Input target sequence

Length: 2091
GAGCGGAGCCGCGGGCGGGAGGGCGGACGGACCGACTGACGGTAGGGACGGGAGGCGAGCAAGATGGCGCAGACGCAGGGCACCCGGAGGAAAGTCTGTTACTACTACGACGGGGATGTTGGAAATTACTATTATGGACAAGGCCACCCAATGAAGCCTCACCGAATCCGCATGACTCATAATTTGCTGCTCAACTATGGTCTCTACCGAAAAATGGAAATCTATCGCCCTCACAAAGCCAATGCTGAGGAGATGACCAAGTACCACAGCGATGACTACATTAAATTCTTGCGCTCCATCCGTCCAGATAACATGTCGGAGTACAGCAAGCAGATGCAGAGATTCAACGTTGGTGAGGACTGTCCAGTATTCGATGGCCTGTTTGAGTTCTGTCAGTTGTCTACTGGTGGTTCTGTGGCAAGTGCTGTGAAACTTAATAAGCAGCAGACGGACATCGCTGTGAATTGGGCTGGGGGCCTGCACCATGCAAAGAAGTCCGAGGCATCTGGCTTCTGTTACGTCAATGATATCGTCTTGGCCATCCTGGAACTGCTAAAGTATCACCAGAGGGTGCTGTACATTGACATTGATATTCACCATGGTGACGGCGTGGAAGAGGCCTTCTACACCACGGACCGGGTCATGACTGTGTCCTTTCATAAGTATGGAGAGTACTTCCCAGGAACTGGGGACCTACGGGATATCGGGGCTGGCAAAGGCAAGTATTATGCTGTTAACTACCCGCTCCGAGACGGGATTGATGACGAGTCCTATGAGGCCATTTTCAAGCCGGTCATGTCCAAAGTAATGGAGATGTTCCAGCCTAGTGCGGTGGTCTTACAGTGTGGCTCAGACTCCCTATCTGGGGATCGGTTAGGTTGCTTCAATCTAACTATCAAAGGACACGCCAAGTGTGTGGAATTTGTCAAGAGCTTTAACCTGCCTATGCTGATGCTGGGAGGCGGTGGTTACACCATTCGTAACGTTGCCCGGTGCTGGACATATGAGACAGCTGTGGCCCTGGATACGGAGATCCCTAATGAGCTTCCATACAATGACTACTTTGAATACTTTGGACCAGATTTCAAGCTCCACATCAGTCCTTCCAATATGACTAACCAGAACACGAATGAGTACCTGGAGAAGATCAAACAGCGACTGTTTGAGAACCTTAGAATGCTGCCGCACGCACCTGGGGTCCAAATGCAGGCGATTCCTGAGGACGCCATCCCTGAGGAGAGTGGCGATGAGGACGAAGACGACCCTGACAAGCGCATCTCGATCTGCTCCTCTGACAAACGAATTGCCTGTGAGGAAGAGTTCTCCGATTCTGAAGAGGAGGGAGAGGGGGGCCGCAAGAACTCTTCCAACTTCAAAAAAGCCAAGAGAGTCAAAACAGAGGATGAAAAAGAGAAAGACCCAGAGGAGAAGAAAGAAGTCACCGAAGAGGAGAAAACCAAGGAGGAGAAGCCAGAAGCCAAAGGGGTCAAGGAGGAGGTCAAGTTGGCCTGAATGGACCTCTCCAGCTCTGGCTTCCTGCTGAGTCCCTCACGTTTCTTCCCCAACCCCTCAGATTTTATATTTTCTATTTCTCTGTGTATTTATATAAAAATTTATTAAATATAAATATCCCCAGGGACAGAAACCAAGGCCCCGAGCTCAGGGCAGCTGTGCTGGGTGAGCTCTTCCAGGAGCCACCTTGCCACCCATTCTTCCCGTTCTTAACTTTGAACCATAAAGGGTGCCAGGTCTGGGTGAAAGGGATACTTTTATGCAACCATAAGACAAACTCCTGAAATGCCAAGTGCCTGCTTAGTAGCTTTGGAAAGGTGCCCTTATTGAACATTCTAGAAGGGGTGGCTGGGTCTTCAAGGATCTCCTGTTTTTTTCAGGCTCCTAAAGTAACATCAGCCATTTTTAGATTGGTTCTGTTTTCGTACCTTCCCACTGGCCTCAAGTGAGCCAAGAAACACTGCCTGCCCTCTGTCTGTCTTCTCCTAATTCTGCAGGTGGAGGTTGCTAGTCTAGTTTCCTTTTTGAGATACTATTTTCATTTTTGTGAGCCTCTTTGTAATAAAATGGTACATTTCT