCAGACGTCTGCCCATCTCCATCTC0.065700.021600.491400.500001.000001.00000


Target Position: 344, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344CAAACUUACCAAAGUUAAA93.037882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
704362CAAACTTACCAAAGTTAAATTTAACTTTGGTAAGTTTG0.048700.020900.646600.750000.923900.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
342-364CGCAAACTTACCAAAGTTAAACAUUUAACUUUGGUAAGUUUGCGCAAACUUACCAAAGUUAAACAU4.94.902


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892CCUGAAGAUGAGGGAGAAG68.87611361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
357910CCTGAAGATGAGGGAGAAGCTTCTCCCTCATCTTCAGG0.199900.073600.706900.750001.000001.00000


Target Position: 448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448CUAAAUUUAAGUGGCAACA74.13761018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831466CTAAATTTAAGTGGCAACATGTTGCCACTTAAATTTAG0.036900.023900.465500.500001.000001.00000


Target Position: 2063, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2063CAUUGAUAAAUUUCAAUAA97.674922

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8206319CATTGATAAATTTCAATAA1/1/0/093.97ANP32ANM_006305.31NANANA15:69071260..69071278(-)00ANP32A(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2061-2083GTCATTGATAAATTTCAATAAATUUAUUGAAAUUUAUCAAUGACCAUUGAUAAAUUUCAAUAAAUU8.98.722


Target Position: 994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
994CUCCAAUCCUGCCCCCUGA75.0387953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6971012CTCCAATCCTGCCCCCTGATCAGGGGGCAGGATTGGAG0.601200.514900.586200.500001.000001.00000


Target Position: 1884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1884UCUGAAAUGACUGCAAAUU66.01831551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6671902TCTGAAATGACTGCAAATTAATTTGCAGTCATTTCAGA0.057100.019100.715500.750001.000001.00000


Target Position: 1352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1352CAUAUCUUUUGCUUUGGUU80.4806584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791370CATATCTTTTGCTTTGGTTAACCAAAGCAAAAGATATG0.026300.005000.508600.750001.000001.00000


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722AGGUAGUGGAAGACGAGGA79.9399625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
793740AGGTAGTGGAAGACGAGGATCCTCGTCTTCCACTACCT0.472400.262600.474100.500001.000001.00000


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684GGAGGAUGAGGAUGAGGAG81.6541512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500702GGAGGATGAGGATGAGGAGCTCCTCATCCTCATCCTCC0.787000.662800.560300.750001.000001.00000


Target Position: 2310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310AGUUACAGAGUUACUAAAA89.4719168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2312328AGTTACAGAGTTACTAAAATTTTAGTAACTCTGTAACT0.386700.114100.706900.750001.000001.00000


Target Position: 1954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1954AGUGACGUGUAAUUUCUGA83.4157416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7821972AGTGACGTGTAATTTCTGATCAGAAATTACACGTCACT0.288800.002200.482800.500001.000001.00000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438CCUCACGCAUCUAAAUUUA87.9823217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
118456CCTCACGCATCTAAATTTATAAATTTAGATGCGTGAGG0.664300.235500.810301.000001.000001.00000


Target Position: 697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
697GAGGAGGAGUAUGAUGAAG76.8652823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754715GAGGAGGAGTATGATGAAGCTTCATCATACTCCTCCTC0.146800.077400.672400.500001.000001.00000


Target Position: 992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
992CCCUCCAAUCCUGCCCCCU55.45872080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291010CCCTCCAATCCTGCCCCCTAGGGGGCAGGATTGGAGGG0.744900.597400.646600.750001.000001.00000


Target Position: 77, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
77AGCCUUCAAAGUCCUAAAA78.9941684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
39095AGCCTTCAAAGTCCTAAAATTTTAGGACTTTGAAGGCT0.255900.051600.853400.750001.000001.00000


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002CUGCCCCCUGAAACUUAUU68.47211395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3751020CTGCCCCCTGAAACTTATTAATAAGTTTCAGGGGGCAG0.538100.449400.775900.750001.000001.00000


Target Position: 851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
851AGCUUGGUGAAGAAGAAAG67.37841466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
744869AGCTTGGTGAAGAAGAAAGCTTTCTTCTTCACCAAGCT0.603800.020500.715500.500001.000001.00000


Target Position: 2043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2043UGAGUUUUAUGUCUGUUUG66.80711503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072061TGAGTTTTATGTCTGTTTGCAAACAGACATAAAACTCA0.050400.005500.577600.500001.000001.00000


Target Position: 610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
610GGCUAUGACCGGGACGACA84.6215364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
669628GGCTATGACCGGGACGACATGTCGTCCCGGTCATAGCC0.189500.007200.793100.750000.962000.62500


Target Position: 1251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1251UCUUACGUUUCCUGGUAUU68.41121397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5491269TCTTACGTTTCCTGGTATTAATACCAGGAAACGTAAGA0.097300.029500.715500.750001.000001.00000


Target Position: 733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733GACGAGGAGGACGAGGAUG66.49851528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
622751GACGAGGAGGACGAGGATGCATCCTCGTCCTCCTCGTC0.468700.354400.663800.500001.000001.00000


Target Position: 2054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2054UCUGUUUGUCAUUGAUAAA83.2437428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8162072TCTGTTTGTCATTGATAAATTTATCAATGACAAACAGA0.016700.002000.724100.750001.000001.00000


Target Position: 290, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
290AAUUUGAAGAACUGGAAUU75.8815890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
804308AATTTGAAGAACTGGAATTAATTCCAGTTCTTCAAATT0.037300.005900.500000.500001.000001.00000


Target Position: 995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
995UCCAAUCCUGCCCCCUGAA65.5431574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741013TCCAATCCTGCCCCCTGAATTCAGGGGGCAGGATTGGA0.592000.503700.698300.750001.000001.00000


Target Position: 155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
155GAGAGAGAGCGCGAGAGAU87.8781220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719173GAGAGAGAGCGCGAGAGATATCTCTCGCGCTCTCTCTC0.043400.005700.629300.750001.000001.00000


Target Position: 611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
611GCUAUGACCGGGACGACAA88.2634207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608629GCTATGACCGGGACGACAATTGTCGTCCCGGTCATAGC0.187800.010600.706901.000001.000001.00000


Target Position: 1304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1304CUGGUCUCAGUUUGGUUAC59.60521923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8301322CTGGTCTCAGTTTGGTTACGTAACCAAACTGAGACCAG0.014800.003800.603400.500000.967400.62500


Target Position: 738, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738GGAGGACGAGGAUGAGGAG79.4684655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503756GGAGGACGAGGATGAGGAGCTCCTCATCCTCGTCCTCC0.670000.388800.560300.750001.000001.00000


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544GUAACCAACCUGAACGACU76.4918846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802562GTAACCAACCTGAACGACTAGTCGTTCAGGTTGGTTAC0.269500.077700.474100.500001.000001.00000


Target Position: 1543, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1543GUUACUCUUGAGCUUAUGA86.5725269

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1541-1563ATGTTACTCTTGAGCTTATGAGCUCAUAAGCUCAAGAGUAACAUGUUACUCUUGAGCUUAUGAGCU19.718.933


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667GGCCUGGAUGAUGAGGAGG57.48142012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
652685GGCCTGGATGATGAGGAGGCCTCCTCATCATCCAGGCC0.580500.008200.655200.500000.972800.62500


Target Position: 2271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2271ACUCAGUGGUGUAUCUUCA87.6544228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322289ACTCAGTGGTGTATCTTCATGAAGATACACCACTGAGT0.015900.001300.482800.500001.000001.00000


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450AAAUUUAAGUGGCAACAAA91.0529117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
713468AAATTTAAGTGGCAACAAATTTGTTGCCACTTAAATTT0.132000.021600.500000.500001.000001.00000


Target Position: 490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490GAGCCACUGAAAAAGUUAG77.0178810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
659508GAGCCACTGAAAAAGTTAGCTAACTTTTTCAGTGGCTC0.320000.015200.637900.500001.000001.00000


Target Position: 1011, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1011GAAACUUAUUUUUUUCUGA90.8515124

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1009-1031CTGAAACTTATTTTTTTCTGATTUCAGAAAAAAAUAAGUUUCAGGAAACUUAUUUUUUUCUGAUUU12.24.922


Target Position: 1343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343AGCACCAGCCAUAUCUUUU75.7518903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7951361AGCACCAGCCATATCTTTTAAAAGATATGGCTGGTGCT0.416000.002000.853400.750000.907600.62500


Target Position: 1873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1873CCUAGUGGAAAUCUGAAAU80.4419589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6161891CCTAGTGGAAATCTGAAATATTTCAGATTTCCACTAGG0.157000.010300.836201.000001.000001.00000


Target Position: 2459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2459UUUCACAAAAAAAAAAAAA67.77261435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7582477TTTCACAAAAAAAAAAAAATTTTTTTTTTTTTGTGAAA0.989200.259800.500000.500001.000001.00000


Target Position: 1604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1604AGGAAAAUGGAUUUGGUAA86.5105273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861622AGGAAAATGGATTTGGTAATTACCAAATCCATTTTCCT0.185100.066300.810300.750001.000001.00000


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690UGAGGAUGAGGAGGAGUAU76.7969826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436708TGAGGATGAGGAGGAGTATATACTCCTCCTCATCCTCA0.156000.136000.681000.750001.000001.00000


Target Position: 1612, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612GGAUUUGGUAAUUAAAAUU87.4268240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051630GGATTTGGTAATTAAAATTAATTTTAATTACCAAATCC0.238900.123300.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1610-1632ATGGATTTGGTAATTAAAATTAGAAUUUUAAUUACCAAAUCCAUGGAUUUGGUAAUUAAAAUUAGU-9.720.122


Target Position: 1964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1964AAUUUCUGAACCCAUGUUU69.41271320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521982AATTTCTGAACCCATGTTTAAACATGGGTTCAGAAATT0.138700.046600.508600.500001.000001.00000


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894UGAAGAUGAGGGAGAAGAU83.2818427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
558912TGAAGATGAGGGAGAAGATATCTTCTCCCTCATCTTCA0.651900.137000.543100.750001.000001.00000


Target Position: 598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
598ACAUAUCUCGACGGCUAUG64.28651663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571616ACATATCTCGACGGCTATGCATAGCCGTCGAGATATGT0.122800.013400.551700.500001.000001.00000


Target Position: 443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
443CGCAUCUAAAUUUAAGUGG58.35671976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
800461CGCATCTAAATTTAAGTGGCCACTTAAATTTAGATGCG0.029000.029100.577600.500001.000001.00000


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371CACAUGAUGAUACCUGCUU76.7101830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961389CACATGATGATACCTGCTTAAGCAGGTATCATCATGTG0.122600.021700.655200.750001.000001.00000


Target Position: 1283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283GGGUUGGUUGGAAGGCUGU71.70991180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8311301GGGTTGGTTGGAAGGCTGTACAGCCTTCCAACCAACCC0.013300.002300.784500.750001.000001.00000


Target Position: 1967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967UUCUGAACCCAUGUUUCAU69.28741332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6321985TTCTGAACCCATGTTTCATATGAAACATGGGTTCAGAA0.223600.031100.517200.500001.000001.00000


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518AGAGCUUAGACCUUUUCAA88.865191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469536AGAGCTTAGACCTTTTCAATTGAAAAGGTCTAAGCTCT0.235900.089000.577600.750001.000001.00000


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237AUGGUUUGGAGUUCUCUUA78.1567747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581255ATGGTTTGGAGTTCTCTTATAAGAGAACTCCAAACCAT0.176300.011300.620700.500001.000001.00000


Target Position: 2454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2454AAUUAUUUCACAAAAAAAA84.3194379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6402472AATTATTTCACAAAAAAAATTTTTTTTGTGAAATAATT0.973100.181700.508600.500001.000001.00000


Target Position: 153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
153CAGAGAGAGAGCGCGAGAG70.90561236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
804171CAGAGAGAGAGCGCGAGAGCTCTCGCGCTCTCTCTCTG0.018500.009000.474100.500001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792GGAGGAGGAUGAAGAAGGU86.3942279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
634810GGAGGAGGATGAAGAAGGTACCTTCTTCATCCTCCTCC0.207500.207500.517200.750001.000001.00000


Target Position: 2366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366GAACCUUGUUUUGAAUAUC75.0297955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472384GAACCTTGTTTTGAATATCGATATTCAAAACAAGGTTC0.185300.078400.491400.500001.000001.00000


Target Position: 332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
332UCACCUCAAUCGCAAACUU73.93411034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
440350TCACCTCAATCGCAAACTTAAGTTTGCGATTGAGGTGA0.172700.049700.586200.750001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513CCUCAAGAGCUUAGACCUU80.4644586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
617531CCTCAAGAGCTTAGACCTTAAGGTCTAAGCTCTTGAGG0.192000.010300.706901.000001.000001.00000


Target Position: 2457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2457UAUUUCACAAAAAAAAAAA75.4291926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472475TATTTCACAAAAAAAAAAATTTTTTTTTTTGTGAAATA0.987100.212900.543100.500001.000001.00000


Target Position: 987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
987CCCCCCCCUCCAAUCCUGC42.82742386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531005CCCCCCCCTCCAATCCTGCGCAGGATTGGAGGGGGGGG0.763600.742200.637900.500001.000001.00000


Target Position: 1654, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1654CAACUUCUUUAAAAGAAAA94.559953

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1652-1674TTCAACTTCTTTAAAAGAAAAAAUUUUCUUUUAAAGAAGUUGAACAACUUCUUUAAAAGAAAAAAU5.517.722


Target Position: 871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
871GGUCAGAAGCGAAAACGAG79.3183670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544889GGTCAGAAGCGAAAACGAGCTCGTTTTCGCTTCTGACC0.493900.107400.543100.750001.000001.00000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679CUGUCCUAUCUUGUUCUGU69.47911317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6271697CTGTCCTATCTTGTTCTGTACAGAACAAGATAGGACAG0.073900.078400.577600.500001.000001.00000


Target Position: 1361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1361UGCUUUGGUUCACAUGAUG64.98651622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5841379TGCTTTGGTTCACATGATGCATCATGTGAACCAAAGCA0.231300.017100.698300.500001.000001.00000


Target Position: 1130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130CUCUUUAUUUUUUUCCCCU72.59741117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8211148CTCTTTATTTTTTTCCCCTAGGGGAAAAAAATAAAGAG0.628500.622000.465500.500001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666GGGCCUGGAUGAUGAGGAG77.1104799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
817684GGGCCTGGATGATGAGGAGCTCCTCATCATCCAGGCCC0.583000.001300.681000.750000.972800.62500


Target Position: 2200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200AUAGAAUAGCUUUUCUUAU81.2972529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7102218ATAGAATAGCTTTTCTTATATAAGAAAAGCTATTCTAT0.098400.011200.500000.500000.956500.62500


Target Position: 336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
336CUCAAUCGCAAACUUACCA76.9802814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
816354CTCAATCGCAAACTTACCATGGTAAGTTTGCGATTGAG0.167400.137600.465500.500001.000001.00000


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281UCACAGAUGAAUUUGAAGA76.076876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
704299TCACAGATGAATTTGAAGATCTTCAAATTCATCTGTGA0.092400.032600.500000.500001.000001.00000


Target Position: 1962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962GUAAUUUCUGAACCCAUGU71.41311202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7971980GTAATTTCTGAACCCATGTACATGGGTTCAGAAATTAC0.105800.044000.474100.500001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057GGAAGAGUGUACUGGGGGU81.9615491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6251075GGAAGAGTGTACTGGGGGTACCCCCAGTACACTCTTCC0.088800.026200.517200.750001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583CUCCUCCCGCAACUCACAU68.68051378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
628601CTCCTCCCGCAACTCACATATGTGAGTTGCGGGAGGAG0.076100.009400.655200.750001.000001.00000


Target Position: 2389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2389AUUGUUUUGUUUGUCGUAU67.53991451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262407ATTGTTTTGTTTGTCGTATATACGACAAACAAAACAAT0.288200.045900.465500.500001.000001.00000


Target Position: 1883, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1883AUCUGAAAUGACUGCAAAU81.8687496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7301901ATCTGAAATGACTGCAAATATTTGCAGTCATTTCAGAT0.039700.024600.672400.500001.000001.00000


Target Position: 1767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767AACAUUUUUACGGACCUAA77.0885804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231785AACATTTTTACGGACCTAATTAGGTCCGTAAAAATGTT0.014500.008500.612100.500001.000001.00000


Target Position: 1789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1789CUGGAGACGUUGCUGCAUG69.7251302

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081807CTGGAGACGTTGCTGCATGCATGCAGCAACGTCTCCAG0.082600.001500.629300.500001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046GGAACGAGAGGGGAAGAGU77.1193796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3511064GGAACGAGAGGGGAAGAGTACTCTTCCCCTCTCGTTCC0.267700.044700.663800.750001.000001.00000


Target Position: 958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958UUGACUGUUUUUACCCAUA76.3735856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
765976TTGACTGTTTTTACCCATATATGGGTAAAAACAGTCAA0.381800.237900.603400.500001.000001.00000


Target Position: 829, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
829GAUGACGAGGAAGAUGAAG68.68351377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608847GATGACGAGGAAGATGAAGCTTCATCTTCCTCGTCATC0.615600.103100.543100.500001.000001.00000


Target Position: 874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874CAGAAGCGAAAACGAGAAC65.34821589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
709892CAGAAGCGAAAACGAGAACGTTCTCGTTTTCGCTTCTG0.046800.032100.637900.500001.000001.00000


Target Position: 977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
977UCCCCUCUCCCCCCCCCCU39.93782421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
703995TCCCCTCTCCCCCCCCCCTAGGGGGGGGGGAGAGGGGA0.984300.904300.525900.500001.000001.00000


Target Position: 700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
700GAGGAGUAUGAUGAAGAUG75.7316905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
675718GAGGAGTATGATGAAGATGCATCTTCATCATACTCCTC0.055100.020100.655200.500001.000001.00000


Target Position: 850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
850GAGCUUGGUGAAGAAGAAA89.9617146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569868GAGCTTGGTGAAGAAGAAATTTCTTCTTCACCAAGCTC0.681600.013600.810300.750001.000001.00000


Target Position: 2431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2431AACUCAGGAAUGUUUAUAA93.119478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072449AACTCAGGAATGTTTATAATTATAAACATTCCTGAGTT0.074200.025500.612100.500001.000001.00000


Target Position: 2238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2238ACUAUGUUUGGAUAUUUUU75.7009907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6762256ACTATGTTTGGATATTTTTAAAAATATCCAAACATAGT0.054900.013300.706900.750001.000001.00000


Target Position: 1657, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1657CUUCUUUAAAAGAAAAAAA85.5537326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3671675CTTCTTTAAAAGAAAAAAATTTTTTTCTTTTAAAGAAG0.194600.107200.637900.750000.951100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1655-1677AACTTCTTTAAAAGAAAAAAAAAUUUUUUUCUUUUAAAGAAGUUCUUCUUUAAAAGAAAAAAAAAU0.77.111


Target Position: 2365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365GGAACCUUGUUUUGAAUAU84.8365355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3532383GGAACCTTGTTTTGAATATATATTCAAAACAAGGTTCC0.203800.081400.827601.000001.000001.00000


Target Position: 2308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2308AAAGUUACAGAGUUACUAA96.350233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8372326AAAGTTACAGAGTTACTAATTAGTAACTCTGTAACTTT0.353100.082200.465500.500001.000001.00000


Target Position: 430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
430UGUCCGAACCUCACGCAUC63.82631694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
769448TGTCCGAACCTCACGCATCGATGCGTGAGGTTCGGACA0.238400.050900.525900.500000.994600.62500


Target Position: 1482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1482CUCAUCCCUUUUCCCCCUU59.49631928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2451500CTCATCCCTTTTCCCCCTTAAGGGGGAAAAGGGATGAG0.331000.189900.672400.750001.000001.00000


Target Position: 1117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1117AUUUUUACUGCCACUCUUU72.84911100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6471135ATTTTTACTGCCACTCTTTAAAGAGTGGCAGTAAAAAT0.252500.158000.508600.500001.000001.00000


Target Position: 2027, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2027CAGAAGAGCCAAACUUUGA86.9923253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872045CAGAAGAGCCAAACTTTGATCAAAGTTTGGCTCTTCTG0.047300.002200.560300.500001.000001.00000


Target Position: 971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
971CCCAUAUCCCCUCUCCCCC50.09192249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
695989CCCATATCCCCTCTCCCCCGGGGGAGAGGGGATATGGG0.979500.546000.500000.500001.000001.00000


Target Position: 1640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1640ACACCUUCAAACUUCAACU74.6963979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6991658ACACCTTCAAACTTCAACTAGTTGAAGTTTGAAGGTGT0.374500.051200.500000.500001.000001.00000


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681GGAGGAGGAUGAGGAUGAG80.3745592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495699GGAGGAGGATGAGGATGAGCTCATCCTCATCCTCCTCC0.742000.655100.560300.750001.000001.00000


Target Position: 1994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1994AAGAACAUCUGCACCAGUU78.6148716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482012AAGAACATCTGCACCAGTTAACTGGTGCAGATGTTCTT0.065100.012400.491400.500001.000001.00000


Target Position: 1714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714UUGUUUUACAAAAAAUGAU67.68491442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201732TTGTTTTACAAAAAATGATATCATTTTTTGTAAAACAA0.121400.028400.465500.500001.000001.00000


Target Position: 1995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1995AGAACAUCUGCACCAGUUU78.6589712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512013AGAACATCTGCACCAGTTTAAACTGGTGCAGATGTTCT0.062000.021100.724100.750001.000001.00000


Target Position: 2197, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2197CUGAUAGAAUAGCUUUUCU82.804451

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2195-2217ACCTGATAGAATAGCTTTTCTTAAGAAAAGCUAUUCUAUCAGGUCUGAUAGAAUAGCUUUUCUUAU21.021.422


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927AUAACCUAUUUUGAAAAAU69.15681339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578945ATAACCTATTTTGAAAAATATTTTTCAAAATAGGTTAT0.191900.052400.534500.500001.000001.00000


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050CGAGAGGGGAAGAGUGUAC72.30241142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5671068CGAGAGGGGAAGAGTGTACGTACACTCTTCCCCTCTCG0.090200.016000.612100.750001.000001.00000


Target Position: 2042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2042UUGAGUUUUAUGUCUGUUU66.73271510

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6982060TTGAGTTTTATGTCTGTTTAAACAGACATAAAACTCAA0.049600.006100.646600.500001.000001.00000


Target Position: 162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
162AGCGCGAGAGAUGGAGAUG62.69651774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566180AGCGCGAGAGATGGAGATGCATCTCCATCTCTCGCGCT0.161900.019700.698300.500001.000001.00000


Target Position: 1244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244GGAGUUCUCUUACGUUUCC68.89481359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6661262GGAGTTCTCTTACGTTTCCGGAAACGTAAGAGAACTCC0.213800.014700.500000.500001.000001.00000


Target Position: 1152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1152UUUUCUUUGUGUCCGGUUU61.43591837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981170TTTTCTTTGTGTCCGGTTTAAACCGGACACAAAGAAAA0.153400.099300.500000.500001.000001.00000


Target Position: 163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
163GCGCGAGAGAUGGAGAUGG61.55131827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
527181GCGCGAGAGATGGAGATGGCCATCTCCATCTCTCGCGC0.161400.017700.577600.500001.000001.00000


Target Position: 1766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1766GAACAUUUUUACGGACCUA92.288195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601784GAACATTTTTACGGACCTATAGGTCCGTAAAAATGTTC0.031300.017200.500000.750001.000001.00000


Target Position: 2437, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2437GGAAUGUUUAUAAAACAAA93.852464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3802455GGAATGTTTATAAAACAAATTTGTTTTATAAACATTCC0.198400.037000.870701.000000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2435-2457CAGGAATGTTTATAAAACAAATTUUUGUUUUAUAAACAUUCCUGGGAAUGUUUAUAAAACAAAUUU5.614.821


Target Position: 2325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2325AAAAAAACAAGUACCCAAA83.6682403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7032343AAAAAAACAAGTACCCAAATTTGGGTACTTGTTTTTTT0.062700.047000.500000.500001.000001.00000


Target Position: 1638, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1638ACACACCUUCAAACUUCAA81.688511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081656ACACACCTTCAAACTTCAATTGAAGTTTGAAGGTGTGT0.848900.152300.560300.750001.000001.00000


Target Position: 1375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375UGAUGAUACCUGCUUUUCU79.1587679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281393TGATGATACCTGCTTTTCTAGAAAAGCAGGTATCATCA0.126400.028000.500000.500001.000001.00000


Target Position: 1467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1467GGACAUUCCCCAUCUCUCA92.209496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6531485GGACATTCCCCATCTCTCATGAGAGATGGGGAATGTCC0.128700.008200.646600.750000.945700.62500


Target Position: 1812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1812CUGGGUUUUUUUUUUCAUA86.0551296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621830CTGGGTTTTTTTTTTCATATATGAAAAAAAAAACCCAG0.600100.007600.741400.750001.000001.00000


Target Position: 870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
870GGGUCAGAAGCGAAAACGA90.4257131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
237888GGGTCAGAAGCGAAAACGATCGTTTTCGCTTCTGACCC0.638900.089100.698300.750001.000001.00000


Target Position: 1923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1923GCUUUCGUGUCCCUCUUCU74.6229990

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5951941GCTTTCGTGTCCCTCTTCTAGAAGAGGGACACGAAAGC0.083800.011400.629300.750001.000001.00000


Target Position: 2332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332CAAGUACCCAAACAAUCAA91.3551112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7352350CAAGTACCCAAACAATCAATTGATTGTTTGGGTACTTG0.153300.016600.500000.750001.000001.00000


Target Position: 2036, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2036CAAACUUUGAGUUUUAUGU77.2092793

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2034-2056GCCAAACTTTGAGTTTTATGTCTACAUAAAACUCAAAGUUUGGCCAAACUUUGAGUUUUAUGUCUU-1.43.221


Target Position: 2029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2029GAAGAGCCAAACUUUGAGU78.5918720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122047GAAGAGCCAAACTTTGAGTACTCAAAGTTTGGCTCTTC0.034900.002800.465500.500001.000001.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834CGAGGAAGAUGAAGAAGAG86.9841254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
779852CGAGGAAGATGAAGAAGAGCTCTTCTTCATCTTCCTCG0.299800.130600.482800.750001.000001.00000


Target Position: 1651, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1651CUUCAACUUCUUUAAAAGA84.3691378

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1649-1671AACTTCAACTTCTTTAAAAGAAAUCUUUUAAAGAAGUUGAAGUUCUUCAACUUCUUUAAAAGAAAU-3.819.222


Target Position: 752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
752AGGAGGAGGAAGGUGAAGA75.5661916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
646770AGGAGGAGGAAGGTGAAGATCTTCACCTTCCTCCTCCT0.783500.689600.620700.500001.000001.00000


Target Position: 916, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
916GACUAAGUGGAAUAACCUA99.083216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
914-936ATGACTAAGTGGAATAACCTATTUAGGUUAUUCCACUUAGUCAUGACUAAGUGGAAUAACCUAUUU18.517.623


Target Position: 1120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1120UUUACUGCCACUCUUUAUU62.76861765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7461138TTTACTGCCACTCTTTATTAATAAAGAGTGGCAGTAAA0.408900.200000.491400.500001.000001.00000


Target Position: 367, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
367CUUAAGAAGCUUGAACUAA85.7655317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
741385CTTAAGAAGCTTGAACTAATTAGTTCAAGCTTCTTAAG0.037800.008500.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
365-387AACTTAAGAAGCTTGAACTAAGCUUAGUUCAAGCUUCUUAAGUUCUUAAGAAGCUUGAACUAAGCU20.37.102


Target Position: 191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191UUCAUUUAGAGCUGCGGAA68.55451386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710209TTCATTTAGAGCTGCGGAATTCCGCAGCTCTAAATGAA0.090600.005300.500000.500001.000001.00000


Target Position: 2378, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2378GAAUAUCUUUCAUUGUUUU90.964120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5872396GAATATCTTTCATTGTTTTAAAACAATGAAAGATATTC0.084400.030600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2376-2398TTGAATATCTTTCATTGTTTTGTAAAACAAUGAAAGAUAUUCAAGAAUAUCUUUCAUUGUUUUGUU5.36.623


Target Position: 852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
852GCUUGGUGAAGAAGAAAGG65.71151563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
675870GCTTGGTGAAGAAGAAAGGCCTTTCTTCTTCACCAAGC0.594500.025000.508600.500001.000001.00000


Target Position: 453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
453UUUAAGUGGCAACAAAAUU64.4561655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
751471TTTAAGTGGCAACAAAATTAATTTTGTTGCCACTTAAA0.818100.018100.491400.500001.000001.00000


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847AACUAACGCAAAAUUGUAU78.9394687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741865AACTAACGCAAAATTGTATATACAATTTTGCGTTAGTT0.179300.123600.603400.500001.000001.00000


Target Position: 759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759GGAAGGUGAAGAGGAGGAC67.8741429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
539777GGAAGGTGAAGAGGAGGACGTCCTCCTCTTCACCTTCC0.392700.364100.551700.750001.000001.00000


Target Position: 1121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1121UUACUGCCACUCUUUAUUU70.81221238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6611139TTACTGCCACTCTTTATTTAAATAAAGAGTGGCAGTAA0.451700.226100.534500.500001.000001.00000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645UUCAAACUUCAACUUCUUU66.50491524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7131663TTCAAACTTCAACTTCTTTAAAGAAGTTGAAGTTTGAA0.193100.164800.672400.500001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264GGUAUUUCCCAAGUCUCUU79.4566656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251282GGTATTTCCCAAGTCTCTTAAGAGACTTGGGAAATACC0.014300.001200.715501.000000.978300.75000


Target Position: 1736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736AGAAUUCUUCCACAUGUAC69.1841337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6201754AGAATTCTTCCACATGTACGTACATGTGGAAGAATTCT0.105700.015300.543100.500001.000001.00000


Target Position: 2397, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2397GUUUGUCGUAUUGUAAAAA85.8073315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3522415GTTTGTCGTATTGTAAAAATTTTTACAATACGACAAAC0.268500.044500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2395-2417TTGTTTGTCGTATTGTAAAAAGAUUUUUACAAUACGACAAACAAGUUUGUCGUAUUGUAAAAAGAU7.221.122


Target Position: 1009, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009CUGAAACUUAUUUUUUUCU72.56671120

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1007-1029CCCTGAAACTTATTTTTTTCTGAAGAAAAAAAUAAGUUUCAGGGCUGAAACUUAUUUUUUUCUGAU0.719.222


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043GUGGGAACGAGAGGGGAAG58.90171959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651061GTGGGAACGAGAGGGGAAGCTTCCCCTCTCGTTCCCAC0.251400.036700.655200.500001.000001.00000


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UAUUGUGAUUUGACUGUUU79.3734662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
545967TATTGTGATTTGACTGTTTAAACAGTCAAATCACAATA0.365200.066800.543100.500001.000001.00000


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866UUUCUUACCUAGUGGAAAU73.3881064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7571884TTTCTTACCTAGTGGAAATATTTCCACTAGGTAAGAAA0.080400.010200.491400.500001.000001.00000


Target Position: 1701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1701AUAUUAGAACGCUUUGUUU78.6597711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351719ATATTAGAACGCTTTGTTTAAACAAAGCGTTCTAATAT0.124900.001100.543100.500001.000001.00000


Target Position: 1835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835CGAGCACGGAAAAACUAAC73.93371035

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761853CGAGCACGGAAAAACTAACGTTAGTTTTTCCGTGCTCG0.504800.012900.646600.750001.000001.00000


Target Position: 1186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1186CGAUAGCUAAGUACACACU86.0726293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6231204CGATAGCTAAGTACACACTAGTGTGTACTTAGCTATCG0.073800.009800.586200.750001.000001.00000


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668GCCUGGAUGAUGAGGAGGA81.1298544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
366686GCCTGGATGATGAGGAGGATCCTCCTCATCATCCAGGC0.596100.069600.629300.750000.972800.62500


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610AUGGAUUUGGUAAUUAAAA79.3725664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6381628ATGGATTTGGTAATTAAAATTTTAATTACCAAATCCAT0.242900.103400.655200.500001.000001.00000


Target Position: 2461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2461UCACAAAAAAAAAAAAAAA78.0015753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1432479TCACAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGTGA0.993400.942900.724100.750001.000001.00000


Target Position: 2150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150CAUUCCAGAUGAACUGCUA95.045850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8322168CATTCCAGATGAACTGCTATAGCAGTTCATCTGGAATG0.013300.005200.482800.750000.918500.87500


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798GGAUGAAGAAGGUUAUAAC88.6635194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
539816GGATGAAGAAGGTTATAACGTTATAACCTTCTTCATCC0.102100.108300.724100.750001.000001.00000


Target Position: 2084, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2084CUUUUUAUACAAUUUUUUU80.2294603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3782102CTTTTTATACAATTTTTTTAAAAAAATTGTATAAAAAG0.425300.258500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2082-2104ATCTTTTTATACAATTTTTTTGGAAAAAAAUUGUAUAAAAAGAUCUUUUUAUACAAUUUUUUUGGU-12.0-9.722


Target Position: 1167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1167GUUUUUGUCCCUGUAAAUG65.53781575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7641185GTTTTTGTCCCTGTAAATGCATTTACAGGGACAAAAAC0.040500.019800.491400.500001.000001.00000


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920AAGUGGAAUAACCUAUUUU81.2329536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
758938AAGTGGAATAACCTATTTTAAAATAGGTTATTCCACTT0.388600.003200.637900.500000.962001.00000


Target Position: 410, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410UGGAAGUAUUGGCAGAAAA84.0968386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
718428TGGAAGTATTGGCAGAAAATTTTCTGCCAATACTTCCA0.043500.022900.844800.750001.000001.00000


Target Position: 1721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721ACAAAAAAUGAUGAGAGAA84.6883359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7151739ACAAAAAATGATGAGAGAATTCTCTCATCATTTTTTGT0.045500.018000.534500.750001.000001.00000


Target Position: 2025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2025CUCAGAAGAGCCAAACUUU83.7378399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7412043CTCAGAAGAGCCAAACTTTAAAGTTTGGCTCTTCTGAG0.103800.003800.810300.750000.934800.62500


Target Position: 484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
484ACAAUAGAGCCACUGAAAA84.8602352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
729502ACAATAGAGCCACTGAAAATTTTCAGTGGCTCTATTGT0.040400.010500.706900.750000.962000.62500


Target Position: 1683, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1683CCUAUCUUGUUCUGUAAAA88.5018200

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10168319CCTATCTTGTTCTGTAAAA1/1/0/093.71ANP32ANM_006305.31NANANA12:48867938..48867956(+)|15:69071640..69071658(-)00ANP32A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6651701CCTATCTTGTTCTGTAAAATTTTACAGAACAAGATAGG0.057600.046400.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1681-1703GTCCTATCTTGTTCTGTAAAATAUUUUACAGAACAAGAUAGGACCCUAUCUUGUUCUGUAAAAUAU11.811.622


Target Position: 849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
849AGAGCUUGGUGAAGAAGAA92.882785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
575867AGAGCTTGGTGAAGAAGAATTCTTCTTCACCAAGCTCT0.425700.013200.551700.750001.000001.00000


Target Position: 795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795GGAGGAUGAAGAAGGUUAU90.0026144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433813GGAGGATGAAGAAGGTTATATAACCTTCTTCATCCTCC0.157500.164100.827601.000001.000001.00000


Target Position: 940, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
940AAAAAUUCCUAUUGUGAUU77.7547765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
756958AAAAATTCCTATTGTGATTAATCACAATAGGAATTTTT0.119100.035600.491400.500001.000001.00000


Target Position: 266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
266GCAAACUCGAAGGCCUCAC57.19192023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
546284GCAAACTCGAAGGCCTCACGTGAGGCCTTCGAGTTTGC0.098000.029600.560300.750001.000001.00000


Target Position: 1790, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1790UGGAGACGUUGCUGCAUGU76.0748877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281808TGGAGACGTTGCTGCATGTACATGCAGCAACGTCTCCA0.058500.001200.637900.500001.000001.00000


Target Position: 1659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659UCUUUAAAAGAAAAAAAAA81.0665549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191677TCTTTAAAAGAAAAAAAAATTTTTTTTTCTTTTAAAGA0.403400.126400.724100.750001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950AUUGUGAUUUGACUGUUUU74.37731003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644968ATTGTGATTTGACTGTTTTAAAACAGTCAAATCACAAT0.407500.080700.508600.500001.000001.00000


Target Position: 2082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2082AUCUUUUUAUACAAUUUUU76.8753822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6482100ATCTTTTTATACAATTTTTAAAAATTGTATAAAAAGAT0.483400.248400.681000.500001.000001.00000


Target Position: 2456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2456UUAUUUCACAAAAAAAAAA74.414999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8372474TTATTTCACAAAAAAAAAATTTTTTTTTTGTGAAATAA0.986000.199800.534500.500001.000001.00000


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840ACGGAAAAACUAACGCAAA81.7003509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3951858ACGGAAAAACTAACGCAAATTTGCGTTAGTTTTTCCGT0.606300.096900.775900.750001.000001.00000


Target Position: 156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
156AGAGAGAGCGCGAGAGAUG72.42941130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
697174AGAGAGAGCGCGAGAGATGCATCTCTCGCGCTCTCTCT0.174900.005800.569000.500001.000001.00000


Target Position: 273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
273CGAAGGCCUCACAGAUGAA96.058637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811291CGAAGGCCTCACAGATGAATTCATCTGTGAGGCCTTCG0.090100.001400.620701.000001.000001.00000


Target Position: 2449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2449AAACAAAUUAUUUCACAAA88.2943204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7222467AAACAAATTATTTCACAAATTTGTGAAATAATTTGTTT0.198500.070400.500000.500001.000001.00000


Target Position: 1155, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1155UCUUUGUGUCCGGUUUUUG55.31782085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6441173TCTTTGTGTCCGGTTTTTGCAAAAACCGGACACAAAGA0.143200.092300.577600.500001.000001.00000


Target Position: 1306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1306GGUCUCAGUUUGGUUACUC72.32131138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261324GGTCTCAGTTTGGTTACTCGAGTAACCAAACTGAGACC0.014300.003500.543100.750000.994600.62500


Target Position: 2432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2432ACUCAGGAAUGUUUAUAAA91.6196105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4562450ACTCAGGAATGTTTATAAATTTATAAACATTCCTGAGT0.147300.023900.706900.750001.000001.00000


Target Position: 1691, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1691GUUCUGUAAAAUAUUAGAA91.4063110

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1689-1711TTGTTCTGTAAAATATTAGAACGUUCUAAUAUUUUACAGAACAAGUUCUGUAAAAUAUUAGAACGU8.420.322


Target Position: 111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
111UCGGGGUUUAUUGAUUGAA69.40751321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
717129TCGGGGTTTATTGATTGAATTCAATCAATAAACCCCGA0.177300.005000.620700.750001.000001.00000


Target Position: 1618, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1618GGUAAUUAAAAUUAGAAGA88.497203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5681636GGTAATTAAAATTAGAAGATCTTCTAATTTTAATTACC0.090100.019400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1616-1638TTGGTAATTAAAATTAGAAGAAAUCUUCUAAUUUUAAUUACCAAGGUAAUUAAAAUUAGAAGAAAU11.71.432


Target Position: 1103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1103UGGAAUAAAAUACUAUUUU72.96671090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811121TGGAATAAAATACTATTTTAAAATAGTATTTTATTCCA0.102300.012600.844800.750001.000001.00000


Target Position: 1996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1996GAACAUCUGCACCAGUUUU86.3727280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682014GAACATCTGCACCAGTTTTAAAACTGGTGCAGATGTTC0.056700.015600.672400.750001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673GAUGAUGAGGAGGAGGAUG71.65021184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
609691GATGATGAGGAGGAGGATGCATCCTCCTCCTCATCATC0.775200.485000.525900.500001.000001.00000


Target Position: 2273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2273UCAGUGGUGUAUCUUCAUU74.7838973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002291TCAGTGGTGTATCTTCATTAATGAAGATACACCACTGA0.060800.001800.715500.750001.000001.00000


Target Position: 2373, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2373GUUUUGAAUAUCUUUCAUU83.326424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6562391GTTTTGAATATCTTTCATTAATGAAAGATATTCAAAAC0.060000.022800.637900.750000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2371-2393TTGTTTTGAATATCTTTCATTGTAAUGAAAGAUAUUCAAAACAAGUUUUGAAUAUCUUUCAUUGUU12.07.721


Target Position: 680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
680AGGAGGAGGAUGAGGAUGA79.4106659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
557698AGGAGGAGGATGAGGATGATCATCCTCATCCTCCTCCT0.736800.667600.620700.500001.000001.00000


Target Position: 2370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2370CUUGUUUUGAAUAUCUUUC63.9221687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182388CTTGTTTTGAATATCTTTCGAAAGATATTCAAAACAAG0.065600.025600.465500.500001.000001.00000


Target Position: 1722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1722CAAAAAAUGAUGAGAGAAU86.5202272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7331740CAAAAAATGATGAGAGAATATTCTCTCATCATTTTTTG0.039500.016200.637900.750001.000001.00000


Target Position: 560, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
560ACUACCGAGAAAAUGUGUU67.92661425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830578ACTACCGAGAAAATGTGTTAACACATTTTCTCGGTAGT0.013400.004400.560300.750001.000001.00000


Target Position: 2396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2396UGUUUGUCGUAUUGUAAAA85.1423338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5862414TGTTTGTCGTATTGTAAAATTTTACAATACGACAAACA0.084400.050100.706900.750001.000001.00000


Target Position: 1042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042UGUGGGAACGAGAGGGGAA78.3321735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5811060TGTGGGAACGAGAGGGGAATTCCCCTCTCGTTCCCACA0.230500.032100.534500.750001.000001.00000


Target Position: 866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866AAAGGGGUCAGAAGCGAAA78.7902702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
700884AAAGGGGTCAGAAGCGAAATTTCGCTTCTGACCCCTTT0.380300.068100.500000.500001.000001.00000


Target Position: 2076, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2076CAAUAAAUCUUUUUAUACA100.17511

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2074-2096TTCAATAAATCTTTTTATACAATUGUAUAAAAAGAUUUAUUGAACAAUAAAUCUUUUUAUACAAUU1.4-10.312


Target Position: 1928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1928CGUGUCCCUCUUCUGGUUG62.73431771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7781946CGTGTCCCTCTTCTGGTTGCAACCAGAAGAGGGACACG0.026300.014500.629300.750000.945700.87500


Target Position: 1918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1918GGUUUGCUUUCGUGUCCCU80.6157573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7361936GGTTTGCTTTCGTGTCCCTAGGGACACGAAAGCAAACC0.039200.006100.508600.750001.000001.00000


Target Position: 910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
910GAUGAUGACUAAGUGGAAU87.8387223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
601928GATGATGACTAAGTGGAATATTCCACTTAGTCATCATC0.080100.082200.672400.750001.000001.00000


Target Position: 921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
921AGUGGAAUAACCUAUUUUG75.0079956

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
810939AGTGGAATAACCTATTTTGCAAAATAGGTTATTCCACT0.388500.003100.560300.500000.962000.87500


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344GCACCAGCCAUAUCUUUUG72.04741157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371362GCACCAGCCATATCTTTTGCAAAAGATATGGCTGGTGC0.225700.001000.706900.750001.000001.00000


Target Position: 1894, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1894CUGCAAAUUCCUAGUGAAU81.993487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071912CTGCAAATTCCTAGTGAATATTCACTAGGAATTTGCAG0.018400.005100.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1892-1914GACTGCAAATTCCTAGTGAATGTAUUCACUAGGAAUUUGCAGUCCUGCAAAUUCCUAGUGAAUGUU20.320.033


Target Position: 1250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1250CUCUUACGUUUCCUGGUAU81.9768488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741268CTCTTACGTTTCCTGGTATATACCAGGAAACGTAAGAG0.088300.025000.767200.750001.000001.00000


Target Position: 2066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066UGAUAAAUUUCAAUAAAUC74.5204993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242084TGATAAATTTCAATAAATCGATTTATTGAAATTTATCA0.067400.009200.543100.500001.000001.00000


Target Position: 1975, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1975CCAUGUUUCAUCUGUAUAA96.307634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781993CCATGTTTCATCTGTATAATTATACAGATGAAACATGG0.446100.135200.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1973-1995ACCCATGTTTCATCTGTATAAAAUUAUACAGAUGAAACAUGGGUCCAUGUUUCAUCUGUAUAAAAU13.112.122


Target Position: 856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856GGUGAAGAAGAAAGGGGUC69.06441347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
575874GGTGAAGAAGAAAGGGGTCGACCCCTTTCTTCTTCACC0.110900.080600.534500.750001.000001.00000


Target Position: 304, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
304GAAUUCUUAAGUACAAUCA89.3727172

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
302-324TGGAATTCTTAAGTACAATCAACUGAUUGUACUUAAGAAUUCCAGAAUUCUUAAGUACAAUCAACU16.15.312


Target Position: 2130, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2130CCAUUGAUCUUUUCAAGAU88.2691206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7492148CCATTGATCTTTTCAAGATATCTTGAAAAGATCAATGG0.058800.003500.663801.000000.983700.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2128-2150GGCCATTGATCTTTTCAAGATGCAUCUUGAAAAGAUCAAUGGCCCCAUUGAUCUUUUCAAGAUGCU20.413.613


Target Position: 2395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2395UUGUUUGUCGUAUUGUAAA76.3462857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5572413TTGTTTGTCGTATTGTAAATTTACAATACGACAAACAA0.094200.055300.646600.500001.000001.00000


Target Position: 1810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1810GGCUGGGUUUUUUUUUUCA86.4683275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271828GGCTGGGTTTTTTTTTTCATGAAAAAAAAAACCCAGCC0.721700.004300.775900.750001.000001.00000


Target Position: 1360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360UUGCUUUGGUUCACAUGAU71.72081179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101378TTGCTTTGGTTCACATGATATCATGTGAACCAAAGCAA0.231900.013900.465500.500000.983700.62500


Target Position: 1976, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976CAUGUUUCAUCUGUAUAAA94.195458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2811994CATGTTTCATCTGTATAAATTTATACAGATGAAACATG0.434400.126000.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1974-1996CCCATGTTTCATCTGTATAAAAGUUUAUACAGAUGAAACAUGGGCAUGUUUCAUCUGUAUAAAAGU8.514.832


Target Position: 865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
865GAAAGGGGUCAGAAGCGAA95.341645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
674883GAAAGGGGTCAGAAGCGAATTCGCTTCTGACCCCTTTC0.344200.065800.500000.750001.000001.00000


Target Position: 2405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2405UAUUGUAAAAAGAAUGUAU81.9099494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7872423TATTGTAAAAAGAATGTATATACATTCTTTTTACAATA0.023500.016200.500000.500001.000001.00000


Target Position: 913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
913GAUGACUAAGUGGAAUAAC71.67781182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788931GATGACTAAGTGGAATAACGTTATTCCACTTAGTCATC0.023300.019900.534500.500001.000001.00000


Target Position: 699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699GGAGGAGUAUGAUGAAGAU99.514112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
641717GGAGGAGTATGATGAAGATATCTTCATCATACTCCTCC0.064100.032500.689701.000001.000001.00000


Target Position: 985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
985CCCCCCCCCCUCCAAUCCU51.27632216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3521003CCCCCCCCCCTCCAATCCTAGGATTGGAGGGGGGGGGG0.779100.759900.646600.750001.000001.00000


Target Position: 635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
635CCCCUGACUCGGAUGCUGA81.1647540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
769653CCCCTGACTCGGATGCTGATCAGCATCCGAGTCAGGGG0.041000.002700.767200.750000.902200.62500


Target Position: 1156, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1156CUUUGUGUCCGGUUUUUGU74.677982

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1154-1176TTCTTTGTGTCCGGTTTTTGTCCACAAAAACCGGACACAAAGAACUUUGUGUCCGGUUUUUGUCCU5.619.322


Target Position: 1983, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1983CAUCUGUAUAAAAGAACAU86.2144285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072001CATCTGTATAAAAGAACATATGTTCTTTTATACAGATG0.129500.063700.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1981-2003TTCATCTGTATAAAAGAACATCTAUGUUCUUUUAUACAGAUGAACAUCUGUAUAAAAGAACAUCUU19.220.332


Target Position: 1483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483UCAUCCCUUUUCCCCCUUC49.74772258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181501TCATCCCTTTTCCCCCTTCGAAGGGGGAAAAGGGATGA0.340100.174100.551700.500001.000001.00000


Target Position: 1013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1013AACUUAUUUUUUUCUGAUU77.6632775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7341031AACTTATTTTTTTCTGATTAATCAGAAAAAAATAAGTT0.039400.015400.637900.500001.000001.00000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825GGUAGAUGACGAGGAAGAU89.5504164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
269843GGTAGATGACGAGGAAGATATCTTCCTCGTCATCTACC0.532300.076100.672401.000001.000001.00000


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671UGGAUGAUGAGGAGGAGGA72.29111143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
790689TGGATGATGAGGAGGAGGATCCTCCTCCTCATCATCCA0.689400.473700.474100.500001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832GACGAGGAAGAUGAAGAAG71.44191200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452850GACGAGGAAGATGAAGAAGCTTCTTCATCTTCCTCGTC0.478000.320300.681000.500001.000001.00000


Target Position: 2044, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2044GAGUUUUAUGUCUGUUUGU81.4061525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8122062GAGTTTTATGTCTGTTTGTACAAACAGACATAAAACTC0.050500.011100.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2042-2064TTGAGTTTTATGTCTGTTTGTCAACAAACAGACAUAAAACUCAAGAGUUUUAUGUCUGUUUGUCAU16.74.921


Target Position: 295, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295GAAGAACUGGAAUUCUUAA98.833618

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
293-315TTGAAGAACTGGAATTCTTAAGTUUAAGAAUUCCAGUUCUUCAAGAAGAACUGGAAUUCUUAAGUU6.917.703


Target Position: 1249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1249UCUCUUACGUUUCCUGGUA75.364934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801267TCTCTTACGTTTCCTGGTATACCAGGAAACGTAAGAGA0.086500.026000.543100.750001.000001.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044UGGGAACGAGAGGGGAAGA67.11471486

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5561062TGGGAACGAGAGGGGAAGATCTTCCCCTCTCGTTCCCA0.286300.044200.620700.500001.000001.00000


Target Position: 897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
897AGAUGAGGGAGAAGAUGAU86.6151267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
555915AGATGAGGGAGAAGATGATATCATCTTCTCCCTCATCT0.720900.157500.543100.750001.000001.00000


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893CUGAAGAUGAGGGAGAAGA76.7958827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525911CTGAAGATGAGGGAGAAGATCTTCTCCCTCATCTTCAG0.216400.088600.560300.500001.000001.00000


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056GGGAAGAGUGUACUGGGGG61.53731830

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6701074GGGAAGAGTGTACTGGGGGCCCCCAGTACACTCTTCCC0.088800.025200.500000.500001.000001.00000


Target Position: 283, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283ACAGAUGAAUUUGAAGAAC64.85671631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687301ACAGATGAATTTGAAGAACGTTCTTCAAATTCATCTGT0.052000.028100.560300.500001.000001.00000


Target Position: 869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
869GGGGUCAGAAGCGAAAACG60.71031882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
730887GGGGTCAGAAGCGAAAACGCGTTTTCGCTTCTGACCCC0.311900.084100.715500.500001.000001.00000


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691GAGGAUGAGGAGGAGUAUG73.15361077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771709GAGGATGAGGAGGAGTATGCATACTCCTCCTCATCCTC0.149600.125200.655200.500001.000001.00000


Target Position: 150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
150CUGCAGAGAGAGAGCGCGA81.0507551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
783168CTGCAGAGAGAGAGCGCGATCGCGCTCTCTCTCTGCAG0.024500.003200.491400.500000.967400.75000


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587UCCCGCAACUCACAUAUCU66.71611512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
703605TCCCGCAACTCACATATCTAGATATGTGAGTTGCGGGA0.048800.006600.646600.500001.000001.00000


Target Position: 1768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1768ACAUUUUUACGGACCUAAG68.78351366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521786ACATTTTTACGGACCTAAGCTTAGGTCCGTAAAAATGT0.039200.003300.569000.500001.000001.00000


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459UGGCAACAAAAUUAAAGAC63.90641690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
803477TGGCAACAAAATTAAAGACGTCTTTAATTTTGTTGCCA0.801100.120200.525900.500001.000001.00000


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588CCCGCAACUCACAUAUCUC75.4898920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
694606CCCGCAACTCACATATCTCGAGATATGTGAGTTGCGGG0.050300.007000.681000.750001.000001.00000


Target Position: 2438, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2438GAAUGUUUAUAAAACAAAU95.47743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3782456GAATGTTTATAAAACAAATATTTGTTTTATAAACATTC0.212500.037500.663800.750000.972800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2436-2458AGGAATGTTTATAAAACAAATTAAUUUGUUUUAUAAACAUUCCUGAAUGUUUAUAAAACAAAUUAU5.65.321


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017UAUUUUUUUCUGAUUGUAA84.4687375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6921035TATTTTTTTCTGATTGTAATTACAATCAGAAAAAAATA0.050400.007300.508600.500001.000001.00000


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728UGGAAGACGAGGAGGACGA70.10121281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
674746TGGAAGACGAGGAGGACGATCGTCCTCCTCGTCTTCCA0.439900.249900.551700.500001.000001.00000


Target Position: 220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
220UCUGAUGUGAAAGAACUUG57.3352016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
736238TCTGATGTGAAAGAACTTGCAAGTTCTTTCACATCAGA0.070400.004000.577600.500001.000001.00000


Target Position: 455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
455UAAGUGGCAACAAAAUUAA79.4795653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
692473TAAGTGGCAACAAAATTAATTAATTTTGTTGCCACTTA0.846200.015800.500000.500001.000001.00000


Target Position: 2316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2316AGAGUUACUAAAAAAACAA89.7513157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4532334AGAGTTACTAAAAAAACAATTGTTTTTTTAGTAACTCT0.317500.202300.577600.750001.000001.00000


Target Position: 1118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118UUUUUACUGCCACUCUUUA75.4757922

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141136TTTTTACTGCCACTCTTTATAAAGAGTGGCAGTAAAAA0.277200.169700.465500.500001.000001.00000


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828AGAUGACGAGGAAGAUGAA96.356732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
522846AGATGACGAGGAAGATGAATTCATCTTCCTCGTCATCT0.627500.096700.551700.750001.000001.00000


Target Position: 591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591GCAACUCACAUAUCUCGAC74.36211007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
669609GCAACTCACATATCTCGACGTCGAGATATGTGAGTTGC0.056600.018000.534500.750001.000001.00000


Target Position: 1874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1874CUAGUGGAAAUCUGAAAUG69.51681314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931892CTAGTGGAAATCTGAAATGCATTTCAGATTTCCACTAG0.127200.005600.517200.500001.000001.00000


Target Position: 2394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2394UUUGUUUGUCGUAUUGUAA77.8551761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8362412TTTGTTTGTCGTATTGTAATTACAATACGACAAACAAA0.118100.064100.465500.500001.000001.00000


Target Position: 1715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1715UGUUUUACAAAAAAUGAUG62.96741752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6941733TGTTTTACAAAAAATGATGCATCATTTTTTGTAAAACA0.117700.020500.551700.500001.000001.00000


Target Position: 1841, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841CGGAAAAACUAACGCAAAA90.8919122

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3184119CGGAAAAACTAACGCAAAA1/1/0/097.21ANP32ANM_006305.31NANANA15:69071482..69071500(-)00ANP32A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1121859CGGAAAAACTAACGCAAAATTTTGCGTTAGTTTTTCCG0.605900.313400.913801.000001.000001.00000


Target Position: 2388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2388CAUUGUUUUGUUUGUCGUA90.8411125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7862406CATTGTTTTGTTTGTCGTATACGACAAACAAAACAATG0.266700.047500.474100.750001.000001.00000


Target Position: 1468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468GACAUUCCCCAUCUCUCAU82.8081449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061486GACATTCCCCATCTCTCATATGAGAGATGGGGAATGTC0.427800.005500.663800.750000.989100.62500


Target Position: 1473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1473UCCCCAUCUCUCAUCCCUU69.43211319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6061491TCCCCATCTCTCATCCCTTAAGGGATGAGAGATGGGGA0.590700.010800.732800.750001.000001.00000


Target Position: 751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
751GAGGAGGAGGAAGGUGAAG65.58521571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
705769GAGGAGGAGGAAGGTGAAGCTTCACCTTCCTCCTCCTC0.791400.691800.672400.500001.000001.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982UCUCCCCCCCCCCUCCAAU51.04862225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891000TCTCCCCCCCCCCTCCAATATTGGAGGGGGGGGGGAGA0.845600.830000.715500.750001.000001.00000


Target Position: 1423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1423GUUUGUAAAUAGCAACCUA97.97421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091441GTTTGTAAATAGCAACCTATAGGTTGCTATTTACAAAC0.022400.007400.474100.750000.994600.62500


Target Position: 1998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1998ACAUCUGCACCAGUUUUUC61.95361804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8212016ACATCTGCACCAGTTTTTCGAAAAACTGGTGCAGATGT0.031900.011200.534500.500001.000001.00000


Target Position: 1909, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1909GAAUGUACAGGUUUGCUUU89.8576154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291927GAATGTACAGGTTTGCTTTAAAGCAAACCTGTACATTC0.125200.004300.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1907-1929GTGAATGTACAGGTTTGCTTTCGAAAGCAAACCUGUACAUUCACGAAUGUACAGGUUUGCUUUCGU18.614.622


Target Position: 2228, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2228AUAAUGUGAUACUAUGUUU83.9759388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512246ATAATGTGATACTATGTTTAAACATAGTATCACATTAT0.195600.103700.543100.500001.000001.00000


Target Position: 2206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2206UAGCUUUUCUUAUGAGAUA85.2375335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6992224TAGCTTTTCTTATGAGATATATCTCATAAGAAAAGCTA0.049600.008400.629300.500001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442ACGCAUCUAAAUUUAAGUG65.12861603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
786460ACGCATCTAAATTTAAGTGCACTTAAATTTAGATGCGT0.041400.029400.482800.500001.000001.00000


Target Position: 274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
274GAAGGCCUCACAGAUGAAU77.5724778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809292GAAGGCCTCACAGATGAATATTCATCTGTGAGGCCTTC0.078500.001400.663800.750001.000001.00000


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744CGAGGAUGAGGAGGAGGAA89.4614169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
406762CGAGGATGAGGAGGAGGAATTCCTCCTCCTCATCCTCG0.800700.536100.620701.000001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921UUGCUUUCGUGUCCCUCUU61.01771864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6891939TTGCTTTCGTGTCCCTCTTAAGAGGGACACGAAAGCAA0.120400.007600.508600.500001.000001.00000


Target Position: 1635, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635GAAACACACCUUCAAACUU86.4968274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5731653GAAACACACCTTCAAACTTAAGTTTGAAGGTGTGTTTC0.205200.108800.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1633-1655AAGAAACACACCTTCAAACTTCAAAGUUUGAAGGUGUGUUUCUUGAAACACACCUUCAAACUUCAU19.219.322


Target Position: 1153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1153UUUCUUUGUGUCCGGUUUU58.58741968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6911171TTTCTTTGTGTCCGGTTTTAAAACCGGACACAAAGAAA0.151100.097200.500000.500001.000001.00000


Target Position: 1351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1351CCAUAUCUUUUGCUUUGGU76.6108838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8061369CCATATCTTTTGCTTTGGTACCAAAGCAAAAGATATGG0.018400.005700.491400.750001.000001.00000


Target Position: 1234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234AGGAUGGUUUGGAGUUCUC66.45811529

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111252AGGATGGTTTGGAGTTCTCGAGAACTCCAAACCATCCT0.033900.003900.534500.500001.000001.00000


Target Position: 2390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2390UUGUUUUGUUUGUCGUAUU69.59741309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632408TTGTTTTGTTTGTCGTATTAATACGACAAACAAAACAA0.341300.042700.637900.500001.000001.00000


Target Position: 1058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1058GAAGAGUGUACUGGGGGUU73.44511058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6441076GAAGAGTGTACTGGGGGTTAACCCCCAGTACACTCTTC0.063300.027900.525900.750001.000001.00000


Target Position: 1098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098GGGGGUGGAAUAAAAUACU80.2519601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6781116GGGGGTGGAATAAAATACTAGTATTTTATTCCACCCCC0.337100.006900.784500.750001.000001.00000


Target Position: 2030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2030AAGAGCCAAACUUUGAGUU68.99461353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7912048AAGAGCCAAACTTTGAGTTAACTCAAAGTTTGGCTCTT0.066000.002500.491400.500001.000001.00000


Target Position: 357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
357GUUAAACAAACUUAAGAAG71.42861201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
762375GTTAAACAAACTTAAGAAGCTTCTTAAGTTTGTTTAAC0.031000.030000.508600.500001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141UUUCCCCUACUUUUUCUUU60.26091890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7621159TTTCCCCTACTTTTTCTTTAAAGAAAAAGTAGGGGAAA0.902200.442900.500000.500001.000001.00000


Target Position: 1235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1235GGAUGGUUUGGAGUUCUCU81.8604497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6901253GGATGGTTTGGAGTTCTCTAGAGAACTCCAAACCATCC0.052000.006200.646600.750001.000001.00000


Target Position: 689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689AUGAGGAUGAGGAGGAGUA81.5156516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
792707ATGAGGATGAGGAGGAGTATACTCCTCCTCATCCTCAT0.173400.149400.474100.500001.000001.00000


Target Position: 1145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1145CCCUACUUUUUCUUUGUGU72.13541151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281163CCCTACTTTTTCTTTGTGTACACAAAGAAAAAGTAGGG0.376800.307400.784500.750001.000001.00000


Target Position: 1474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474CCCCAUCUCUCAUCCCUUU77.1868794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301492CCCCATCTCTCATCCCTTTAAAGGGATGAGAGATGGGG0.606000.027700.991401.000001.000001.00000


Target Position: 1602, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602CAAGGAAAAUGGAUUUGGU82.5073463

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1600-1622TACAAGGAAAATGGATTTGGTAAACCAAAUCCAUUUUCCUUGUACAAGGAAAAUGGAUUUGGUAAU20.118.722


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740AGGACGAGGAUGAGGAGGA76.2809862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791758AGGACGAGGATGAGGAGGATCCTCCTCATCCTCGTCCT0.745600.425100.474100.500001.000001.00000


Target Position: 2376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2376UUGAAUAUCUUUCAUUGUU69.82421293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8362394TTGAATATCTTTCATTGTTAACAATGAAAGATATTCAA0.048700.026300.500000.500000.983700.62500


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698AGGAGGAGUAUGAUGAAGA86.2289283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
787716AGGAGGAGTATGATGAAGATCTTCATCATACTCCTCCT0.124600.049300.620700.500001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948CUAUUGUGAUUUGACUGUU80.5231580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
616966CTATTGTGATTTGACTGTTAACAGTCAAATCACAATAG0.324200.064200.525900.750001.000001.00000


Target Position: 868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
868AGGGGUCAGAAGCGAAAAC61.50251833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
809886AGGGGTCAGAAGCGAAAACGTTTTCGCTTCTGACCCCT0.336800.074100.698300.500001.000001.00000


Target Position: 492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
492GCCACUGAAAAAGUUAGAA83.8537396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
432510GCCACTGAAAAAGTTAGAATTCTAACTTTTTCAGTGGC0.317500.027000.827601.000001.000001.00000


Target Position: 1838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1838GCACGGAAAAACUAACGCA89.6347161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7091856GCACGGAAAAACTAACGCATGCGTTAGTTTTTCCGTGC0.408400.034800.500000.750001.000001.00000


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460GGCAACAAAAUUAAAGACC60.18991893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
721478GGCAACAAAATTAAAGACCGGTCTTTAATTTTGTTGCC0.760300.743500.646600.500001.000001.00000


Target Position: 2357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2357CCAACCUUGGAACCUUGUU68.3451403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5592375CCAACCTTGGAACCTTGTTAACAAGGTTCCAAGGTTGG0.291600.014800.698301.000000.978300.62500


Target Position: 2372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372UGUUUUGAAUAUCUUUCAU78.4496727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5292390TGTTTTGAATATCTTTCATATGAAAGATATTCAAAACA0.104500.023100.551700.750000.983700.62500


Target Position: 1982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1982UCAUCUGUAUAAAAGAACA85.6555320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562000TCATCTGTATAAAAGAACATGTTCTTTTATACAGATGA0.149300.068000.517200.500001.000001.00000


Target Position: 1646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646UCAAACUUCAACUUCUUUA76.0796875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891664TCAAACTTCAACTTCTTTATAAAGAAGTTGAAGTTTGA0.184000.156600.689700.750001.000001.00000


Target Position: 2072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2072AUUUCAAUAAAUCUUUUUA83.0204437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852090ATTTCAATAAATCTTTTTATAAAAAGATTTATTGAAAT0.470200.045100.474100.500001.000001.00000


Target Position: 807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
807AGGUUAUAACGAUGGAGAG74.36991006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571825AGGTTATAACGATGGAGAGCTCTCCATCGTTATAACCT0.716000.062800.534500.500001.000001.00000


Target Position: 1641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1641CACCUUCAAACUUCAACUU77.4362784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241659CACCTTCAAACTTCAACTTAAGTTGAAGTTTGAAGGTG0.245600.028100.655200.750001.000001.00000


Target Position: 816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
816CGAUGGAGAGGUAGAUGAC81.7937501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
794834CGATGGAGAGGTAGATGACGTCATCTACCTCTCCATCG0.086500.049800.474100.750001.000001.00000


Target Position: 843, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
843UGAAGAAGAGCUUGGUGAA86.7058265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
759861TGAAGAAGAGCTTGGTGAATTCACCAAGCTCTTCTTCA0.031400.018500.551700.750001.000001.00000


Target Position: 488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
488UAGAGCCACUGAAAAAGUU73.43321059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
625506TAGAGCCACTGAAAAAGTTAACTTTTTCAGTGGCTCTA0.283200.009700.525900.500001.000001.00000


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634AGAAACACACCUUCAAACU73.83771040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281652AGAAACACACCTTCAAACTAGTTTGAAGGTGTGTTTCT0.193000.080100.517200.500000.972800.62500


Target Position: 745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
745GAGGAUGAGGAGGAGGAAG69.58531310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833763GAGGATGAGGAGGAGGAAGCTTCCTCCTCCTCATCCTC0.860200.579000.672400.500001.000001.00000


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337UCAAUCGCAAACUUACCAA74.3611008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
640355TCAATCGCAAACTTACCAATTGGTAAGTTTGCGATTGA0.064400.053400.577600.750000.994600.75000


Target Position: 1684, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1684CUAUCUUGUUCUGUAAAAU85.9329304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6931702CTATCTTGTTCTGTAAAATATTTTACAGAACAAGATAG0.050300.039900.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1682-1704TCCTATCTTGTTCTGTAAAATATAUUUUACAGAACAAGAUAGGACUAUCUUGUUCUGUAAAAUAUU7.213.422


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902AGGGAGAAGAUGAUGACUA88.9007189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333920AGGGAGAAGATGATGACTATAGTCATCATCTTCTCCCT0.329500.249200.672400.750001.000001.00000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679GAGGAGGAGGAUGAGGAUG66.97361493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
600697GAGGAGGAGGATGAGGATGCATCCTCATCCTCCTCCTC0.736400.578400.655200.500001.000001.00000


Target Position: 1877, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877GUGGAAAUCUGAAAUGACU84.888350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721895GTGGAAATCTGAAATGACTAGTCATTTCAGATTTCCAC0.104000.007000.586200.500000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1875-1897TAGTGGAAATCTGAAATGACTGCAGUCAUUUCAGAUUUCCACUAGUGGAAAUCUGAAAUGACUGCU14.820.122


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755AGGAGGAAGGUGAAGAGGA79.8102633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801773AGGAGGAAGGTGAAGAGGATCCTCTTCACCTTCCTCCT0.939500.733800.474100.500001.000001.00000


Target Position: 2458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2458AUUUCACAAAAAAAAAAAA80.1364610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7252476ATTTCACAAAAAAAAAAAATTTTTTTTTTTTGTGAAAT0.988300.226800.508600.500001.000001.00000


Target Position: 1211, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1211GCAUUUGUUCCUGACUCUC68.39081398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5621229GCATTTGTTCCTGACTCTCGAGAGTCAGGAACAAATGC0.169600.019300.543100.750001.000001.00000


Target Position: 2312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2312UUACAGAGUUACUAAAAAA90.2637134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6862330TTACAGAGTTACTAAAAAATTTTTTAGTAACTCTGTAA0.431400.154500.534500.500001.000001.00000


Target Position: 1095, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095GGUGGGGGUGGAAUAAAAU84.8064358

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7741113GGTGGGGGTGGAATAAAATATTTTATTCCACCCCCACC0.119800.002500.844801.000001.000001.00000


Target Position: 1434, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1434GCAACCUAAAGGCGUAUUU72.51951124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7931452GCAACCTAAAGGCGTATTTAAATACGCCTTTAGGTTGC0.022000.002200.853401.000000.929300.87500


Target Position: 521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
521GCUUAGACCUUUUCAAUUG76.3412858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
363539GCTTAGACCTTTTCAATTGCAATTGAAAAGGTCTAAGC0.212400.040300.706900.750001.000001.00000


Target Position: 735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
735CGAGGAGGACGAGGAUGAG75.0415952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
770753CGAGGAGGACGAGGATGAGCTCATCCTCGTCCTCCTCG0.618800.375000.482800.750001.000001.00000


Target Position: 1192, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1192CUAAGUACACACUAAGUGA93.202877

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1190-1212AGCTAAGTACACACTAAGTGAGCUCACUUAGUGUGUACUUAGCUCUAAGUACACACUAAGUGAGCU16.414.332


Target Position: 1733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733GAGAGAAUUCUUCCACAUG80.4472588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7641751GAGAGAATTCTTCCACATGCATGTGGAAGAATTCTCTC0.165200.036300.655200.500001.000001.00000


Target Position: 555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
555GAACGACUACCGAGAAAAU92.738487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438573GAACGACTACCGAGAAAATATTTTCTCGGTAGTCGTTC0.412700.025800.663800.750001.000001.00000


Target Position: 335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
335CCUCAAUCGCAAACUUACC64.80271633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
755353CCTCAATCGCAAACTTACCGGTAAGTTTGCGATTGAGG0.167400.097500.491400.500001.000001.00000


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990CCCCCUCCAAUCCUGCCCC43.71932375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7141008CCCCCTCCAATCCTGCCCCGGGGCAGGATTGGAGGGGG0.669300.630000.500000.500001.000001.00000


Target Position: 1154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1154UUCUUUGUGUCCGGUUUUU57.89261994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031172TTCTTTGTGTCCGGTTTTTAAAAACCGGACACAAAGAA0.149300.095600.672400.500001.000001.00000


Target Position: 1686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1686AUCUUGUUCUGUAAAAUAU81.1505542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181704ATCTTGTTCTGTAAAATATATATTTTACAGAACAAGAT0.704200.026100.637900.500001.000001.00000


Target Position: 2131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2131CAUUGAUCUUUUCAAGAUG80.0794617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7732149CATTGATCTTTTCAAGATGCATCTTGAAAAGATCAATG0.036800.002500.500000.500000.962000.62500


Target Position: 433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
433CCGAACCUCACGCAUCUAA81.4237524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193451CCGAACCTCACGCATCTAATTAGATGCGTGAGGTTCGG0.500300.119900.879301.000001.000001.00000


Target Position: 1850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850UAACGCAAAAUUGUAUUUU63.28941726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6661868TAACGCAAAATTGTATTTTAAAATACAATTTTGCGTTA0.057400.048600.534500.500001.000001.00000


Target Position: 2369, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2369CCUUGUUUUGAAUAUCUUU84.6348362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982387CCTTGTTTTGAATATCTTTAAAGATATTCAAAACAAGG0.249500.075700.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2367-2389AACCTTGTTTTGAATATCTTTCAAAAGAUAUUCAAAACAAGGUUCCUUGUUUUGAAUAUCUUUCAU6.610.322


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000UCCUGCCCCCUGAAACUUA72.03511158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1301018TCCTGCCCCCTGAAACTTATAAGTTTCAGGGGGCAGGA0.579500.516000.836200.750001.000001.00000


Target Position: 1006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006CCCCUGAAACUUAUUUUUU75.8262893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041024CCCCTGAAACTTATTTTTTAAAAAATAAGTTTCAGGGG0.118400.111400.991401.000001.000001.00000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951UUGUGAUUUGACUGUUUUU72.67881111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506969TTGTGATTTGACTGTTTTTAAAAACAGTCAAATCACAA0.408700.113900.646600.500001.000001.00000


Target Position: 483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
483CACAAUAGAGCCACUGAAA93.593770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
724501CACAATAGAGCCACTGAAATTTCAGTGGCTCTATTGTG0.041800.010400.793100.750000.962000.62500


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683AGGAGGAUGAGGAUGAGGA81.2337535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807701AGGAGGATGAGGATGAGGATCCTCATCCTCATCCTCCT0.760300.665200.474100.500001.000001.00000


Target Position: 338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338CAAUCGCAAACUUACCAAA91.7453102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
677356CAATCGCAAACTTACCAAATTTGGTAAGTTTGCGATTG0.054100.035000.646600.750000.994600.75000


Target Position: 2078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2078AUAAAUCUUUUUAUACAAU80.25602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852096ATAAATCTTTTTATACAATATTGTATAAAAAGATTTAT0.484000.159000.534500.500001.000001.00000


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732AGACGAGGAGGACGAGGAU80.092613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
546750AGACGAGGAGGACGAGGATATCCTCGTCCTCCTCGTCT0.455500.241500.543100.750001.000001.00000


Target Position: 2318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2318AGUUACUAAAAAAACAAGU69.72611301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122336AGTTACTAAAAAAACAAGTACTTGTTTTTTTAGTAACT0.268700.187800.500000.500001.000001.00000


Target Position: 1619, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1619GUAAUUAAAAUUAGAAGAA89.056183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6501637GTAATTAAAATTAGAAGAATTCTTCTAATTTTAATTAC0.082300.019500.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1617-1639TGGTAATTAAAATTAGAAGAAACUUCUUCUAAUUUUAAUUACCAGUAAUUAAAAUUAGAAGAAACU20.2-7.522


Target Position: 1003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1003UGCCCCCUGAAACUUAUUU59.86331908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131021TGCCCCCTGAAACTTATTTAAATAAGTTTCAGGGGGCA0.348400.292000.853400.750001.000001.00000


Target Position: 559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
559GACUACCGAGAAAAUGUGU76.8831821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
800577GACTACCGAGAAAATGTGTACACATTTTCTCGGTAGTC0.019400.009900.612100.500001.000001.00000


Target Position: 1885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1885CUGAAAUGACUGCAAAUUC71.24391216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7081903CTGAAATGACTGCAAATTCGAATTTGCAGTCATTTCAG0.049800.015500.612100.500001.000001.00000


Target Position: 1879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1879GGAAAUCUGAAAUGACUGC67.35341470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6701897GGAAATCTGAAATGACTGCGCAGTCATTTCAGATTTCC0.056200.022000.517200.500000.967400.62500


Target Position: 1100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100GGGUGGAAUAAAAUACUAU94.268454

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7221118GGGTGGAATAAAATACTATATAGTATTTTATTCCACCC0.333800.004900.948301.000001.000001.00000


Target Position: 316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
316ACAAUCAACGUAGGCCUCA68.91271357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773334ACAATCAACGTAGGCCTCATGAGGCCTACGTTGATTGT0.095100.041800.482800.500001.000001.00000


Target Position: 2329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2329AAACAAGUACCCAAACAAU84.8471354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7592347AAACAAGTACCCAAACAATATTGTTTGGGTACTTGTTT0.074900.022400.491400.500001.000001.00000


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207GUGAGCAUUUGUUCCUGAC71.08481224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7891225GTGAGCATTTGTTCCTGACGTCAGGAACAAATGCTCAC0.158000.003200.474100.500001.000001.00000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045GGGAACGAGAGGGGAAGAG60.09241899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3181063GGGAACGAGAGGGGAAGAGCTCTTCCCCTCTCGTTCCC0.323500.057200.681000.750001.000001.00000


Target Position: 2401, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2401GUCGUAUUGUAAAAAGAAU85.2333336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082419GTCGTATTGTAAAAAGAATATTCTTTTTACAATACGAC0.294400.019100.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2399-2421TTGTCGTATTGTAAAAAGAATGTAUUCUUUUUACAAUACGACAAGUCGUAUUGUAAAAAGAAUGUU5.516.523


Target Position: 470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470UUAAAGACCUCAGCACAAU68.91651356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
610488TTAAAGACCTCAGCACAATATTGTGCTGAGGTCTTTAA0.721300.653900.525900.500001.000001.00000


Target Position: 1146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1146CCUACUUUUUCUUUGUGUC70.34381264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6211164CCTACTTTTTCTTTGTGTCGACACAAAGAAAAAGTAGG0.369900.301200.525900.750001.000001.00000


Target Position: 534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
534CAAUUGCGAGGUAACCAAC73.08281082

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801552CAATTGCGAGGTAACCAACGTTGGTTACCTCGCAATTG0.059100.001800.500000.500001.000001.00000


Target Position: 1834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1834CCGAGCACGGAAAAACUAA84.0996385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6041852CCGAGCACGGAAAAACTAATTAGTTTTTCCGTGCTCGG0.529000.010900.879301.000000.902200.62500


Target Position: 1124, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1124CUGCCACUCUUUAUUUUUU80.9012556

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2112419CTGCCACTCTTTATTTTTT1/1/0/097.21ANP32ANM_006305.31NANANA15:69072199..69072217(-)|12:48867395..48867413(+)00ANP32A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2871142CTGCCACTCTTTATTTTTTAAAAAATAAAGAGTGGCAG0.968600.264700.784500.750001.000001.00000


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960GUGUAAUUUCUGAACCCAU87.5291236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5781978GTGTAATTTCTGAACCCATATGGGTTCAGAAATTACAC0.086600.048700.637900.750001.000001.00000


Target Position: 938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
938UGAAAAAUUCCUAUUGUGA80.4317590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
682956TGAAAAATTCCTATTGTGATCACAATAGGAATTTTTCA0.103000.032900.500000.500001.000001.00000


Target Position: 74, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
74UUGAGCCUUCAAAGUCCUA70.35591262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
80092TTGAGCCTTCAAAGTCCTATAGGACTTTGAAGGCTCAA0.349200.006200.474100.500001.000001.00000


Target Position: 2400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400UGUCGUAUUGUAAAAAGAA87.6223232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5762418TGTCGTATTGTAAAAAGAATTCTTTTTACAATACGACA0.248400.022100.534500.750001.000001.00000


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763GGUGAAGAGGAGGACGUGA85.57324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
383781GGTGAAGAGGAGGACGTGATCACGTCCTCCTCTTCACC0.375800.355500.629300.750001.000001.00000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414AAGAAUGUAUGGUUGAAAA91.6781103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752432AAGAATGTATGGTTGAAAATTTTCAACCATACATTCTT0.123900.005000.637900.500001.000001.00000


Target Position: 1734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1734AGAGAAUUCUUCCACAUGU81.0713548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6271752AGAGAATTCTTCCACATGTACATGTGGAAGAATTCTCT0.218200.049300.517200.500001.000001.00000


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734ACGAGGAGGACGAGGAUGA75.0319954

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
524752ACGAGGAGGACGAGGATGATCATCCTCGTCCTCCTCGT0.616200.371200.551700.500001.000001.00000


Target Position: 846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846AGAAGAGCUUGGUGAAGAA96.589827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
546864AGAAGAGCTTGGTGAAGAATTCTTCACCAAGCTCTTCT0.210900.015800.551700.750001.000001.00000


Target Position: 1105, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105GAAUAAAAUACUAUUUUUA100.52610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701123GAATAAAATACTATTTTTATAAAAATAGTATTTTATTC0.136900.022400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1103-1125TGGAATAAAATACTATTTTTACTUAAAAAUAGUAUUUUAUUCCAGAAUAAAAUACUAUUUUUACUU-9.7-9.702


Target Position: 1372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372ACAUGAUGAUACCUGCUUU87.6964226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111390ACATGATGATACCTGCTTTAAAGCAGGTATCATCATGT0.115700.022700.706900.750001.000001.00000


Target Position: 152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
152GCAGAGAGAGAGCGCGAGA85.5607325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
782170GCAGAGAGAGAGCGCGAGATCTCGCGCTCTCTCTCTGC0.025600.009600.629300.750001.000001.00000


Target Position: 2178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178GAAGCUUCAUUUUUGUUAC77.401787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7452196GAAGCTTCATTTTTGTTACGTAACAAAAATGAAGCTTC0.118800.004000.491400.500001.000001.00000


Target Position: 2246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2246UGGAUAUUUUUGGUCUUAA83.0852434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7962264TGGATATTTTTGGTCTTAATTAAGACCAAAAATATCCA0.021500.005500.810300.750001.000001.00000


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783UGGAGAGGAGGAGGAGGAU68.4991392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
256801TGGAGAGGAGGAGGAGGATATCCTCCTCCTCCTCTCCA0.864600.796500.663800.750001.000001.00000


Target Position: 276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
276AGGCCUCACAGAUGAAUUU77.718770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836294AGGCCTCACAGATGAATTTAAATTCATCTGTGAGGCCT0.082500.001000.844800.750001.000001.00000


Target Position: 1979, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1979GUUUCAUCUGUAUAAAAGA90.6308130

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1977-1999ATGTTTCATCTGTATAAAAGAACUCUUUUAUACAGAUGAAACAUGUUUCAUCUGUAUAAAAGAACU-4.316.321


Target Position: 168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
168AGAGAUGGAGAUGGGCAGA75.4065929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
708186AGAGATGGAGATGGGCAGATCTGCCCATCTCCATCTCT0.071000.025200.500000.500001.000001.00000


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878AGCGAAAACGAGAACCUGA83.4186415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
835896AGCGAAAACGAGAACCTGATCAGGTTCTCGTTTTCGCT0.012000.009400.629300.500001.000001.00000


Target Position: 277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
277GGCCUCACAGAUGAAUUUG67.40271463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
816295GGCCTCACAGATGAATTTGCAAATTCATCTGTGAGGCC0.077900.001300.853400.750001.000001.00000


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758AGGAAGGUGAAGAGGAGGA73.88411038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
805776AGGAAGGTGAAGAGGAGGATCCTCCTCTTCACCTTCCT0.569100.525200.474100.500001.000001.00000


Target Position: 597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
597CACAUAUCUCGACGGCUAU83.175430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520615CACATATCTCGACGGCTATATAGCCGTCGAGATATGTG0.142400.018200.750000.750001.000001.00000


Target Position: 2075, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2075UCAAUAAAUCUUUUUAUAC67.37441467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6072093TCAATAAATCTTTTTATACGTATAAAAAGATTTATTGA0.459000.048200.543100.500001.000001.00000


Target Position: 366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
366ACUUAAGAAGCUUGAACUA86.5864268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767384ACTTAAGAAGCTTGAACTATAGTTCAAGCTTCTTAAGT0.030100.004200.534500.750001.000001.00000


Target Position: 1997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1997AACAUCUGCACCAGUUUUU67.74451438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322015AACATCTGCACCAGTTTTTAAAAACTGGTGCAGATGTT0.039600.010300.646600.500001.000001.00000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409CUGGAAGUAUUGGCAGAAA86.2031286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467427CTGGAAGTATTGGCAGAAATTTCTGCCAATACTTCCAG0.137600.024900.784500.750001.000001.00000


Target Position: 113, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
113GGGGUUUAUUGAUUGAAUU86.8815260

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_911319GGGGTTTATTGATTGAATT1/1/0/093.71ANP32ANM_006305.31NANANA16:12335196..12335214(+)|15:69113131..69113149(-)00ANP32A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761131GGGGTTTATTGATTGAATTAATTCAATCAATAAACCCC0.032100.003100.982801.000001.000001.00000


Target Position: 2304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2304UAAAAAAGUUACAGAGUUA91.012118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202322TAAAAAAGTTACAGAGTTATAACTCTGTAACTTTTTTA0.168100.069500.500000.500001.000001.00000


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554UGAACGACUACCGAGAAAA79.2294675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404572TGAACGACTACCGAGAAAATTTTCTCGGTAGTCGTTCA0.419800.031700.724100.750001.000001.00000


Target Position: 218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
218CCUCUGAUGUGAAAGAACU82.8982444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760236CCTCTGATGTGAAAGAACTAGTTCTTTCACATCAGAGG0.044700.003200.637900.750000.989100.62500


Target Position: 353, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
353CAAAGUUAAACAAACUUAA92.39591

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
351-373ACCAAAGTTAAACAAACTTAAGAUUAAGUUUGUUUAACUUUGGUCAAAGUUAAACAAACUUAAGAU4.94.902


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493CCACUGAAAAAGUUAGAAA92.890684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
429511CCACTGAAAAAGTTAGAAATTTCTAACTTTTTCAGTGG0.316600.027800.844801.000001.000001.00000


Target Position: 1233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233GAGGAUGGUUUGGAGUUCU79.848631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7831251GAGGATGGTTTGGAGTTCTAGAACTCCAAACCATCCTC0.027700.002200.586200.500001.000001.00000


Target Position: 558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
558CGACUACCGAGAAAAUGUG75.286938

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
775576CGACTACCGAGAAAATGTGCACATTTTCTCGGTAGTCG0.027600.016100.500000.750001.000001.00000


Target Position: 2079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079UAAAUCUUUUUAUACAAUU73.14431078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022097TAAATCTTTTTATACAATTAATTGTATAAAAAGATTTA0.441500.191900.525900.500001.000001.00000


Target Position: 693, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
693GGAUGAGGAGGAGUAUGAU93.728267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474711GGATGAGGAGGAGTATGATATCATACTCCTCCTCATCC0.132500.103300.689701.000001.000001.00000


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867AAGGGGUCAGAAGCGAAAA75.3501936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
750885AAGGGGTCAGAAGCGAAAATTTTCGCTTCTGACCCCTT0.382100.071400.637900.500001.000001.00000


Target Position: 1927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1927UCGUGUCCCUCUUCUGGUU70.09411282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521945TCGTGTCCCTCTTCTGGTTAACCAGAAGAGGGACACGA0.032600.005600.646600.750000.945700.75000


Target Position: 481, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
481AGCACAAUAGAGCCACUGA85.623321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
817499AGCACAATAGAGCCACTGATCAGTGGCTCTATTGTGCT0.016600.008500.629300.500000.902200.62500


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245ACAACAGUCGGUCGAAUGA78.2823738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
792263ACAACAGTCGGTCGAATGATCATTCGACCGACTGTTGT0.025800.002000.482800.500000.962000.62500


Target Position: 952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952UGUGAUUUGACUGUUUUUA75.0048957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
234970TGTGATTTGACTGTTTTTATAAAAACAGTCAAATCACA0.455300.142500.672400.750001.000001.00000


Target Position: 2359, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2359AACCUUGGAACCUUGUUUU70.34331265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6692377AACCTTGGAACCTTGTTTTAAAACAAGGTTCCAAGGTT0.206400.011800.646600.500001.000001.00000


Target Position: 1201, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1201CACUAAGUGAGCAUUUGUU86.0441298

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1199-1221CACACTAAGTGAGCATTTGTTCCAACAAAUGCUCACUUAGUGUGCACUAAGUGAGCAUUUGUUCCU12.117.633


Target Position: 75, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
75UGAGCCUUCAAAGUCCUAA74.7683974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
66193TGAGCCTTCAAAGTCCTAATTAGGACTTTGAAGGCTCA0.338000.007700.689700.750001.000001.00000


Target Position: 2080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080AAAUCUUUUUAUACAAUUU83.8566394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7882098AAATCTTTTTATACAATTTAAATTGTATAAAAAGATTT0.467100.249000.500000.500001.000001.00000


Target Position: 2035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2035CCAAACUUUGAGUUUUAUG68.71191374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6372053CCAAACTTTGAGTTTTATGCATAAAACTCAAAGTTTGG0.187500.008800.689700.750000.956500.75000


Target Position: 1243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243UGGAGUUCUCUUACGUUUC60.7551879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7801261TGGAGTTCTCTTACGTTTCGAAACGTAAGAGAACTCCA0.103900.002300.672400.500001.000001.00000


Target Position: 2056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2056UGUUUGUCAUUGAUAAAUU80.5923575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992074TGTTTGTCATTGATAAATTAATTTATCAATGACAAACA0.020000.003200.698300.750001.000001.00000


Target Position: 1446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1446CGUAUUUUGGCACUGGUCU72.49121126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7531464CGTATTTTGGCACTGGTCTAGACCAGTGCCAAAATACG0.032400.024000.551700.750001.000001.00000


Target Position: 770, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770AGGAGGACGUGAGUGGAGA78.1551748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
565788AGGAGGACGTGAGTGGAGATCTCCACTCACGTCCTCCT0.660000.354600.620700.500001.000001.00000


Target Position: 301, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
301CUGGAAUUCUUAAGUACAA91.772101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
401319CTGGAATTCTTAAGTACAATTGTACTTAAGAATTCCAG0.230700.040200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
299-321AACTGGAATTCTTAAGTACAATCUUGUACUUAAGAAUUCCAGUUCUGGAAUUCUUAAGUACAAUCU19.020.112


Target Position: 1872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872ACCUAGUGGAAAUCUGAAA82.0471485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5801890ACCTAGTGGAAATCTGAAATTTCAGATTTCCACTAGGT0.131300.012700.853400.750001.000001.00000


Target Position: 980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
980CCUCUCCCCCCCCCCUCCA57.06172029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
729998CCTCTCCCCCCCCCCTCCATGGAGGGGGGGGGGAGAGG0.856200.829500.500000.750001.000001.00000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242UUGGAGUUCUCUUACGUUU68.69921375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191260TTGGAGTTCTCTTACGTTTAAACGTAAGAGAACTCCAA0.104400.001300.646600.500001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412GAAGUAUUGGCAGAAAAGU76.76828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815430GAAGTATTGGCAGAAAAGTACTTTTCTGCCAATACTTC0.071200.016100.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
410-432TGGAAGTATTGGCAGAAAAGTGTACUUUUCUGCCAAUACUUCCAGAAGUAUUGGCAGAAAAGUGUU10.34.601


Target Position: 2233, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2233GUGAUACUAUGUUUGGAUA95.786341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7222251GTGATACTATGTTTGGATATATCCAAACATAGTATCAC0.042600.011600.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2231-2253ATGTGATACTATGTTTGGATATTUAUCCAAACAUAGUAUCACAUGUGAUACUAUGUUUGGAUAUUU20.120.322


Target Position: 1814, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1814GGGUUUUUUUUUUCAUACA89.3142174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2921832GGGTTTTTTTTTTCATACATGTATGAAAAAAAAAACCC0.254300.078400.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1812-1834CTGGGTTTTTTTTTTCATACACCUGUAUGAAAAAAAAAACCCAGGGGUUUUUUUUUUCAUACACCU16.112.622


Target Position: 2311, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2311GUUACAGAGUUACUAAAAA95.542642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4112329GTTACAGAGTTACTAAAAATTTTTAGTAACTCTGTAAC0.556600.147500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2309-2331AAGTTACAGAGTTACTAAAAAAAUUUUUAGUAACUCUGUAACUUGUUACAGAGUUACUAAAAAAAU4.920.322


Target Position: 1611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1611UGGAUUUGGUAAUUAAAAU78.3654733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4251629TGGATTTGGTAATTAAAATATTTTAATTACCAAATCCA0.237700.122000.836200.750001.000001.00000


Target Position: 2177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177GGAAGCUUCAUUUUUGUUA87.0236252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8312195GGAAGCTTCATTTTTGTTATAACAAAAATGAAGCTTCC0.095200.001100.836201.000001.000001.00000


Target Position: 1616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616UUGGUAAUUAAAAUUAGAA79.2589671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871634TTGGTAATTAAAATTAGAATTCTAATTTTAATTACCAA0.109900.016700.474100.500001.000001.00000


Target Position: 934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
934AUUUUGAAAAAUUCCUAUU69.95161288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
759952ATTTTGAAAAATTCCTATTAATAGGAATTTTTCAAAAT0.209700.098100.500000.500001.000001.00000


Target Position: 553, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
553CUGAACGACUACCGAGAAA84.007387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360571CTGAACGACTACCGAGAAATTTCTCGGTAGTCGTTCAG0.434700.041500.784500.750001.000001.00000


Target Position: 1357, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1357CUUUUGCUUUGGUUCACAU82.7745453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7801375CTTTTGCTTTGGTTCACATATGTGAACCAAAGCAAAAG0.034300.011400.482800.750000.983700.62500


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597AGUUACAAGGAAAAUGGAU77.4485783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6111615AGTTACAAGGAAAATGGATATCCATTTTCCTTGTAACT0.223800.013600.525900.750001.000001.00000


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582GCUCCUCCCGCAACUCACA82.7845452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
619600GCTCCTCCCGCAACTCACATGTGAGTTGCGGGAGGAGC0.073100.012800.646600.750000.923900.62500


Target Position: 1453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1453UGGCACUGGUCUGGGGACA64.08381677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341471TGGCACTGGTCTGGGGACATGTCCCCAGACCAGTGCCA0.012500.002200.637900.500000.956500.62500


Target Position: 1073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1073GGUUGCGGGGGGAGGGAUG58.10171983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351091GGTTGCGGGGGGAGGGATGCATCCCTCCCCCCGCAACC0.358600.016700.698300.750001.000001.00000


Target Position: 696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
696UGAGGAGGAGUAUGAUGAA90.8355126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
540714TGAGGAGGAGTATGATGAATTCATCATACTCCTCCTCA0.141800.088000.551700.750001.000001.00000


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672GGAUGAUGAGGAGGAGGAU87.8793219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190690GGATGATGAGGAGGAGGATATCCTCCTCCTCATCATCC0.772400.476000.689701.000001.000001.00000


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373CAUGAUGAUACCUGCUUUU83.1039433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631391CATGATGATACCTGCTTTTAAAAGCAGGTATCATCATG0.058200.023400.655200.750001.000001.00000


Target Position: 2275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2275AGUGGUGUAUCUUCAUUAA95.912139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892293AGTGGTGTATCTTCATTAATTAATGAAGATACACCACT0.125300.002100.672400.750001.000001.00000


Target Position: 1606, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1606GAAAAUGGAUUUGGUAAUU79.7445639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3751624GAAAATGGATTTGGTAATTAATTACCAAATCCATTTTC0.191500.093400.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1604-1626AGGAAAATGGATTTGGTAATTAAAAUUACCAAAUCCAUUUUCCUGAAAAUGGAUUUGGUAAUUAAU20.011.323


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868UCUUACCUAGUGGAAAUCU63.03051745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191886TCTTACCTAGTGGAAATCTAGATTTCCACTAGGTAAGA0.108700.031900.500000.500001.000001.00000


Target Position: 2404, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2404GUAUUGUAAAAAGAAUGUA87.6413230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802422GTATTGTAAAAAGAATGTATACATTCTTTTTACAATAC0.026100.017800.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2402-2424TCGTATTGTAAAAAGAATGTATGUACAUUCUUUUUACAAUACGAGUAUUGUAAAAAGAAUGUAUGU19.28.522


Target Position: 421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
421GCAGAAAAGUGUCCGAACC68.06241418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788439GCAGAAAAGTGTCCGAACCGGTTCGGACACTTTTCTGC0.108600.002100.500000.500000.934800.62500


Target Position: 2057, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2057GUUUGUCAUUGAUAAAUUU89.0896182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7672075GTTTGTCATTGATAAATTTAAATTTATCAATGACAAAC0.031000.002900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2055-2077CTGTTTGTCATTGATAAATTTCAAAAUUUAUCAAUGACAAACAGGUUUGUCAUUGAUAAAUUUCAU-10.320.522


Target Position: 912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912UGAUGACUAAGUGGAAUAA86.028299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
638930TGATGACTAAGTGGAATAATTATTCCACTTAGTCATCA0.065200.063000.689700.750001.000001.00000


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185GCGAUAGCUAAGUACACAC76.8269825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6701203GCGATAGCTAAGTACACACGTGTGTACTTAGCTATCGC0.060700.007200.629300.750001.000001.00000


Target Position: 939, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
939GAAAAAUUCCUAUUGUGAU89.8749153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
762957GAAAAATTCCTATTGTGATATCACAATAGGAATTTTTC0.104400.033900.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
937-959TTGAAAAATTCCTATTGTGATTTAUCACAAUAGGAAUUUUUCAAGAAAAAUUCCUAUUGUGAUUUU20.5-12.022


Target Position: 1922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922UGCUUUCGUGUCCCUCUUC57.35142015

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7161940TGCTTTCGTGTCCCTCTTCGAAGAGGGACACGAAAGCA0.115900.011500.681000.500001.000001.00000


Target Position: 2291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2291UAAAAGCUUCCUUUAAAAA80.458587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6522309TAAAAGCTTCCTTTAAAAATTTTTAAAGGAAGCTTTTA0.211200.081800.534500.500000.972800.75000


Target Position: 1839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839CACGGAAAAACUAACGCAA88.1773210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3751857CACGGAAAAACTAACGCAATTGCGTTAGTTTTTCCGTG0.584700.038400.646600.750001.000001.00000


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822AGAGGUAGAUGACGAGGAA94.243156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
530840AGAGGTAGATGACGAGGAATTCCTCGTCATCTACCTCT0.148900.072500.551700.750001.000001.00000


Target Position: 302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
302UGGAAUUCUUAAGUACAAU76.4144852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333320TGGAATTCTTAAGTACAATATTGTACTTAAGAATTCCA0.234600.051100.836200.750001.000001.00000


Target Position: 932, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932CUAUUUUGAAAAAUUCCUA87.0898249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
726950CTATTTTGAAAAATTCCTATAGGAATTTTTCAAAATAG0.198900.079900.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
930-952ACCTATTTTGAAAAATTCCTATTUAGGAAUUUUUCAAAAUAGGUCUAUUUUGAAAAAUUCCUAUUU18.7-1.431


Target Position: 2402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2402UCGUAUUGUAAAAAGAAUG61.6291822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7432420TCGTATTGTAAAAAGAATGCATTCTTTTTACAATACGA0.081200.018900.637900.500001.000001.00000


Target Position: 2452, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2452CAAAUUAUUUCACAAAAAA93.88463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3092470CAAATTATTTCACAAAAAATTTTTTGTGAAATAATTTG0.939100.176000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2450-2472AACAAATTATTTCACAAAAAAAAUUUUUUGUGAAAUAAUUUGUUCAAAUUAUUUCACAAAAAAAAU5.6-10.312


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901GAGGGAGAAGAUGAUGACU82.5303462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
826919GAGGGAGAAGATGATGACTAGTCATCATCTTCTCCCTC0.444500.106600.603400.500001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833ACGAGGAAGAUGAAGAAGA78.6104718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
779851ACGAGGAAGATGAAGAAGATCTTCTTCATCTTCCTCGT0.523900.313600.551700.500001.000001.00000


Target Position: 612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612CUAUGACCGGGACGACAAG69.87791290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819630CTATGACCGGGACGACAAGCTTGTCGTCCCGGTCATAG0.181000.012400.534500.500001.000001.00000


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519GAGCUUAGACCUUUUCAAU90.3965133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379537GAGCTTAGACCTTTTCAATATTGAAAAGGTCTAAGCTC0.188000.038900.801700.750001.000001.00000


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687GGAUGAGGAUGAGGAGGAG80.6173572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497705GGATGAGGATGAGGAGGAGCTCCTCCTCATCCTCATCC0.201200.172400.560300.750001.000001.00000


Target Position: 1143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1143UCCCCUACUUUUUCUUUGU62.83081762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6871161TCCCCTACTTTTTCTTTGTACAAAGAAAAAGTAGGGGA0.497800.310900.663800.500001.000001.00000


Target Position: 2281, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2281GUAUCUUCAUUAAAAGCUU85.8814310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5472299GTATCTTCATTAAAAGCTTAAGCTTTTAATGAAGATAC0.184600.020100.543100.750000.951100.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2279-2301GTGTATCTTCATTAAAAGCTTCCAAGCUUUUAAUGAAGAUACACGUAUCUUCAUUAAAAGCUUCCU17.016.022


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973ACCCAUGUUUCAUCUGUAU78.6023719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2481991ACCCATGTTTCATCTGTATATACAGATGAAACATGGGT0.413200.082400.810300.750001.000001.00000


Target Position: 2362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2362CUUGGAACCUUGUUUUGAA93.452472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8302380CTTGGAACCTTGTTTTGAATTCAAAACAAGGTTCCAAG0.169800.012300.465500.750001.000001.00000


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452AUUUAAGUGGCAACAAAAU73.31461070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
664470ATTTAAGTGGCAACAAAATATTTTGTTGCCACTTAAAT0.819900.019200.500000.500001.000001.00000


Target Position: 774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774GGACGUGAGUGGAGAGGAG82.5724460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513792GGACGTGAGTGGAGAGGAGCTCCTCTCCACTCACGTCC0.896400.362300.560300.750001.000001.00000


Target Position: 2319, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2319GUUACUAAAAAAACAAGUA89.1913175

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2317-2339GAGTTACTAAAAAAACAAGTACCUACUUGUUUUUUUAGUAACUCGUUACUAAAAAAACAAGUACCU17.86.621


Target Position: 753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
753GGAGGAGGAAGGUGAAGAG80.7929561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504771GGAGGAGGAAGGTGAAGAGCTCTTCACCTTCCTCCTCC0.769600.734400.560300.750001.000001.00000


Target Position: 2272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2272CUCAGUGGUGUAUCUUCAU81.7454505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8182290CTCAGTGGTGTATCTTCATATGAAGATACACCACTGAG0.053900.001300.655200.750001.000001.00000


Target Position: 1191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1191GCUAAGUACACACUAAGUG73.65261048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241209GCTAAGTACACACTAAGTGCACTTAGTGTGTACTTAGC0.014500.002000.560300.750000.929300.62500


Target Position: 797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
797AGGAUGAAGAAGGUUAUAA85.8427312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493815AGGATGAAGAAGGTTATAATTATAACCTTCTTCATCCT0.123100.130500.810300.750001.000001.00000


Target Position: 2213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2213UCUUAUGAGAUAUAUAUAA89.4019171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4532231TCTTATGAGATATATATAATTATATATATCTCATAAGA0.183500.024600.689700.750001.000001.00000


Target Position: 924, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
924GGAAUAACCUAUUUUGAAA101.0937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402942GGAATAACCTATTTTGAAATTTCAAAATAGGTTATTCC0.401200.032000.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
922-944GTGGAATAACCTATTTTGAAAAAUUUCAAAAUAGGUUAUUCCACGGAAUAACCUAUUUUGAAAAAU7.710.012


Target Position: 723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
723GGUAGUGGAAGACGAGGAG73.24951075

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550741GGTAGTGGAAGACGAGGAGCTCCTCGTCTTCCACTACC0.467100.276400.543100.750001.000001.00000


Target Position: 2033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2033AGCCAAACUUUGAGUUUUA88.8728190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6022051AGCCAAACTTTGAGTTTTATAAAACTCAAAGTTTGGCT0.080000.011500.819000.750000.956500.75000


Target Position: 278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
278GCCUCACAGAUGAAUUUGA87.8627221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
592296GCCTCACAGATGAATTTGATCAAATTCATCTGTGAGGC0.103400.011500.775900.750001.000001.00000


Target Position: 1897, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897CAAAUUCCUAGUGAAUGUA87.1872247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341915CAAATTCCTAGTGAATGTATACATTCACTAGGAATTTG0.039700.003400.465500.750000.989100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1895-1917TGCAAATTCCTAGTGAATGTACAUACAUUCACUAGGAAUUUGCACAAAUUCCUAGUGAAUGUACAU20.514.223


Target Position: 253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
253CGGUCGAAUGAAGGCAAAC67.18511481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
832271CGGTCGAATGAAGGCAAACGTTTGCCTTCATTCGACCG0.094600.001100.767200.750001.000001.00000


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277UGGUGUAUCUUCAUUAAAA94.204457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8032295TGGTGTATCTTCATTAAAATTTTAATGAAGATACACCA0.264400.001700.844800.750001.000001.00000


Target Position: 796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
796GAGGAUGAAGAAGGUUAUA89.7129159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445814GAGGATGAAGAAGGTTATATATAACCTTCTTCATCCTC0.149900.156900.767200.750001.000001.00000


Target Position: 1488, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1488CCUUUUCCCCCUUCACAGA77.1069800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501506CCTTTTCCCCCTTCACAGATCTGTGAAGGGGGAAAAGG0.096900.076200.620700.750000.945700.62500


Target Position: 2032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2032GAGCCAAACUUUGAGUUUU83.6951402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482050GAGCCAAACTTTGAGTTTTAAAACTCAAAGTTTGGCTC0.085000.003500.810300.750000.956500.62500


Target Position: 1102, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102GUGGAAUAAAAUACUAUUU82.4507466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6591120GTGGAATAAAATACTATTTAAATAGTATTTTATTCCAC0.091800.007800.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1100-1122GGGTGGAATAAAATACTATTTTTAAAUAGUAUUUUAUUCCACCCGUGGAAUAAAAUACUAUUUUUU6.321.202


Target Position: 1961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961UGUAAUUUCUGAACCCAUG66.29821537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6121979TGTAATTTCTGAACCCATGCATGGGTTCAGAAATTACA0.074600.042600.551700.500001.000001.00000


Target Position: 1486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486UCCCUUUUCCCCCUUCACA65.25281596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121504TCCCTTTTCCCCCTTCACATGTGAAGGGGGAAAAGGGA0.211800.164400.663800.500001.000001.00000


Target Position: 1687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1687UCUUGUUCUGUAAAAUAUU74.8856964

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7141705TCTTGTTCTGTAAAATATTAATATTTTACAGAACAAGA0.045600.018200.715500.750001.000001.00000


Target Position: 1706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1706AGAACGCUUUGUUUUACAA90.0933141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7041724AGAACGCTTTGTTTTACAATTGTAAAACAAAGCGTTCT0.109600.005600.577600.750001.000001.00000


Target Position: 2413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2413AAAGAAUGUAUGGUUGAAA84.814357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7112431AAAGAATGTATGGTTGAAATTTCAACCATACATTCTTT0.051500.005300.500000.500001.000001.00000


Target Position: 2441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2441UGUUUAUAAAACAAAUUAU81.2609531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5102459TGTTTATAAAACAAATTATATAATTTGTTTTATAAACA0.115700.034800.663800.750001.000001.00000


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993CCUCCAAUCCUGCCCCCUG62.74541770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151011CCTCCAATCCTGCCCCCTGCAGGGGGCAGGATTGGAGG0.589600.521200.560300.750001.000001.00000


Target Position: 2188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2188UUUUGUUACCUGAUAGAAU75.9579884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352206TTTTGTTACCTGATAGAATATTCTATCAGGTAACAAAA0.013700.003900.491400.500001.000001.00000


Target Position: 2364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364UGGAACCUUGUUUUGAAUA73.94841032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3592382TGGAACCTTGTTTTGAATATATTCAAAACAAGGTTCCA0.198800.080300.801700.750001.000001.00000


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895UGCAAAUUCCUAGUGAAUG59.69981919

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7941913TGCAAATTCCTAGTGAATGCATTCACTAGGAATTTGCA0.024000.005000.698300.500000.989100.62500


Target Position: 2460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2460UUCACAAAAAAAAAAAAAA72.47121128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8202478TTCACAAAAAAAAAAAAAATTTTTTTTTTTTTTGTGAA0.991600.918400.672400.500001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991CCCCUCCAAUCCUGCCCCC45.42122347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7151009CCCCTCCAATCCTGCCCCCGGGGGCAGGATTGGAGGGG0.734400.600800.500000.500001.000001.00000


Target Position: 1787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1787CGCUGGAGACGUUGCUGCA89.8977150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261805CGCTGGAGACGTTGCTGCATGCAGCAACGTCTCCAGCG0.087300.001200.569000.750001.000001.00000


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239GGUUUGGAGUUCUCUUACG74.7188976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281257GGTTTGGAGTTCTCTTACGCGTAAGAGAACTCCAAACC0.248200.019800.577600.500001.000001.00000


Target Position: 437, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
437ACCUCACGCAUCUAAAUUU78.6916710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
373455ACCTCACGCATCTAAATTTAAATTTAGATGCGTGAGGT0.647800.215000.853400.750001.000001.00000


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871UACCUAGUGGAAAUCUGAA83.7972398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6481889TACCTAGTGGAAATCTGAATTCAGATTTCCACTAGGTA0.282500.036500.508600.500001.000001.00000


Target Position: 1711, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711GCUUUGUUUUACAAAAAAU87.3298242

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1709-1731ACGCTTTGTTTTACAAAAAATGAAUUUUUUGUAAAACAAAGCGUGCUUUGUUUUACAAAAAAUGAU-2.910.322


Target Position: 14, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
14ACGGCGAUCAGGUUAGUGU70.63281245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
68832ACGGCGATCAGGTTAGTGTACACTAACCTGATCGCCGT0.306700.018000.569000.500001.000001.00000


Target Position: 2209, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2209CUUUUCUUAUGAGAUAUAU81.8845495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7062227CTTTTCTTATGAGATATATATATATCTCATAAGAAAAG0.047900.008600.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2207-2229AGCTTTTCTTATGAGATATATATAUAUAUCUCAUAAGAAAAGCUCUUUUCUUAUGAGAUAUAUAUU8.25.523


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137UUUUUUUCCCCUACUUUUU59.82191912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181155TTTTTTTCCCCTACTTTTTAAAAAGTAGGGGAAAAAAA0.572900.552400.500000.500001.000001.00000


Target Position: 1122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1122UACUGCCACUCUUUAUUUU74.02831026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791140TACTGCCACTCTTTATTTTAAAATAAAGAGTGGCAGTA0.932000.238600.681000.500001.000001.00000


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678UGAGGAGGAGGAUGAGGAU78.7036708

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
560696TGAGGAGGAGGATGAGGATATCCTCATCCTCCTCCTCA0.740000.482900.543100.750001.000001.00000


Target Position: 997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997CAAUCCUGCCCCCUGAAAC66.04061549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6791015CAATCCTGCCCCCTGAAACGTTTCAGGGGGCAGGATTG0.581900.493600.500000.500001.000001.00000


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786AGAGGAGGAGGAGGAUGAA86.2322282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532804AGAGGAGGAGGAGGATGAATTCATCCTCCTCCTCCTCT0.867300.799100.551700.750001.000001.00000


Target Position: 1015, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015CUUAUUUUUUUCUGAUUGU73.74961042

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1013-1035AACTTATTTTTTTCTGATTGTAAACAAUCAGAAAAAAAUAAGUUCUUAUUUUUUUCUGAUUGUAAU18.1-9.722


Target Position: 1732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1732UGAGAGAAUUCUUCCACAU81.9706490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831750TGAGAGAATTCTTCCACATATGTGGAAGAATTCTCTCA0.154400.026000.569000.750001.000001.00000


Target Position: 1811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1811GCUGGGUUUUUUUUUUCAU80.4773585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451829GCTGGGTTTTTTTTTTCATATGAAAAAAAAAACCCAGC0.774700.003700.698301.000001.000001.00000


Target Position: 1971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1971GAACCCAUGUUUCAUCUGU79.6243645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8331989GAACCCATGTTTCATCTGTACAGATGAAACATGGGTTC0.235200.056800.465500.500001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784GGAGAGGAGGAGGAGGAUG68.75261368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176802GGAGAGGAGGAGGAGGATGCATCCTCCTCCTCCTCTCC0.865200.798800.715500.750001.000001.00000


Target Position: 1685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1685UAUCUUGUUCUGUAAAAUA88.21209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6821703TATCTTGTTCTGTAAAATATATTTTACAGAACAAGATA0.052300.032600.500000.500001.000001.00000


Target Position: 747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747GGAUGAGGAGGAGGAAGGU77.9007759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
638765GGATGAGGAGGAGGAAGGTACCTTCCTCCTCCTCATCC0.792900.536600.517200.750001.000001.00000


Target Position: 1660, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660CUUUAAAAGAAAAAAAAAA86.2948281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3931678CTTTAAAAGAAAAAAAAAATTTTTTTTTTCTTTTAAAG0.878600.134300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1658-1680TTCTTTAAAAGAAAAAAAAAACTUUUUUUUUUUCUUUUAAAGAACUUUAAAAGAAAAAAAAAACUU-11.3-9.111


Target Position: 333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
333CACCUCAAUCGCAAACUUA91.1907115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
398351CACCTCAATCGCAAACTTATAAGTTTGCGATTGAGGTG0.179000.053900.758600.750001.000001.00000


Target Position: 289, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
289GAAUUUGAAGAACUGGAAU84.9006349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
626307GAATTTGAAGAACTGGAATATTCCAGTTCTTCAAATTC0.211600.009600.663800.750001.000001.00000


Target Position: 271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
271CUCGAAGGCCUCACAGAUG69.38731324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
791289CTCGAAGGCCTCACAGATGCATCTGTGAGGCCTTCGAG0.046200.002100.655200.500001.000001.00000


Target Position: 275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
275AAGGCCUCACAGAUGAAUU75.9097888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
829293AAGGCCTCACAGATGAATTAATTCATCTGTGAGGCCTT0.073300.001100.629300.500001.000001.00000


Target Position: 257, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257CGAAUGAAGGCAAACUCGA83.3399421

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
255-277GTCGAATGAAGGCAAACTCGAAGUCGAGUUUGCCUUCAUUCGACCGAAUGAAGGCAAACUCGAAGU19.716.302


Target Position: 1165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1165CGGUUUUUGUCCCUGUAAA90.219135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201183CGGTTTTTGTCCCTGTAAATTTACAGGGACAAAAACCG0.109500.052000.913801.000000.907600.75000


Target Position: 2083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2083UCUUUUUAUACAAUUUUUU67.48111459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1752101TCTTTTTATACAATTTTTTAAAAAATTGTATAAAAAGA0.445100.265000.724100.750001.000001.00000


Target Position: 495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
495ACUGAAAAAGUUAGAAAAC66.0221550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
535513ACTGAAAAAGTTAGAAAACGTTTTCTAACTTTTTCAGT0.172200.134000.560300.500001.000001.00000


Target Position: 352, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
352CCAAAGUUAAACAAACUUA89.9064149

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
350-372TACCAAAGTTAAACAAACTTAAGUAAGUUUGUUUAACUUUGGUACCAAAGUUAAACAAACUUAAGU10.310.302


Target Position: 385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
385AGCGAUAACAGAGUCUCAG67.10521487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833403AGCGATAACAGAGTCTCAGCTGAGACTCTGTTATCGCT0.013100.008300.569000.500001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898GAUGAGGGAGAAGAUGAUG73.66831047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
606916GATGAGGGAGAAGATGATGCATCATCTTCTCCCTCATC0.718900.171600.525900.500001.000001.00000


Target Position: 282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
282CACAGAUGAAUUUGAAGAA94.016561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
604300CACAGATGAATTTGAAGAATTCTTCAAATTCATCTGTG0.078800.030100.620700.750001.000001.00000


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837GGAAGAUGAAGAAGAGCUU87.6929227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
738855GGAAGATGAAGAAGAGCTTAAGCTCTTCTTCATCTTCC0.039100.041500.732801.000001.000001.00000


Target Position: 1933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1933CCCUCUUCUGGUUGCUUUA84.2459382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8021951CCCTCTTCTGGTTGCTTTATAAAGCAACCAGAAGAGGG0.018700.003200.956901.000000.945700.75000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592UGUUAAGUUACAAGGAAAA81.9407492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5651610TGTTAAGTTACAAGGAAAATTTTCCTTGTAACTTAACA0.153000.014000.706900.750001.000001.00000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826GUAGAUGACGAGGAAGAUG71.98861163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
607844GTAGATGACGAGGAAGATGCATCTTCCTCGTCATCTAC0.523400.082900.525900.500001.000001.00000


Target Position: 2219, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2219GAGAUAUAUAUAAUGUGAU94.033860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3782237GAGATATATATAATGTGATATCACATTATATATATCTC0.251800.082500.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2217-2239ATGAGATATATATAATGTGATACAUCACAUUAUAUAUAUCUCAUGAGAUAUAUAUAAUGUGAUACU20.58.212


Target Position: 1305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305UGGUCUCAGUUUGGUUACU67.49131458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8121323TGGTCTCAGTTTGGTTACTAGTAACCAAACTGAGACCA0.017200.003900.637900.500001.000001.00000


Target Position: 2051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2051AUGUCUGUUUGUCAUUGAU80.5192581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992069ATGTCTGTTTGTCATTGATATCAATGACAAACAGACAT0.030400.003400.474100.500001.000001.00000


Target Position: 1680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1680UGUCCUAUCUUGUUCUGUA93.069880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6241698TGTCCTATCTTGTTCTGTATACAGAACAAGATAGGACA0.070900.070400.525900.750001.000001.00000


Target Position: 520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
520AGCUUAGACCUUUUCAAUU79.9211627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
356538AGCTTAGACCTTTTCAATTAATTGAAAAGGTCTAAGCT0.200900.138100.844800.750001.000001.00000


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001CCUGCCCCCUGAAACUUAU75.66913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1361019CCTGCCCCCTGAAACTTATATAAGTTTCAGGGGGCAGG0.563100.467400.801701.000001.000001.00000


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415AGAAUGUAUGGUUGAAAAC69.02691349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202433AGAATGTATGGTTGAAAACGTTTTCAACCATACATTCT0.177900.005900.577600.500001.000001.00000


Target Position: 857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857GUGAAGAAGAAAGGGGUCA72.99551085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
770875GTGAAGAAGAAAGGGGTCATGACCCCTTTCTTCTTCAC0.113200.083000.569000.500001.000001.00000


Target Position: 2409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2409GUAAAAAGAAUGUAUGGUU84.6096367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7652427GTAAAAAGAATGTATGGTTAACCATACATTCTTTTTAC0.030600.007300.534500.750001.000001.00000


Target Position: 2053, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2053GUCUGUUUGUCAUUGAUAA96.558329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8032071GTCTGTTTGTCATTGATAATTATCAATGACAAACAGAC0.018600.002100.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2051-2073ATGTCTGTTTGTCATTGATAAATUUAUCAAUGACAAACAGACAUGUCUGUUUGUCAUUGAUAAAUU8.719.222


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801UGAAGAAGGUUAUAACGAU86.7899264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
569819TGAAGAAGGTTATAACGATATCGTTATAACCTTCTTCA0.137300.089900.543100.750001.000001.00000


Target Position: 2276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2276GUGGUGUAUCUUCAUUAAA90.1913137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7852294GTGGTGTATCTTCATTAAATTTAATGAAGATACACCAC0.354200.002200.793100.750001.000001.00000


Target Position: 1854, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1854GCAAAAUUGUAUUUUCUUA96.100636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5881872GCAAAATTGTATTTTCTTATAAGAAAATACAATTTTGC0.084000.039200.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1852-1874ACGCAAAATTGTATTTTCTTACCUAAGAAAAUACAAUUUUGCGUGCAAAAUUGUAUUUUCUUACCU5.5-3.322


Target Position: 873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873UCAGAAGCGAAAACGAGAA76.2141866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526891TCAGAAGCGAAAACGAGAATTCTCGTTTTCGCTTCTGA0.499600.207700.551700.750001.000001.00000


Target Position: 2377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2377UGAAUAUCUUUCAUUGUUU80.1962605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802395TGAATATCTTTCATTGTTTAAACAATGAAAGATATTCA0.053000.031500.724100.750001.000001.00000


Target Position: 2245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2245UUGGAUAUUUUUGGUCUUA72.14231150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7722263TTGGATATTTTTGGTCTTATAAGACCAAAAATATCCAA0.028300.006400.612100.500001.000001.00000


Target Position: 953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
953GUGAUUUGACUGUUUUUAC73.33321068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
718971GTGATTTGACTGTTTTTACGTAAAAACAGTCAAATCAC0.456500.179800.612100.500001.000001.00000


Target Position: 1703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703AUUAGAACGCUUUGUUUUA80.6653568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141721ATTAGAACGCTTTGTTTTATAAAACAAAGCGTTCTAAT0.097500.001400.474100.500001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765UGAAGAGGAGGACGUGAGU68.88831360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
629783TGAAGAGGAGGACGTGAGTACTCACGTCCTCCTCTTCA0.369200.348300.517200.500001.000001.00000


Target Position: 557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
557ACGACUACCGAGAAAAUGU73.74921043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
702575ACGACTACCGAGAAAATGTACATTTTCTCGGTAGTCGT0.048800.039500.569000.500001.000001.00000


Target Position: 983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
983CUCCCCCCCCCCUCCAAUC45.39962348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701001CTCCCCCCCCCCTCCAATCGATTGGAGGGGGGGGGGAG0.843900.830900.629300.500001.000001.00000


Target Position: 2234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2234UGAUACUAUGUUUGGAUAU76.5577844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6952252TGATACTATGTTTGGATATATATCCAAACATAGTATCA0.050100.014300.681000.750001.000001.00000


Target Position: 303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
303GGAAUUCUUAAGUACAAUC77.9608756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308321GGAATTCTTAAGTACAATCGATTGTACTTAAGAATTCC0.243400.061800.689700.750001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773AGGACGUGAGUGGAGAGGA76.4712848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788791AGGACGTGAGTGGAGAGGATCCTCTCCACTCACGTCCT0.880800.359200.474100.500001.000001.00000


Target Position: 173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
173UGGAGAUGGGCAGACGGAU68.18481410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
647191TGGAGATGGGCAGACGGATATCCGTCTGCCCATCTCCA0.062800.021500.663800.750001.000001.00000


Target Position: 1668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1668GAAAAAAAAAACUGUCCUA93.748766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6871686GAAAAAAAAAACTGTCCTATAGGACAGTTTTTTTTTTC0.852900.804400.500000.750001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424UUUGUAAAUAGCAACCUAA81.5344515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171442TTTGTAAATAGCAACCTAATTAGGTTGCTATTTACAAA0.021700.008000.465500.500000.983700.62500


Target Position: 1716, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1716GUUUUACAAAAAAUGAUGA83.0323436

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1714-1736TTGTTTTACAAAAAATGATGAGAUCAUCAUUUUUUGUAAAACAAGUUUUACAAAAAAUGAUGAGAU13.67.222


Target Position: 1356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1356UCUUUUGCUUUGGUUCACA72.18911148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841374TCTTTTGCTTTGGTTCACATGTGAACCAAAGCAAAAGA0.028000.010600.517200.500000.983700.62500


Target Position: 1093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1093CGGGUGGGGGUGGAAUAAA79.1787678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8271111CGGGTGGGGGTGGAATAAATTTATTCCACCCCCACCCG0.053000.001200.913801.000001.000001.00000


Target Position: 2212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2212UUCUUAUGAGAUAUAUAUA89.1259179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7412230TTCTTATGAGATATATATATATATATATCTCATAAGAA0.191900.012300.629300.500001.000001.00000


Target Position: 432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
432UCCGAACCUCACGCAUCUA74.28381010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
423450TCCGAACCTCACGCATCTATAGATGCGTGAGGTTCGGA0.398100.096700.698300.750001.000001.00000


Target Position: 435, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
435GAACCUCACGCAUCUAAAU88.5002201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
368453GAACCTCACGCATCTAAATATTTAGATGCGTGAGGTTC0.629500.177300.663800.750001.000001.00000


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144AAGAUGCAUUCCAGAUGAA89.9125148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272162AAGATGCATTCCAGATGAATTCATCTGGAATGCATCTT0.132600.010500.465500.500001.000001.00000


Target Position: 1432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432UAGCAACCUAAAGGCGUAU65.07851613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8271450TAGCAACCTAAAGGCGTATATACGCCTTTAGGTTGCTA0.014200.001400.629300.500000.929301.00000


Target Position: 1445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1445GCGUAUUUUGGCACUGGUC68.29561405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6391463GCGTATTTTGGCACTGGTCGACCAGTGCCAAAATACGC0.083400.008600.603400.750001.000001.00000


Target Position: 2436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2436AGGAAUGUUUAUAAAACAA91.5579108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3742454AGGAATGTTTATAAAACAATTGTTTTATAAACATTCCT0.206200.038500.698300.750000.972800.62500


Target Position: 258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
258GAAUGAAGGCAAACUCGAA101.3396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684276GAATGAAGGCAAACTCGAATTCGAGTTTGCCTTCATTC0.606700.006500.500000.750001.000001.00000


Target Position: 1617, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617UGGUAAUUAAAAUUAGAAG69.62721307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5411635TGGTAATTAAAATTAGAAGCTTCTAATTTTAATTACCA0.100500.016400.706900.500001.000001.00000


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071GGGGUUGCGGGGGGAGGGA59.80451914

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601089GGGGTTGCGGGGGGAGGGATCCCTCCCCCCGCAACCCC0.510200.014800.620700.750001.000001.00000


Target Position: 2224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2224AUAUAUAAUGUGAUACUAU91.0544116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902242ATATATAATGTGATACTATATAGTATCACATTATATAT0.189300.087500.500000.500001.000001.00000


Target Position: 533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533UCAAUUGCGAGGUAACCAA76.9986812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
815551TCAATTGCGAGGTAACCAATTGGTTACCTCGCAATTGA0.016700.001900.577600.750001.000001.00000


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820GGAGAGGUAGAUGACGAGG66.10861544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
608838GGAGAGGTAGATGACGAGGCCTCGTCATCTACCTCTCC0.125900.060600.525900.500001.000001.00000


Target Position: 2109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109GGCUUCUUUGAGUCCAACA86.166289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8062127GGCTTCTTTGAGTCCAACATGTTGGACTCAAAGAAGCC0.021200.001700.793100.750001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425UUGUAAAUAGCAACCUAAA80.6087574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7941443TTGTAAATAGCAACCTAAATTTAGGTTGCTATTTACAA0.021900.005200.646600.500000.983700.75000


Target Position: 2208, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2208GCUUUUCUUAUGAGAUAUA93.619769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6852226GCTTTTCTTATGAGATATATATATCTCATAAGAAAAGC0.052200.008600.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2206-2228TAGCTTTTCTTATGAGATATATAUAUAUCUCAUAAGAAAAGCUAGCUUUUCUUAUGAGAUAUAUAU15.910.332


Target Position: 959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
959UGACUGUUUUUACCCAUAU76.6502834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
252977TGACTGTTTTTACCCATATATATGGGTAAAAACAGTCA0.411100.247600.681000.750001.000001.00000


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007CCCUGAAACUUAUUUUUUU84.9509347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5831025CCCTGAAACTTATTTTTTTAAAAAAATAAGTTTCAGGG0.085200.081200.991401.000001.000001.00000


Target Position: 1737, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1737GAAUUCUUCCACAUGUACU84.9808343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131755GAATTCTTCCACATGTACTAGTACATGTGGAAGAATTC0.085500.012500.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1735-1757GAGAATTCTTCCACATGTACTTCAGUACAUGUGGAAGAAUUCUCGAAUUCUUCCACAUGUACUUCU20.45.322


Target Position: 1131, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1131UCUUUAUUUUUUUCCCCUA77.7371766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5351149TCTTTATTTTTTTCCCCTATAGGGGAAAAAAATAAAGA0.595500.604000.551700.750001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719CUCAGGUAGUGGAAGACGA84.2547381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
676737CTCAGGTAGTGGAAGACGATCGTCTTCCACTACCTGAG0.487400.261700.517200.500001.000001.00000


Target Position: 348, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348CUUACCAAAGUUAAACAAA84.2582380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526366CTTACCAAAGTTAAACAAATTTGTTTAACTTTGGTAAG0.105700.022000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
346-368AACTTACCAAAGTTAAACAAACTUUUGUUUAACUUUGGUAAGUUCUUACCAAAGUUAAACAAACUU7.220.002


Target Position: 2453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2453AAAUUAUUUCACAAAAAAA92.468789

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222471AAATTATTTCACAAAAAAATTTTTTTGTGAAATAATTT0.954100.177400.500000.500001.000001.00000


Target Position: 1648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1648AAACUUCAACUUCUUUAAA84.613365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6781666AAACTTCAACTTCTTTAAATTTAAAGAAGTTGAAGTTT0.156900.132400.500000.500001.000001.00000


Target Position: 2416, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2416GAAUGUAUGGUUGAAAACU82.624458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232434GAATGTATGGTTGAAAACTAGTTTTCAACCATACATTC0.170000.006700.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2414-2436AAGAATGTATGGTTGAAAACTCAAGUUUUCAACCAUACAUUCUUGAAUGUAUGGUUGAAAACUCAU14.96.732


Target Position: 2128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128GGCCAUUGAUCUUUUCAAG78.9379688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8042146GGCCATTGATCTTTTCAAGCTTGAAAAGATCAATGGCC0.055600.001700.862100.750000.983700.62500


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771GGAGGACGUGAGUGGAGAG82.9348442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496789GGAGGACGTGAGTGGAGAGCTCTCCACTCACGTCCTCC0.662100.355900.560300.750001.000001.00000


Target Position: 905, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905GAGAAGAUGAUGACUAAGU82.8796445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
789923GAGAAGATGATGACTAAGTACTTAGTCATCATCTTCTC0.198500.185800.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
903-925GGGAGAAGATGATGACTAAGTGGACUUAGUCAUCAUCUUCUCCCGAGAAGAUGAUGACUAAGUGGU18.919.113


Target Position: 471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471UAAAGACCUCAGCACAAUA88.5617198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
763489TAAAGACCTCAGCACAATATATTGTGCTGAGGTCTTTA0.720800.653300.491400.500001.000001.00000


Target Position: 2427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2427UGAAAACUCAGGAAUGUUU75.4045930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5522445TGAAAACTCAGGAATGTTTAAACATTCCTGAGTTTTCA0.096400.019600.724100.750001.000001.00000


Target Position: 1208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1208UGAGCAUUUGUUCCUGACU69.81781294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251226TGAGCATTTGTTCCTGACTAGTCAGGAACAAATGCTCA0.158000.005100.517200.500001.000001.00000


Target Position: 808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
808GGUUAUAACGAUGGAGAGG66.49981527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651826GGTTATAACGATGGAGAGGCCTCTCCATCGTTATAACC0.220400.065800.508600.500001.000001.00000


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176CCUGUAAAUGCGAUAGCUA93.336173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8371194CCTGTAAATGCGATAGCTATAGCTATCGCATTTACAGG0.011700.001400.672401.000000.962000.75000


Target Position: 1985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985UCUGUAUAAAAGAACAUCU73.93021037

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052003TCTGTATAAAAGAACATCTAGATGTTCTTTTATACAGA0.112100.064700.500000.500001.000001.00000


Target Position: 1896, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896GCAAAUUCCUAGUGAAUGU82.8062450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901914GCAAATTCCTAGTGAATGTACATTCACTAGGAATTTGC0.022500.004000.646600.750000.989100.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1894-1916CTGCAAATTCCTAGTGAATGTACACAUUCACUAGGAAUUUGCAGGCAAAUUCCUAGUGAAUGUACU20.57.433


Target Position: 1688, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1688CUUGUUCUGUAAAAUAUUA91.8896100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7851706CTTGTTCTGTAAAATATTATAATATTTTACAGAACAAG0.023900.011600.603400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1686-1708ATCTTGTTCTGTAAAATATTAGAUAAUAUUUUACAGAACAAGAUCUUGUUCUGUAAAAUAUUAGAU-10.319.222


Target Position: 1585, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585CUUGUUGUGUUAAGUUACA83.6164406

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1583-1605GGCTTGTTGTGTTAAGTTACAAGUGUAACUUAACACAACAAGCCCUUGUUGUGUUAAGUUACAAGU12.919.323


Target Position: 543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
543GGUAACCAACCUGAACGAC66.14681543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
587561GGTAACCAACCTGAACGACGTCGTTCAGGTTGGTTACC0.154000.075400.534500.750000.951100.62500


Target Position: 2356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2356GCCAACCUUGGAACCUUGU63.46091717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672374GCCAACCTTGGAACCTTGTACAAGGTTCCAAGGTTGGC0.291400.013700.793100.750000.956500.62500


Target Position: 1528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1528AAAGAGGACUCUGAUGUUA86.4021278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321546AAAGAGGACTCTGATGTTATAACATCAGAGTCCTCTTT0.127600.006800.465500.500001.000001.00000


Target Position: 1607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1607AAAAUGGAUUUGGUAAUUA84.458377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8351625AAAATGGATTTGGTAATTATAATTACCAAATCCATTTT0.526400.092800.465500.500001.000001.00000


Target Position: 1865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865UUUUCUUACCUAGUGGAAA72.30661141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171883TTTTCTTACCTAGTGGAAATTTCCACTAGGTAAGAAAA0.070700.008500.500000.500001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GAGGAGGACGUGAGUGGAG73.63321052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
667787GAGGAGGACGTGAGTGGAGCTCCACTCACGTCCTCCTC0.684900.352900.500000.500001.000001.00000


Target Position: 1759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759GUGCUUAGAACAUUUUUAC71.44691198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581777GTGCTTAGAACATTTTTACGTAAAAATGTTCTAAGCAC0.816900.007800.612100.500001.000001.00000


Target Position: 1097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1097UGGGGGUGGAAUAAAAUAC61.23771851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7261115TGGGGGTGGAATAAAATACGTATTTTATTCCACCCCCA0.313800.004300.663800.500001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718GCUCAGGUAGUGGAAGACG65.09521608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
829736GCTCAGGTAGTGGAAGACGCGTCTTCCACTACCTGAGC0.453800.008200.577600.500001.000001.00000


Target Position: 2199, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2199GAUAGAAUAGCUUUUCUUA101.8624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6322217GATAGAATAGCTTTTCTTATAAGAAAAGCTATTCTATC0.088300.009200.646600.750000.956500.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2197-2219CTGATAGAATAGCTTTTCTTATGUAAGAAAAGCUAUUCUAUCAGGAUAGAAUAGCUUUUCUUAUGU5.56.622


Target Position: 1605, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1605GGAAAAUGGAUUUGGUAAU82.846446

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1160519GGAAAATGGATTTGGTAAT1/1/0/097.75ANP32ANM_006305.31NANANA15:69071718..69071736(-)|12:48867856..48867874(+)00ANP32A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841623GGAAAATGGATTTGGTAATATTACCAAATCCATTTTCC0.185500.095300.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1603-1625AAGGAAAATGGATTTGGTAATTAAUUACCAAAUCCAUUUUCCUUGGAAAAUGGAUUUGGUAAUUAU20.07.422


Target Position: 861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
861AGAAGAAAGGGGUCAGAAG74.07181024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
701879AGAAGAAAGGGGTCAGAAGCTTCTGACCCCTTTCTTCT0.129000.073100.586200.500001.000001.00000


Target Position: 272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
272UCGAAGGCCUCACAGAUGA71.3131211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802290TCGAAGGCCTCACAGATGATCATCTGTGAGGCCTTCGA0.062400.002500.569000.500001.000001.00000


Target Position: 76, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
76GAGCCUUCAAAGUCCUAAA93.474571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
64194GAGCCTTCAAAGTCCTAAATTTAGGACTTTGAAGGCTC0.281600.008600.810300.750001.000001.00000


Target Position: 279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
279CCUCACAGAUGAAUUUGAA94.169159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
557297CCTCACAGATGAATTTGAATTCAAATTCATCTGTGAGG0.097800.015000.672401.000001.000001.00000


Target Position: 1893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893ACUGCAAAUUCCUAGUGAA93.884662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141911ACTGCAAATTCCTAGTGAATTCACTAGGAATTTGCAGT0.016900.006300.534500.750001.000001.00000


Target Position: 1350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1350GCCAUAUCUUUUGCUUUGG57.95541989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8101368GCCATATCTTTTGCTTTGGCCAAAGCAAAAGATATGGC0.017800.005300.655200.500001.000001.00000


Target Position: 986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
986CCCCCCCCCUCCAAUCCUG51.6912199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3011004CCCCCCCCCTCCAATCCTGCAGGATTGGAGGGGGGGGG0.765100.745600.706900.750001.000001.00000


Target Position: 2274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2274CAGUGGUGUAUCUUCAUUA99.475213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7792292CAGTGGTGTATCTTCATTATAATGAAGATACACCACTG0.069500.002300.750000.750001.000001.00000


Target Position: 1072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1072GGGUUGCGGGGGGAGGGAU65.35451587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511090GGGTTGCGGGGGGAGGGATATCCCTCCCCCCGCAACCC0.360000.015400.810301.000001.000001.00000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458GUGGCAACAAAAUUAAAGA84.8471353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474476GTGGCAACAAAATTAAAGATCTTTAATTTTGTTGCCAC0.804700.082600.569000.500001.000001.00000


Target Position: 1236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1236GAUGGUUUGGAGUUCUCUU87.2347245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6501254GATGGTTTGGAGTTCTCTTAAGAGAACTCCAAACCATC0.108900.008300.543100.750001.000001.00000


Target Position: 2067, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2067GAUAAAUUUCAAUAAAUCU89.807155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2065-2087TTGATAAATTTCAATAAATCTTTAGAUUUAUUGAAAUUUAUCAAGAUAAAUUUCAAUAAAUCUUUU1.8-10.322


Target Position: 815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
815ACGAUGGAGAGGUAGAUGA78.1185751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517833ACGATGGAGAGGTAGATGATCATCTACCTCTCCATCGT0.138700.079000.551700.500001.000001.00000


Target Position: 1135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1135UAUUUUUUUCCCCUACUUU71.11441221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7341153TATTTTTTTCCCCTACTTTAAAGTAGGGGAAAAAAATA0.569600.573000.543100.500001.000001.00000


Target Position: 2195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2195ACCUGAUAGAAUAGCUUUU76.2248864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7702213ACCTGATAGAATAGCTTTTAAAAGCTATTCTATCAGGT0.055200.002700.853400.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181GCUUCAUUUUUGUUACCUG80.5853576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512199GCTTCATTTTTGTTACCTGCAGGTAACAAAAATGAAGC0.033100.006900.569000.750001.000001.00000


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436AACCUCACGCAUCUAAAUU71.45311197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
635454AACCTCACGCATCTAAATTAATTTAGATGCGTGAGGTT0.654400.199600.637900.500001.000001.00000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972AACCCAUGUUUCAUCUGUA93.28374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8291990AACCCATGTTTCATCTGTATACAGATGAAACATGGGTT0.353500.059200.465500.500001.000001.00000


Target Position: 2194, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2194UACCUGAUAGAAUAGCUUU76.6148837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8082212TACCTGATAGAATAGCTTTAAAGCTATTCTATCAGGTA0.071500.002000.681000.500001.000001.00000


Target Position: 2071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071AAUUUCAAUAAAUCUUUUU72.08271155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6542089AATTTCAATAAATCTTTTTAAAAAGATTTATTGAAATT0.320600.041700.508600.500001.000001.00000


Target Position: 429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
429GUGUCCGAACCUCACGCAU74.9747960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400447GTGTCCGAACCTCACGCATATGCGTGAGGTTCGGACAC0.214400.037300.637900.750001.000001.00000


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764GUGAAGAGGAGGACGUGAG71.04591227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
778782GTGAAGAGGAGGACGTGAGCTCACGTCCTCCTCTTCAC0.373700.352100.482800.500001.000001.00000


Target Position: 1163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1163UCCGGUUUUUGUCCCUGUA72.4761127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511181TCCGGTTTTTGTCCCTGTATACAGGGACAAAAACCGGA0.096400.027700.689700.750000.907600.87500


Target Position: 999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
999AUCCUGCCCCCUGAAACUU58.4181973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431017ATCCTGCCCCCTGAAACTTAAGTTTCAGGGGGCAGGAT0.579000.515300.543100.500001.000001.00000


Target Position: 2099, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2099UUUUGGGGAUGGCUUCUUU67.12031485

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8332117TTTTGGGGATGGCTTCTTTAAAGAAGCCATCCCCAAAA0.017800.001100.500000.500001.000001.00000


Target Position: 1853, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1853CGCAAAAUUGUAUUUUCUU81.4243523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5901871CGCAAAATTGTATTTTCTTAAGAAAATACAATTTTGCG0.083500.038900.784501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1851-1873AACGCAAAATTGTATTTTCTTACAAGAAAAUACAAUUUUGCGUUCGCAAAAUUGUAUUUUCUUACU5.314.022


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363UUGGAACCUUGUUUUGAAU69.84551291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6822381TTGGAACCTTGTTTTGAATATTCAAAACAAGGTTCCAA0.196500.040200.637900.500001.000001.00000


Target Position: 1681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1681GUCCUAUCUUGUUCUGUAA94.645752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6431699GTCCTATCTTGTTCTGTAATTACAGAACAAGATAGGAC0.063300.062000.784500.750001.000001.00000


Target Position: 2214, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2214CUUAUGAGAUAUAUAUAAU95.906240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662232CTTATGAGATATATATAATATTATATATATCTCATAAG0.195000.023100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2212-2234TTCTTATGAGATATATATAATGTAUUAUAUAUAUCUCAUAAGAACUUAUGAGAUAUAUAUAAUGUU-5.913.432


Target Position: 1004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1004GCCCCCUGAAACUUAUUUU74.6363989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271022GCCCCCTGAAACTTATTTTAAAATAAGTTTCAGGGGGC0.360800.189701.000001.000001.000001.00000


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762AGGUGAAGAGGAGGACGUG69.11251343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
637780AGGTGAAGAGGAGGACGTGCACGTCCTCCTCTTCACCT0.376000.346400.551700.500001.000001.00000


Target Position: 1475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1475CCCAUCUCUCAUCCCUUUU68.22611408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1941493CCCATCTCTCATCCCTTTTAAAAGGGATGAGAGATGGG0.629500.118000.991401.000001.000001.00000


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741GGACGAGGAUGAGGAGGAG77.7286768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491759GGACGAGGATGAGGAGGAGCTCCTCCTCATCCTCGTCC0.750700.439000.560300.750001.000001.00000


Target Position: 717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717UGCUCAGGUAGUGGAAGAC60.90531871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
772735TGCTCAGGTAGTGGAAGACGTCTTCCACTACCTGAGCA0.329300.002600.534500.500001.000001.00000


Target Position: 692, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
692AGGAUGAGGAGGAGUAUGA82.3042474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
567710AGGATGAGGAGGAGTATGATCATACTCCTCCTCATCCT0.137000.116200.620700.500001.000001.00000


Target Position: 1852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1852ACGCAAAAUUGUAUUUUCU76.843824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7081870ACGCAAAATTGTATTTTCTAGAAAATACAATTTTGCGT0.047100.037800.551700.500001.000001.00000


Target Position: 1309, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1309CUCAGUUUGGUUACUCAAU77.4811780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7421327CTCAGTTTGGTTACTCAATATTGAGTAACCAAACTGAG0.067500.003800.801700.750000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1307-1329GTCTCAGTTTGGTTACTCAATGCAUUGAGUAACCAAACUGAGACCUCAGUUUGGUUACUCAAUGCU20.319.233


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928UAACCUAUUUUGAAAAAUU80.1148612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
613946TAACCTATTTTGAAAAATTAATTTTTCAAAATAGGTTA0.161000.051100.525900.500001.000001.00000


Target Position: 1815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1815GGUUUUUUUUUUCAUACAC73.36351065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941833GGTTTTTTTTTTCATACACGTGTATGAAAAAAAAAACC0.214100.053400.560300.750001.000001.00000


Target Position: 1842, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1842GGAAAAACUAACGCAAAAU82.3604470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1401860GGAAAAACTAACGCAAAATATTTTGCGTTAGTTTTTCC0.545000.274200.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1840-1862ACGGAAAAACTAACGCAAAATTGAUUUUGCGUUAGUUUUUCCGUGGAAAAACUAACGCAAAAUUGU20.68.733


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126GCCACUCUUUAUUUUUUUC70.18251278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1591144GCCACTCTTTATTTTTTTCGAAAAAAATAAAGAGTGGC0.924900.291200.827600.750001.000001.00000


Target Position: 72, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
72GGUUGAGCCUUCAAAGUCC76.2968861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
81390GGTTGAGCCTTCAAAGTCCGGACTTTGAAGGCTCAACC0.091100.001400.482800.500000.972800.75000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489AGAGCCACUGAAAAAGUUA86.0905292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
607507AGAGCCACTGAAAAAGTTATAACTTTTTCAGTGGCTCT0.352700.010700.689700.750001.000001.00000


Target Position: 1986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1986CUGUAUAAAAGAACAUCUG73.01351084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6842004CTGTATAAAAGAACATCTGCAGATGTTCTTTTATACAG0.102000.056200.500000.500001.000001.00000


Target Position: 2443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2443UUUAUAAAACAAAUUAUUU71.86071172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682461TTTATAAAACAAATTATTTAAATAATTTGTTTTATAAA0.230800.056200.500000.500001.000001.00000


Target Position: 482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482GCACAAUAGAGCCACUGAA94.938751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777500GCACAATAGAGCCACTGAATTCAGTGGCTCTATTGTGC0.026400.009400.681001.000000.962000.62500


Target Position: 2433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2433CUCAGGAAUGUUUAUAAAA89.8847152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652451CTCAGGAATGTTTATAAAATTTTATAAACATTCCTGAG0.147500.023100.810300.750001.000001.00000


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926AAUAACCUAUUUUGAAAAA81.9285493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
642944AATAACCTATTTTGAAAAATTTTTCAAAATAGGTTATT0.146800.065100.508600.500001.000001.00000


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904GGAGAAGAUGAUGACUAAG81.0934547

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341922GGAGAAGATGATGACTAAGCTTAGTCATCATCTTCTCC0.211400.196500.732800.750001.000001.00000


Target Position: 1974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974CCCAUGUUUCAUCUGUAUA87.6222233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2301992CCCATGTTTCATCTGTATATATACAGATGAAACATGGG0.434700.092200.948301.000001.000001.00000


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180AGCUUCAUUUUUGUUACCU67.0171490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7672198AGCTTCATTTTTGTTACCTAGGTAACAAAAATGAAGCT0.038800.003700.508600.500001.000001.00000


Target Position: 244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
244GACAACAGUCGGUCGAAUG74.17021017

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807262GACAACAGTCGGTCGAATGCATTCGACCGACTGTTGTC0.020600.001600.663800.500000.923900.62500


Target Position: 909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
909AGAUGAUGACUAAGUGGAA96.783725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
558927AGATGATGACTAAGTGGAATTCCACTTAGTCATCATCT0.092700.094100.551700.750001.000001.00000


Target Position: 451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
451AAUUUAAGUGGCAACAAAA91.3143113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797469AATTTAAGTGGCAACAAAATTTTGTTGCCACTTAAATT0.186200.020400.508600.500001.000001.00000


Target Position: 931, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
931CCUAUUUUGAAAAAUUCCU70.44171259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
702949CCTATTTTGAAAAATTCCTAGGAATTTTTCAAAATAGG0.192900.073800.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
929-951AACCTATTTTGAAAAATTCCTATAGGAAUUUUUCAAAAUAGGUUCCUAUUUUGAAAAAUUCCUAUU14.2-4.322


Target Position: 1101, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101GGUGGAAUAAAAUACUAUU93.235675

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7110119GGTGGAATAAAATACTATT1/1/0/093.97ANP32ANM_006305.31NANANA15:69072222..69072240(-)00ANP32A(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7211119GGTGGAATAAAATACTATTAATAGTATTTTATTCCACC0.100000.004900.844801.000001.000001.00000


Target Position: 996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
996CCAAUCCUGCCCCCUGAAA73.30221072

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1241014CCAATCCTGCCCCCTGAAATTTCAGGGGGCAGGATTGG0.590500.501800.844801.000001.000001.00000


Target Position: 860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
860AAGAAGAAAGGGGUCAGAA82.057484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811878AAGAAGAAAGGGGTCAGAATTCTGACCCCTTTCTTCTT0.113600.072600.465500.500001.000001.00000


Target Position: 750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
750UGAGGAGGAGGAAGGUGAA83.7154401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
527768TGAGGAGGAGGAAGGTGAATTCACCTTCCTCCTCCTCA0.796800.612500.551700.750001.000001.00000


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162GUCCGGUUUUUGUCCCUGU72.31271140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271180GTCCGGTTTTTGTCCCTGTACAGGGACAAAAACCGGAC0.179000.047300.612100.500000.907600.87500


Target Position: 1444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1444GGCGUAUUUUGGCACUGGU78.4224731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7311462GGCGTATTTTGGCACTGGTACCAGTGCCAAAATACGCC0.062800.004100.646600.750000.972800.62500


Target Position: 777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777CGUGAGUGGAGAGGAGGAG66.37741534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828795CGTGAGTGGAGAGGAGGAGCTCCTCCTCTCCACTCACG0.899200.615100.465500.750001.000001.00000


Target Position: 411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
411GGAAGUAUUGGCAGAAAAG80.9065555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
748429GGAAGTATTGGCAGAAAAGCTTTTCTGCCAATACTTCC0.034000.020700.732800.750001.000001.00000


Target Position: 1593, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593GUUAAGUUACAAGGAAAAU76.9114818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051611GTTAAGTTACAAGGAAAATATTTTCCTTGTAACTTAAC0.180600.019300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1591-1613GTGTTAAGTTACAAGGAAAATGGAUUUUCCUUGUAACUUAACACGUUAAGUUACAAGGAAAAUGGU18.74.922


Target Position: 454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
454UUAAGUGGCAACAAAAUUA78.5766722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
711472TTAAGTGGCAACAAAATTATAATTTTGTTGCCACTTAA0.818400.017000.500000.500001.000001.00000


Target Position: 151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
151UGCAGAGAGAGAGCGCGAG57.60542006

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761169TGCAGAGAGAGAGCGCGAGCTCGCGCTCTCTCTCTGCA0.031100.006700.543100.500000.967400.75000


Target Position: 585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585CCUCCCGCAACUCACAUAU72.97241089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
657603CCTCCCGCAACTCACATATATATGTGAGTTGCGGGAGG0.068300.007800.801701.000001.000001.00000


Target Position: 1682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1682UCCUAUCUUGUUCUGUAAA77.7582764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6611700TCCTATCTTGTTCTGTAAATTTACAGAACAAGATAGGA0.058400.053700.870700.750001.000001.00000


Target Position: 1426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426UGUAAAUAGCAACCUAAAG66.57141517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7641444TGTAAATAGCAACCTAAAGCTTTAGGTTGCTATTTACA0.030700.004300.569000.500000.983700.87500


Target Position: 922, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
922GUGGAAUAACCUAUUUUGA86.0989291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
631940GTGGAATAACCTATTTTGATCAAAATAGGTTATTCCAC0.393100.009300.569000.500000.962000.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
920-942AAGTGGAATAACCTATTTTGAAAUCAAAAUAGGUUAUUCCACUUGUGGAAUAACCUAUUUUGAAAU-1.421.222


Target Position: 960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960GACUGUUUUUACCCAUAUC78.9489686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
742978GACTGTTTTTACCCATATCGATATGGGTAAAAACAGTC0.429900.293000.637900.500001.000001.00000


Target Position: 1245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245GAGUUCUCUUACGUUUCCU77.8493762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8221263GAGTTCTCTTACGTTTCCTAGGAAACGTAAGAGAACTC0.146100.023600.465500.500001.000001.00000


Target Position: 2299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2299UCCUUUAAAAAAGUUACAG55.03422100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5682317TCCTTTAAAAAAGTTACAGCTGTAACTTTTTTAAAGGA0.153700.073400.586200.500001.000001.00000


Target Position: 431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
431GUCCGAACCUCACGCAUCU78.0005754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460449GTCCGAACCTCACGCATCTAGATGCGTGAGGTTCGGAC0.396800.076000.594800.500001.000001.00000


Target Position: 2026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2026UCAGAAGAGCCAAACUUUG62.9151758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322044TCAGAAGAGCCAAACTTTGCAAAGTTTGGCTCTTCTGA0.099700.004100.577600.500001.000001.00000


Target Position: 161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
161GAGCGCGAGAGAUGGAGAU79.5652647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
699179GAGCGCGAGAGATGGAGATATCTCCATCTCTCGCGCTC0.214800.005700.629300.750001.000001.00000


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729GGAAGACGAGGAGGACGAG74.498995

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501747GGAAGACGAGGAGGACGAGCTCGTCCTCCTCGTCTTCC0.434400.249200.560300.750001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590CGCAACUCACAUAUCUCGA83.1515431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
654608CGCAACTCACATATCTCGATCGAGATATGTGAGTTGCG0.060400.018200.629300.750001.000001.00000


Target Position: 1433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433AGCAACCUAAAGGCGUAUU61.86321809

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8131451AGCAACCTAAAGGCGTATTAATACGCCTTTAGGTTGCT0.017200.001700.844800.750000.929301.00000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210AGCAUUUGUUCCUGACUCU78.4468728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5581228AGCATTTGTTCCTGACTCTAGAGTCAGGAACAAATGCT0.170800.014900.629300.500001.000001.00000


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094GGGUGGGGGUGGAAUAAAA95.283447

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201112GGGTGGGGGTGGAATAAAATTTTATTCCACCCCCACCC0.138500.001300.991401.000001.000001.00000


Target Position: 1955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1955GUGACGUGUAAUUUCUGAA91.2511114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6871973GTGACGTGTAATTTCTGAATTCAGAAATTACACGTCAC0.306000.006300.620700.750001.000001.00000


Target Position: 2426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426UUGAAAACUCAGGAAUGUU68.74641370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6882444TTGAAAACTCAGGAATGTTAACATTCCTGAGTTTTCAA0.075000.022000.500000.500001.000001.00000


Target Position: 2361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2361CCUUGGAACCUUGUUUUGA78.5507724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6052379CCTTGGAACCTTGTTTTGATCAAAACAAGGTTCCAAGG0.168200.010800.620700.750001.000001.00000


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491AGCCACUGAAAAAGUUAGA73.26831073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773509AGCCACTGAAAAAGTTAGATCTAACTTTTTCAGTGGCT0.317700.024900.629300.500001.000001.00000


Target Position: 2207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2207AGCUUUUCUUAUGAGAUAU80.8499558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7102225AGCTTTTCTTATGAGATATATATCTCATAAGAAAAGCT0.046800.008600.810300.750001.000001.00000


Target Position: 1238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238UGGUUUGGAGUUCUCUUAC61.88151808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051256TGGTTTGGAGTTCTCTTACGTAAGAGAACTCCAAACCA0.191500.015300.663800.500001.000001.00000


Target Position: 2442, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2442GUUUAUAAAACAAAUUAUU81.7701503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4092460GTTTATAAAACAAATTATTAATAATTTGTTTTATAAAC0.173200.033100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2440-2462ATGTTTATAAAACAAATTATTTCAAUAAUUUGUUUUAUAAACAUGUUUAUAAAACAAAUUAUUUCU-10.3-7.511


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780GAGUGGAGAGGAGGAGGAG73.32051069

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
749798GAGTGGAGAGGAGGAGGAGCTCCTCCTCCTCTCCACTC0.925200.634400.500000.500001.000001.00000


Target Position: 1164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1164CCGGUUUUUGUCCCUGUAA79.7692637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981182CCGGTTTTTGTCCCTGTAATTACAGGGACAAAAACCGG0.120800.023700.879301.000000.907600.75000


Target Position: 2384, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2384CUUUCAUUGUUUUGUUUGU74.5151994

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2382-2404ATCTTTCATTGTTTTGTTTGTCGACAAACAAAACAAUGAAAGAUCUUUCAUUGUUUUGUUUGUCGU12.27.412


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055GGGGAAGAGUGUACUGGGG66.91411495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6961073GGGGAAGAGTGTACTGGGGCCCCAGTACACTCTTCCCC0.111700.030900.500000.500001.000001.00000


Target Position: 2331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2331ACAAGUACCCAAACAAUCA85.0082342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7742349ACAAGTACCCAAACAATCATGATTGTTTGGGTACTTGT0.082500.020900.482800.500001.000001.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476CCAUCUCUCAUCCCUUUUC66.86541498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2331494CCATCTCTCATCCCTTTTCGAAAAGGGATGAGAGATGG0.518600.300500.672400.750001.000001.00000


Target Position: 1639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1639CACACCUUCAAACUUCAAC64.99421620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7171657CACACCTTCAAACTTCAACGTTGAAGTTTGAAGGTGTG0.844200.149400.646600.500001.000001.00000


Target Position: 2146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2146GAUGCAUUCCAGAUGAACU90.1997136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952164GATGCATTCCAGATGAACTAGTTCATCTGGAATGCATC0.041800.011800.474100.500000.978300.62500


Target Position: 1788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1788GCUGGAGACGUUGCUGCAU77.1808795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8231806GCTGGAGACGTTGCTGCATATGCAGCAACGTCTCCAGC0.077300.001200.698301.000001.000001.00000


Target Position: 1127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127CCACUCUUUAUUUUUUUCC56.70952041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981145CCACTCTTTATTTTTTTCCGGAAAAAAATAAAGAGTGG0.759900.251800.474100.500001.000001.00000


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669CCUGGAUGAUGAGGAGGAG72.11731153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
580687CCTGGATGATGAGGAGGAGCTCCTCCTCATCATCCAGG0.602300.455300.534500.750000.994600.62500


Target Position: 2313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2313UACAGAGUUACUAAAAAAA84.4953373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8242331TACAGAGTTACTAAAAAAATTTTTTTAGTAACTCTGTA0.451400.198200.681000.500001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885ACGAGAACCUGAAGAUGAG74.4869996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819903ACGAGAACCTGAAGATGAGCTCATCTTCAGGTTCTCGT0.118400.006900.465500.500001.000001.00000


Target Position: 78, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
78GCCUUCAAAGUCCUAAAAC66.2741539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
37196GCCTTCAAAGTCCTAAAACGTTTTAGGACTTTGAAGGC0.218200.062200.853400.750001.000001.00000


Target Position: 923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
923UGGAAUAACCUAUUUUGAA85.1628337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503941TGGAATAACCTATTTTGAATTCAAAATAGGTTATTCCA0.409000.019400.672400.750000.962000.75000


Target Position: 694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694GAUGAGGAGGAGUAUGAUG80.6395571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
604712GATGAGGAGGAGTATGATGCATCATACTCCTCCTCATC0.135300.110200.525900.500001.000001.00000


Target Position: 1214, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1214UUUGUUCCUGACUCUCAAA77.5984777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7011232TTTGTTCCTGACTCTCAAATTTGAGAGTCAGGAACAAA0.066400.007500.500000.500001.000001.00000


Target Position: 298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
298GAACUGGAAUUCUUAAGUA101.4835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
758316GAACTGGAATTCTTAAGTATACTTAAGAATTCCAGTTC0.083200.018600.491400.750001.000001.00000


Target Position: 79, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
79CCUUCAAAGUCCUAAAACG75.7556901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
52697CCTTCAAAGTCCTAAAACGCGTTTTAGGACTTTGAAGG0.181000.025500.569000.500001.000001.00000


Target Position: 2034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2034GCCAAACUUUGAGUUUUAU80.562579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6212052GCCAAACTTTGAGTTTTATATAAAACTCAAAGTTTGGC0.090100.009900.956901.000000.956500.75000


Target Position: 2218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2218UGAGAUAUAUAUAAUGUGA90.8737123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6772236TGAGATATATATAATGTGATCACATTATATATATCTCA0.256000.019500.500000.500001.000001.00000


Target Position: 252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
252UCGGUCGAAUGAAGGCAAA71.37371205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
834270TCGGTCGAATGAAGGCAAATTTGCCTTCATTCGACCGA0.026600.001100.793100.750001.000001.00000


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988CCCCCCCUCCAAUCCUGCC45.00192357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7541006CCCCCCCTCCAATCCTGCCGGCAGGATTGGAGGGGGGG0.760100.727900.491400.500001.000001.00000


Target Position: 154, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
154AGAGAGAGAGCGCGAGAGA82.6054459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
814172AGAGAGAGAGCGCGAGAGATCTCTCGCGCTCTCTCTCT0.055300.008600.500000.500001.000001.00000


Target Position: 1968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1968UCUGAACCCAUGUUUCAUC60.81011876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5501986TCTGAACCCATGTTTCATCGATGAAACATGGGTTCAGA0.218500.034600.543100.500001.000001.00000


Target Position: 2236, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2236AUACUAUGUUUGGAUAUUU80.1522609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6992254ATACTATGTTTGGATATTTAAATATCCAAACATAGTAT0.070600.018600.543100.500001.000001.00000


Target Position: 1848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRan