siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs 267   710   1560  
Biltr, Ernai 293   791   1753   1755  
Biltr, Ernai, Rnaxs, Sidirect 2039  
Biltr, Ernai, Sidirect 1754   2071  
Biltr, Sidirect 271   425   873   1049   1359   1721   1767   2065  
Biltr, Rnaxs 36   40   41   44   45   46   47   48   49   50   54   55   56   83   84   85   86   87   88   90  
106   107   108   109   110   111   112   113   115   116   117   118   120   121   122   137   138   143   156   165  
166   167   168   170   174   175   176   177   180   185   186   187   188   189   199   202   203   204   206   216  
217   219   243   244   245   246   248   249   250   255   256   257   263   264   265   266   268   269   270   272  
273   296   299   311   312   315   316   317   318   326   327   329   330   333   336   337   338   339   367   395  
398   403   404   412   413   414   415   416   417   420   421   422   423   424   446   447   448   449   499   500  
501   509   511   512   513   518   519   538   539   540   542   543   544   545   565   566   567   568   569   570  
571   572   573   575   578   582   583   653   656   657   688   689   698   699   707   708   709   711   712   713  
717   718   719   720   722   755   756   763   764   765   766   767   768   769   771   821   822   823   824   826  
833   834   835   836   867   869   870   876   877   878   880   893   908   911   912   913   914   917   918   919  
920   928   929   965   992   993   994   1017   1028   1029   1030   1033   1034   1035   1036   1037   1038   1042   1043   1044  
1046   1047   1048   1051   1052   1053   1055   1056   1057   1065   1066   1067   1070   1071   1076   1077   1078   1079   1080   1087  
1088   1089   1090   1091   1092   1100   1101   1102   1106   1107   1112   1113   1114   1118   1119   1125   1126   1127   1128   1130  
1140   1141   1142   1157   1158   1159   1160   1161   1195   1196   1197   1229   1231   1232   1240   1243   1244   1245   1252   1253  
1254   1262   1264   1265   1274   1277   1278   1279   1280   1287   1288   1360   1361   1362   1373   1377   1378   1380   1381   1382  
1386   1387   1388   1389   1390   1391   1396   1397   1398   1399   1400   1401   1411   1412   1413   1415   1416   1417   1418   1419  
1420   1421   1423   1424   1425   1428   1430   1436   1438   1439   1441   1442   1443   1448   1449   1450   1451   1452   1456   1457  
1458   1462   1463   1464   1465   1470   1471   1472   1476   1477   1478   1483   1484   1485   1486   1487   1521   1538   1539   1540  
1542   1546   1547   1548   1559   1561   1562   1563   1564   1565   1566   1567   1568   1570   1572   1584   1585   1587   1588   1590  
1591   1592   1593   1595   1597   1599   1600   1601   1602   1603   1604   1605   1606   1607   1608   1609   1610   1612   1630   1631  
1694   1695   1696   1697   1698   1701   1702   1703   1704   1705   1706   1708   1710   1711   1712   1714   1719   1742   1744   1773  
1774   1777   1779   1780   1781   1786   1793   1823   1824   1825   1833   1850   1851   1853   1881   1887   1889   1890   1891   1892  
1897   1898   1899   1900   1901   1905   1906   1916   1917   1926   1952   1953   1954   1971   1973   1974   1975   1976   1977   1978  
1979   1980   1981   1982   1983   1984   1985   1986   1987   1988   1990   2011   2013   2014   2015   2017   2018   2019   2022   2023  
2024   2026   2030   2031   2037   2038   2040   2041   2044   2051   2052   2056   2057   2058   2059   2060   2061   2062   2063   2064  
Biltr, Rnaxs, Sidirect 89   114   207   574   576   770   881   882   1392   1569   1571   1573   1586   1594   1596   1598   1707   1834   1835   1902  
1921   2020   2025   2032   2033  


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397CAGAGGAUGAAAAAGAGAA93.313752

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3041415CAGAGGATGAAAAAGAGAATTCTCTTTTTCATCCTCTG0.959300.484400.612100.750001.000001.00000


Target Position: 111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
111CGGGGAUGUUGGAAAUUAC80.7612429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
279129CGGGGATGTTGGAAATTACGTAATTTCCAACATCCCCG0.368400.016800.732800.750001.000001.00000


Target Position: 1195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1195GGGGUCCAAAUGCAGGCGA69.09661050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701213GGGGTCCAAATGCAGGCGATCGCCTGCATTTGGACCCC0.065600.002100.698300.750000.962000.87500


Target Position: 2024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2024UCUAGUUUCCUUUUUGAGA72.8115844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5062042TCTAGTTTCCTTTTTGAGATCTCAAAAAGGAAACTAGA0.109900.001400.500000.500001.000001.00000


Target Position: 219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
219AAUCUAUCGCCCUCACAAA89.1189114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
423237AATCTATCGCCCTCACAAATTTGTGAGGGCGATAGATT0.162500.064100.508600.500000.945700.62500


Target Position: 249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
249GGAGAUGACCAAGUACCAC76.3269637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325267GGAGATGACCAAGTACCACGTGGTACTTGGTCATCTCC0.439400.056200.577600.750001.000001.00000


Target Position: 1052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1052ACAAUGACUACUUUGAAUA85.2898247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2391070ACAATGACTACTTTGAATATATTCAAAGTAGTCATTGT0.344200.293200.663800.750001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591UCUCUGUGUAUUUAUAUAA85.4479241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201609TCTCTGTGTATTTATATAATTATATAAATACACAGAGA0.044000.003900.689700.750001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765CGAGUCCUAUGAGGCCAUU75.563684

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476783CGAGTCCTATGAGGCCATTAATGGCCTCATAGGACTCG0.023900.004700.784501.000000.934800.62500


Target Position: 188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
188UGCUCAACUAUGGUCUCUA83.363304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501206TGCTCAACTATGGTCTCTATAGAGACCATAGTTGAGCA0.018300.010600.681000.750001.000001.00000


Target Position: 1288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1288UCCUCUGACAAACGAAUUG57.00881688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3521306TCCTCTGACAAACGAATTGCAATTCGTTTGTCAGAGGA0.226900.012900.724100.500001.000001.00000


Target Position: 919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
919GAAUUUGUCAAGAGCUUUA93.958548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
253937GAATTTGTCAAGAGCTTTATAAAGCTCTTGACAAATTC0.341000.125600.637900.750001.000001.00000


Target Position: 574, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
574CUGUACAUUGACAUUGAUA91.825667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
128592CTGTACATTGACATTGATATATCAATGTCAATGTACAG0.280100.084000.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
572-594TGCTGTACATTGACATTGATATTUAUCAAUGUCAAUGUACAGCACUGUACAUUGACAUUGAUAUUU13.620.420


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471CCAGAAGCCAAAGGGGUCA70.8712953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731489CCAGAAGCCAAAGGGGTCATGACCCCTTTGGCTTCTGG0.024000.007900.620700.750001.000001.00000


Target Position: 1774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1774GCAACCAUAAGACAAACUC67.68231119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701792GCAACCATAAGACAAACTCGAGTTTGTCTTATGGTTGC0.352800.035900.543100.750001.000001.00000


Target Position: 1400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1400AGGAUGAAAAAGAGAAAGA80.9822412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291418AGGATGAAAAAGAGAAAGATCTTTCTCTTTTTCATCCT0.807000.559800.620700.500001.000001.00000


Target Position: 1102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102CCUUCCAAUAUGACUAACC64.23251328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821120CCTTCCAATATGACTAACCGGTTAGTCATATTGGAAGG0.071800.043200.491400.500001.000001.00000


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771CUAUGAGGCCAUUUUCAAG78.2832538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468789CTATGAGGCCATTTTCAAGCTTGAAAATGGCCTCATAG0.060600.003400.534500.500001.000001.00000


Target Position: 1112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1112UGACUAACCAGAACACGAA87.4607171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621130TGACTAACCAGAACACGAATTCGTGTTCTGGTTAGTCA0.192100.029200.551700.750001.000001.00000


Target Position: 293, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
293GCUCCAUCCGUCCAGAUAA92.305457

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_529319GCTCCATCCGTCCAGATAA1/1/0/094.96HDAC1NM_004964.21NANANA1:32782333..32782351(+)00HDAC1(0.002)


Target Position: 422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422GUGCUGUGAAACUUAAUAA94.292442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
256440GTGCTGTGAAACTTAATAATTATTAAGTTTCACAGCAC0.340700.020700.758600.750001.000001.00000


Target Position: 1090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090CUCCACAUCAGUCCUUCCA73.858774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261108CTCCACATCAGTCCTTCCATGGAAGGACTGATGTGGAG0.101400.054800.465500.500001.000001.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411GAGAAAGACCCAGAGGAGA82.7938324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3681429GAGAAAGACCCAGAGGAGATCTCCTCTGGGTCTTTCTC0.427900.224300.586200.500001.000001.00000


Target Position: 1484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1484GGGUCAAGGAGGAGGUCAA94.290443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811502GGGTCAAGGAGGAGGTCAATTGACCTCCTCCTTGACCC0.045000.001900.844801.000001.000001.00000


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140GGAGAAGAUCAAACAGCGA91.642470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161158GGAGAAGATCAAACAGCGATCGCTGTTTGATCTTCTCC0.042500.029000.577600.750001.000001.00000


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119CCAGAACACGAAUGAGUAC75.0229715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981137CCAGAACACGAATGAGTACGTACTCATTCGTGTTCTGG0.180900.037100.663800.750001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769UCCUAUGAGGCCAUUUUCA73.5814799

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342787TCCTATGAGGCCATTTTCATGAAAATGGCCTCATAGGA0.450300.010000.646600.500000.956500.62500


Target Position: 914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
914GUGUGGAAUUUGUCAAGAG81.5703380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489932GTGTGGAATTTGTCAAGAGCTCTTGACAAATTCCACAC0.147600.018800.482800.500001.000001.00000


Target Position: 1833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1833CCCUUAUUGAACAUUCUAG75.3867695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3331851CCCTTATTGAACATTCTAGCTAGAATGTTCAATAAGGG0.084500.010900.819000.750001.000001.00000


Target Position: 1483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1483GGGGUCAAGGAGGAGGUCA76.548624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901501GGGGTCAAGGAGGAGGTCATGACCTCCTCCTTGACCCC0.051200.001800.767200.750001.000001.00000


Target Position: 1114, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1114ACUAACCAGAACACGAAUG58.91941592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821132ACTAACCAGAACACGAATGCATTCGTGTTCTGGTTAGT0.171200.066100.551700.500001.000001.00000


Target Position: 1391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391UCAAAACAGAGGAUGAAAA81.118406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2811409TCAAAACAGAGGATGAAAATTTTCATCCTCTGTTTTGA0.548400.456400.724100.750001.000001.00000


Target Position: 296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
296CCAUCCGUCCAGAUAACAU85.2557248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182314CCATCCGTCCAGATAACATATGTTATCTGGACGGATGG0.198700.042500.689701.000000.902200.62500


Target Position: 578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
578ACAUUGACAUUGAUAUUCA92.245958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486596ACATTGACATTGATATTCATGAATATCAATGTCAATGT0.102800.036400.482800.500001.000001.00000


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317CGGAGUACAGCAAGCAGAU85.8536229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379335CGGAGTACAGCAAGCAGATATCTGCTTGCTGTACTCCG0.139300.005900.732801.000000.994600.87500


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893CUAUCAAAGGACACGCCAA91.923763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520911CTATCAAAGGACACGCCAATTGGCGTGTCCTTTGATAG0.013900.006400.525900.750000.983700.62500


Target Position: 1362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1362CUCUUCCAACUUCAAAAAA79.6986468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041380CTCTTCCAACTTCAAAAAATTTTTTGAAGTTGGAAGAG0.175500.004400.810300.750001.000001.00000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766GAGUCCUAUGAGGCCAUUU78.8307505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
387784GAGTCCTATGAGGCCATTTAAATGGCCTCATAGGACTC0.056100.006000.810300.750000.934800.75000


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327CAAGCAGAUGCAGAGAUUC72.5264864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505345CAAGCAGATGCAGAGATTCGAATCTCTGCATCTGCTTG0.189200.030000.474100.500000.972800.87500


Target Position: 187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
187CUGCUCAACUAUGGUCUCU71.9741892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513205CTGCTCAACTATGGTCTCTAGAGACCATAGTTGAGCAG0.015000.008800.560300.500001.000001.00000


Target Position: 1253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1253ACGAAGACGACCCUGACAA78.9301500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711271ACGAAGACGACCCTGACAATTGTCAGGGTCGTCTTCGT0.127000.019300.629300.750001.000001.00000


Target Position: 413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413CUGUGGCAAGUGCUGUGAA88.5402130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509431CTGTGGCAAGTGCTGTGAATTCACAGCACTTGCCACAG0.169500.001400.612100.750000.983701.00000


Target Position: 1418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1418ACCCAGAGGAGAAGAAAGA74.1278766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881436ACCCAGAGGAGAAGAAAGATCTTTCTTCTCCTCTGGGT0.761700.302300.629300.500001.000001.00000


Target Position: 1983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1983UCUGUCUGUCUUCUCCUAA77.8471564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2342001TCTGTCTGTCTTCTCCTAATTAGGAGAAGACAGACAGA0.543700.203600.689700.750001.000001.00000


Target Position: 1436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1436AAGUCACCGAAGAGGAGAA86.4514210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5231454AAGTCACCGAAGAGGAGAATTCTCCTCTTCGGTGACTT0.067500.014100.465500.500000.907600.62500


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582UGACAUUGAUAUUCACCAU85.1649251

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462600TGACATTGATATTCACCATATGGTGAATATCAATGTCA0.027600.022200.569000.750001.000001.00000


Target Position: 403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
403ACUGGUGGUUCUGUGGCAA79.5923473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
527421ACTGGTGGTTCTGTGGCAATTGCCACAGAACCACCAGT0.012100.001400.560300.750001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048CCAUACAAUGACUACUUUG77.2353596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1441066CCATACAATGACTACTTTGCAAAGTAGTCATTGTATGG0.360500.227000.698300.750001.000001.00000


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540CAUCCUGGAACUGCUAAAG68.05461100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451558CATCCTGGAACTGCTAAAGCTTTAGCAGTTCCAGGATG0.051900.016800.517200.500001.000001.00000


Target Position: 1443, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1443CGAAGAGGAGAAAACCAAG79.2742490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2361461CGAAGAGGAGAAAACCAAGCTTGGTTTTCTCCTCTTCG0.227000.027200.655200.750000.962000.87500


Target Position: 166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
166AUCCGCAUGACUCAUAAUU66.71551180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
382184ATCCGCATGACTCATAATTAATTATGAGTCATGCGGAT0.275200.029700.672400.500001.000001.00000


Target Position: 1386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1386GAGAGUCAAAACAGAGGAU87.727162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2641404GAGAGTCAAAACAGAGGATATCCTCTGTTTTGACTCTC0.475300.190200.629300.750001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420AAGUGCUGUGAAACUUAAU78.8151506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364438AAGTGCTGTGAAACTTAATATTAAGTTTCACAGCACTT0.369300.006800.629300.500001.000001.00000


Target Position: 120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
120UGGAAAUUACUAUUAUGGA81.9006367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504138TGGAAATTACTATTATGGATCCATAATAGTAATTTCCA0.082800.075300.474100.500001.000001.00000


Target Position: 2063, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2063GCCUCUUUGUAAUAAAAUG77.9377556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4222081GCCTCTTTGTAATAAAATGCATTTTATTACAAAGAGGC0.041500.030000.844800.750001.000001.00000


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255GACCAAGUACCACAGCGAU86.2721216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
277273GACCAAGTACCACAGCGATATCGCTGTGGTACTTGGTC0.113300.079500.637900.750001.000001.00000


Target Position: 189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
189GCUCAACUAUGGUCUCUAC83.7785285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503207GCTCAACTATGGTCTCTACGTAGAGACCATAGTTGAGC0.018000.006500.672400.750001.000001.00000


Target Position: 1588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588AUUUCUCUGUGUAUUUAUA89.847399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5131606ATTTCTCTGTGTATTTATATATAAATACACAGAGAAAT0.055000.006400.465500.500001.000001.00000


Target Position: 1891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1891AGGCUCCUAAAGUAACAUC65.45891248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711909AGGCTCCTAAAGTAACATCGATGTTACTTTAGGAGCCT0.321000.023100.663800.500001.000001.00000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160UGUUUGAGAACCUUAGAAU79.4142483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841178TGTTTGAGAACCTTAGAATATTCTAAGGTTCTCAAACA0.075000.001900.698300.750001.000001.00000


Target Position: 1028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028CGGAGAUCCCUAAUGAGCU81.5267383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3481046CGGAGATCCCTAATGAGCTAGCTCATTAGGGATCTCCG0.167200.031400.560300.750000.956500.75000


Target Position: 1981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1981CCUCUGUCUGUCUUCUCCU78.2454540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351999CCTCTGTCTGTCTTCTCCTAGGAGAAGACAGACAGAGG0.473700.205500.500000.750001.000001.00000


Target Position: 1101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101UCCUUCCAAUAUGACUAAC55.64581749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3281119TCCTTCCAATATGACTAACGTTAGTCATATTGGAAGGA0.086900.051200.724100.500001.000001.00000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826AGUGCGGUGGUCUUACAGU74.6367731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
507844AGTGCGGTGGTCTTACAGTACTGTAAGACCACCGCACT0.019500.001400.500000.500001.000001.00000


Target Position: 1029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1029GGAGAUCCCUAAUGAGCUU87.4885170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2471047GGAGATCCCTAATGAGCTTAAGCTCATTAGGGATCTCC0.131500.025500.732801.000000.956500.87500


Target Position: 84, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
84CCGGAGGAAAGUCUGUUAC63.72271355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302102CCGGAGGAAAGTCTGTTACGTAACAGACTTTCCTCCGG0.099500.028700.732800.750001.000001.00000


Target Position: 1457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1457CCAAGGAGGAGAAGCCAGA79.0837495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2951475CCAAGGAGGAGAAGCCAGATCTGGCTTCTCCTCCTTGG0.216200.055000.620700.750001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464GGAGAAGCCAGAAGCCAAA90.90983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2611482GGAGAAGCCAGAAGCCAAATTTGGCTTCTGGCTTCTCC0.123200.030500.870701.000000.907600.87500


Target Position: 929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
929AGAGCUUUAACCUGCCUAU79.9447462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438947AGAGCTTTAACCTGCCTATATAGGCAGGTTAAAGCTCT0.037100.003400.681000.750000.907600.62500


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593UCUGUGUAUUUAUAUAAAA87.632165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471611TCTGTGTATTTATATAAAATTTTATATAAATACACAGA0.058800.002800.724100.750001.000001.00000


Target Position: 1565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565ACCCCUCAGAUUUUAUAUU72.4028871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2021583ACCCCTCAGATTTTATATTAATATAAAATCTGAGGGGT0.461200.122100.844800.750001.000001.00000


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688GGGGACCUACGGGAUAUCG61.40771477

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505706GGGGACCTACGGGATATCGCGATATCCCGTAGGTCCCC0.036900.001400.698300.500001.000001.00000


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575UGUACAUUGACAUUGAUAU80.8773419

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199593TGTACATTGACATTGATATATATCAATGTCAATGTACA0.300200.088000.663800.750001.000001.00000


Target Position: 1229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1229UCCCUGAGGAGAGUGGCGA58.78821603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161247TCCCTGAGGAGAGTGGCGATCGCCACTCTCCTCAGGGA0.020200.001300.577600.500000.913000.62500


Target Position: 570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
570GGUGCUGUACAUUGACAUU90.755287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
411588GGTGCTGTACATTGACATTAATGTCAATGTACAGCACC0.196000.004200.844801.000001.000001.00000


Target Position: 89, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
89GGAAAGUCUGUUACUACUA95.51227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
160107GGAAAGTCTGTTACTACTATAGTAGTAACAGACTTTCC0.266700.093700.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
87-109GAGGAAAGTCTGTTACTACTACGUAGUAGUAACAGACUUUCCUCGGAAAGUCUGUUACUACUACGU18.821.510


Target Position: 1604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1604AUAUAAAAAUUUAUUAAAU89.1572113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011622ATATAAAAATTTATTAAATATTTAATAAATTTTTATAT0.077300.019700.534500.500001.000001.00000


Target Position: 1954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1954UCAAGUGAGCCAAGAAACA76.3276636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131972TCAAGTGAGCCAAGAAACATGTTTCTTGGCTCACTTGA0.189800.023700.517200.500001.000001.00000


Target Position: 2037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2037UUGAGAUACUAUUUUCAUU78.7583514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5222055TTGAGATACTATTTTCATTAATGAAAATAGTATCTCAA0.107800.005100.637900.500001.000001.00000


Target Position: 1767, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1767CUUUUAUGCAACCAUAAGA83.6358291

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1765-1787TACTTTTATGCAACCATAAGACAUCUUAUGGUUGCAUAAAAGUACUUUUAUGCAACCAUAAGACAU17.4-1.420


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107CAAUAUGACUAACCAGAAC79.4422480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371125CAATATGACTAACCAGAACGTTCTGGTTAGTCATATTG0.153900.050500.500000.500001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718GGCAAGUAUUAUGCUGUUA90.472592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484736GGCAAGTATTATGCTGTTATAACAGCATAATACTTGCC0.022700.005000.965501.000000.907600.62500


Target Position: 2061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2061GAGCCUCUUUGUAAUAAAA99.36917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2572079GAGCCTCTTTGTAATAAAATTTTATTACAAAGAGGCTC0.188700.112100.810300.750001.000001.00000


Target Position: 2040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2040AGAUACUAUUUUCAUUUUU79.6835470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3492058AGATACTATTTTCATTTTTAAAAATGAAAATAGTATCT0.075800.010200.724100.750001.000001.00000


Target Position: 1130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1130AUGAGUACCUGGAGAAGAU83.0105316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001148ATGAGTACCTGGAGAAGATATCTTCTCCAGGTACTCAT0.031400.010800.474100.500001.000001.00000


Target Position: 1274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1274GCAUCUCGAUCUGCUCCUC71.832905

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781292GCATCTCGATCTGCTCCTCGAGGAGCAGATCGAGATGC0.028700.002000.543100.750000.923900.62500


Target Position: 709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
709GCUGGCAAAGGCAAGUAUU78.8349504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
434727GCTGGCAAAGGCAAGTATTAATACTTGCCTTTGCCAGC0.038100.004300.844801.000000.967400.75000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413GAAAGACCCAGAGGAGAAG70.4376977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801431GAAAGACCCAGAGGAGAAGCTTCTCCTCTGGGTCTTTC0.421200.213500.534500.500001.000001.00000


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388GAGUCAAAACAGAGGAUGA97.252112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811406GAGTCAAAACAGAGGATGATCATCCTCTGTTTTGACTC0.490800.205700.586200.500001.000001.00000


Target Position: 511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511UUCUGUUACGUCAAUGAUA80.4997442

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
350529TTCTGTTACGTCAATGATATATCATTGACGTAACAGAA0.121800.009400.629300.500001.000001.00000


Target Position: 115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
115GAUGUUGGAAAUUACUAUU86.5035205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186133GATGTTGGAAATTACTATTAATAGTAATTTCCAACATC0.361900.068000.672400.750001.000001.00000


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720CAAGUAUUAUGCUGUUAAC82.6701328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471738CAAGTATTATGCTGTTAACGTTAACAGCATAATACTTG0.025400.007300.500000.500001.000001.00000


Target Position: 1113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113GACUAACCAGAACACGAAU87.1093180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2331131GACTAACCAGAACACGAATATTCGTGTTCTGGTTAGTC0.178000.031200.810300.750001.000001.00000


Target Position: 566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
566AGAGGGUGCUGUACAUUGA88.9434118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
492584AGAGGGTGCTGTACATTGATCAATGTACAGCACCCTCT0.118600.001700.500000.500001.000001.00000


Target Position: 1562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562CCAACCCCUCAGAUUUUAU79.4399481

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2411580CCAACCCCTCAGATTTTATATAAAATCTGAGGGGTTGG0.134000.110800.801701.000000.967400.75000


Target Position: 1070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070ACUUUGGACCAGAUUUCAA86.7927194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151088ACTTTGGACCAGATTTCAATTGAAATCTGGTCCAAAGT0.268500.004000.560300.750001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719GCAAGUAUUAUGCUGUUAA94.495738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480737GCAAGTATTATGCTGTTAATTAACAGCATAATACTTGC0.023300.005800.819001.000000.951100.62500


Target Position: 1244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244GCGAUGAGGACGAAGACGA82.5166340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4351262GCGATGAGGACGAAGACGATCGTCTTCGTCCTCATCGC0.167400.003200.629300.750001.000001.00000


Target Position: 1990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1990GUCUUCUCCUAAUUCUGCA85.0807252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5252008GTCTTCTCCTAATTCTGCATGCAGAATTAGGAGAAGAC0.035800.004500.465500.500001.000001.00000


Target Position: 2065, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2065CUCUUUGUAAUAAAAUGGU70.274985

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2063-2085GCCTCTTTGTAATAAAATGGTACACCAUUUUAUUACAAAGAGGCCUCUUUGUAAUAAAAUGGUACU11.319.220


Target Position: 2017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2017UUGCUAGUCUAGUUUCCUU75.8166669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5002035TTGCTAGTCTAGTTTCCTTAAGGAAACTAGACTAGCAA0.019100.015300.508600.500001.000001.00000


Target Position: 245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
245CUGAGGAGAUGACCAAGUA93.561351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353263CTGAGGAGATGACCAAGTATACTTGGTCATCTCCTCAG0.448600.007500.603400.750000.962001.00000


Target Position: 992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
992GGUGCUGGACAUAUGAGAC81.2905399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981010GGTGCTGGACATATGAGACGTCTCATATGTCCAGCACC0.098200.004500.534500.750001.000001.00000


Target Position: 1599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1599UAUUUAUAUAAAAAUUUAU84.8408261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521617TATTTATATAAAAATTTATATAAATTTTTATATAAATA0.333200.010700.500000.500001.000001.00000


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337CAGAGAUUCAACGUUGGUG71.0747936

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519355CAGAGATTCAACGTTGGTGCACCAACGTTGAATCTCTG0.084300.032200.491400.500001.000001.00000


Target Position: 1779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1779CAUAAGACAAACUCCUGAA94.520837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941797CATAAGACAAACTCCTGAATTCAGGAGTTTGTCTTATG0.251800.229500.482800.750000.956500.75000


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563CAACCCCUCAGAUUUUAUA88.5011134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3101581CAACCCCTCAGATTTTATATATAAAATCTGAGGGGTTG0.245300.110800.603400.750000.967400.62500


Target Position: 216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
216GGAAAUCUAUCGCCCUCAC74.5245741

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327234GGAAATCTATCGCCCTCACGTGAGGGCGATAGATTTCC0.195600.108200.577600.750001.000001.00000


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653CCUUUCAUAAGUAUGGAGA79.6976469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
481671CCTTTCATAAGTATGGAGATCTCCATACTTATGAAAGG0.023200.009800.620700.750001.000001.00000


Target Position: 1561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1561CCCAACCCCUCAGAUUUUA74.7482724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2561579CCCAACCCCTCAGATTTTATAAAATCTGAGGGGTTGGG0.125500.107200.956901.000000.967400.75000


Target Position: 1042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042GAGCUUCCAUACAAUGACU87.9069155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3051060GAGCTTCCATACAATGACTAGTCATTGTATGGAAGCTC0.510900.087300.603400.500001.000001.00000


Target Position: 965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
965GUGGUUACACCAUUCGUAA91.025978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
485983GTGGTTACACCATTCGTAATTACGAATGGTGTAACCAC0.271800.001800.758600.750000.902200.62500


Target Position: 2014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2014AGGUUGCUAGUCUAGUUUC69.74231009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652032AGGTTGCTAGTCTAGTTTCGAAACTAGACTAGCAACCT0.027000.022900.672400.500001.000001.00000


Target Position: 913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
913UGUGUGGAAUUUGUCAAGA73.9909769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493931TGTGTGGAATTTGTCAAGATCTTGACAAATTCCACACA0.151300.014000.482800.500001.000001.00000


Target Position: 199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
199GGUCUCUACCGAAAAAUGG66.82711177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
419217GGTCTCTACCGAAAAATGGCCATTTTTCGGTAGAGACC0.183000.015800.508600.500000.934800.75000


Target Position: 2025, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2025CUAGUUUCCUUUUUGAGAU81.4164391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5042043CTAGTTTCCTTTTTGAGATATCTCAAAAAGGAAACTAG0.127300.001400.491400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2023-2045GTCTAGTTTCCTTTTTGAGATACAUCUCAAAAAGGAAACUAGACCUAGUUUCCUUUUUGAGAUACU20.414.620


Target Position: 1975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1975GCCUGCCCUCUGUCUGUCU74.237761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131993GCCTGCCCTCTGTCTGTCTAGACAGACAGAGGGCAGGC0.219800.031300.775900.750001.000001.00000


Target Position: 1979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1979GCCCUCUGUCUGUCUUCUC67.14511156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2151997GCCCTCTGTCTGTCTTCTCGAGAAGACAGACAGAGGGC0.237600.208800.689700.750001.000001.00000


Target Position: 1079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1079CAGAUUUCAAGCUCCACAU82.8158323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2631097CAGATTTCAAGCTCCACATATGTGGAGCTTGAAATCTG0.477100.135300.629300.750000.972800.62500


Target Position: 1450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1450GAGAAAACCAAGGAGGAGA81.8378370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121468GAGAAAACCAAGGAGGAGATCTCCTCCTTGGTTTTCTC0.131100.058300.586200.500000.978300.87500


Target Position: 1196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1196GGGUCCAAAUGCAGGCGAU83.2429310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981214GGGTCCAAATGCAGGCGATATCGCCTGCATTTGGACCC0.051000.008300.810301.000000.962001.00000


Target Position: 90, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
90GAAAGUCUGUUACUACUAC82.6575330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473108GAAAGTCTGTTACTACTACGTAGTAGTAACAGACTTTC0.288900.010500.491400.500001.000001.00000


Target Position: 2052, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2052CAUUUUUGUGAGCCUCUUU81.8974368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2112070CATTTTTGTGAGCCTCTTTAAAGAGGCTCACAAAAATG0.222100.036500.655200.750001.000001.00000


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415AAGACCCAGAGGAGAAGAA79.9815461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151433AAGACCCAGAGGAGAAGAATTCTTCTCCTCTGGGTCTT0.441400.212400.465500.500001.000001.00000


Target Position: 1452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1452GAAAACCAAGGAGGAGAAG63.2271385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3791470GAAAACCAAGGAGGAGAAGCTTCTCCTCCTTGGTTTTC0.307400.076400.534500.500000.978301.00000


Target Position: 186, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
186GCUGCUCAACUAUGGUCUC71.0155940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512204GCTGCTCAACTATGGTCTCGAGACCATAGTTGAGCAGC0.015200.008500.543100.750001.000001.00000


Target Position: 1710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1710UUCUUCCCGUUCUUAACUU62.41261421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441728TTCTTCCCGTTCTTAACTTAAGTTAAGAACGGGAAGAA0.083900.055700.534500.500001.000001.00000


Target Position: 318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
318GGAGUACAGCAAGCAGAUG75.7064675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
428336GGAGTACAGCAAGCAGATGCATCTGCTTGCTGTACTCC0.051300.003600.715500.750000.994601.00000


Target Position: 170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
170GCAUGACUCAUAAUUUGCU84.5727268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458188GCATGACTCATAATTTGCTAGCAAATTATGAGTCATGC0.131000.017100.500000.750001.000001.00000


Target Position: 48, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
48ACGGGAGGCGAGCAAGAUG63.58631367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
37566ACGGGAGGCGAGCAAGATGCATCTTGCTCGCCTCCCGT0.199600.007500.620700.500001.000001.00000


Target Position: 1572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1572AGAUUUUAUAUUUUCUAUU81.9281366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2561590AGATTTTATATTTTCTATTAATAGAAAATATAAAATCT0.435500.337400.715500.750001.000001.00000


Target Position: 1287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1287CUCCUCUGACAAACGAAUU72.8075845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701305CTCCTCTGACAAACGAATTAATTCGTTTGTCAGAGGAG0.239300.006500.801700.750000.983700.62500


Target Position: 1977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1977CUGCCCUCUGUCUGUCUUC63.07461395

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4881995CTGCCCTCTGTCTGTCTTCGAAGACAGACAGAGGGCAG0.241000.027300.612100.500001.000001.00000


Target Position: 143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
143GCCACCCAAUGAAGCCUCA78.8503502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
288161GCCACCCAATGAAGCCTCATGAGGCTTCATTGGGTGGC0.109600.029600.775900.750000.972800.62500


Target Position: 1601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601UUUAUAUAAAAAUUUAUUA83.3614305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5191619TTTATATAAAAATTTATTATAATAAATTTTTATATAAA0.340000.014300.465500.500001.000001.00000


Target Position: 1089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089GCUCCACAUCAGUCCUUCC72.9815835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911107GCTCCACATCAGTCCTTCCGGAAGGACTGATGTGGAGC0.089300.053500.482800.500001.000001.00000


Target Position: 2041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2041GAUACUAUUUUCAUUUUUG82.7101326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4842059GATACTATTTTCATTTTTGCAAAAATGAAAATAGTATC0.057500.011000.534500.500001.000001.00000


Target Position: 1485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1485GGUCAAGGAGGAGGUCAAG72.5811861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261503GGTCAAGGAGGAGGTCAAGCTTGACCTCCTCCTTGACC0.041400.006500.715500.750001.000001.00000


Target Position: 1472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472CAGAAGCCAAAGGGGUCAA77.2501594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671490CAGAAGCCAAAGGGGTCAATTGACCCCTTTGGCTTCTG0.026800.007900.637900.750001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158ACUGUUUGAGAACCUUAGA76.1981642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981176ACTGTTTGAGAACCTTAGATCTAAGGTTCTCAAACAGT0.100500.001600.482800.500001.000001.00000


Target Position: 1754, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1754GGUGAAAGGGAUACUUUUA96.255120

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9175419GGTGAAAGGGATACTTTTA1/1/0/094.96HDAC1NM_004964.21NANANANA00HDAC1(0.002)&SLC40A1(0.029)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1752-1774TGGGTGAAAGGGATACTTTTATGUAAAAGUAUCCCUUUCACCCAGGUGAAAGGGAUACUUUUAUGU4.919.230


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264CCUGACAAGCGCAUCUCGA80.8409422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3641282CCTGACAAGCGCATCTCGATCGAGATGCGCTTGTCAGG0.109300.029800.551700.750000.940200.62500


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880UGCUUCAAUCUAACUAUCA79.2977488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482898TGCTTCAATCTAACTATCATGATAGTTAGATTGAAGCA0.022800.008800.629300.500001.000001.00000


Target Position: 1921, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1921GAUUGGUUCUGUUUUCGUA99.38656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4361939GATTGGTTCTGTTTTCGTATACGAAAACAGAACCAATC0.211200.006000.500000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1919-1941TAGATTGGTTCTGTTTTCGTACCUACGAAAACAGAACCAAUCUAGAUUGGUUCUGUUUUCGUACCU15.318.830


Target Position: 867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
867GGAUCGGUUAGGUUGCUUC74.9354719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497885GGATCGGTTAGGTTGCTTCGAAGCAACCTAACCGATCC0.019500.002000.698300.750001.000001.00000


Target Position: 1087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1087AAGCUCCACAUCAGUCCUU69.33061028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481105AAGCTCCACATCAGTCCTTAAGGACTGATGTGGAGCTT0.077300.054700.500000.500001.000001.00000


Target Position: 1127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1127CGAAUGAGUACCUGGAGAA94.179845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3071145CGAATGAGTACCTGGAGAATTCTCCAGGTACTCATTCG0.097400.072200.620701.000001.000001.00000


Target Position: 114, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
114GGAUGUUGGAAAUUACUAU94.766335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125132GGATGTTGGAAATTACTATATAGTAATTTCCAACATCC0.377400.065700.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
112-134GGGGATGTTGGAAATTACTATTAAUAGUAAUUUCCAACAUCCCCGGAUGUUGGAAAUUACUAUUAU6.320.530


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217GAAAUCUAUCGCCCUCACA85.9501224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518235GAAATCTATCGCCCTCACATGTGAGGGCGATAGATTTC0.217500.103400.465500.500001.000001.00000


Target Position: 1780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1780AUAAGACAAACUCCUGAAA80.5238439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3681798ATAAGACAAACTCCTGAAATTTCAGGAGTTTGTCTTAT0.245200.220900.543100.500000.956500.75000


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439UCACCGAAGAGGAGAAAAC60.88841498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3571457TCACCGAAGAGGAGAAAACGTTTTCTCCTCTTCGGTGA0.071700.016800.577600.500000.934800.62500


Target Position: 1971, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1971CACUGCCUGCCCUCUGUCU74.4604748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361989CACTGCCTGCCCTCTGTCTAGACAGAGGGCAGGCAGTG0.376400.058600.569000.500001.000001.00000


Target Position: 1881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881UGUUUUUUUCAGGCUCCUA76.3284635

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4021899TGTTTTTTTCAGGCTCCTATAGGAGCCTGAAAAAAACA0.048600.016900.534500.750001.000001.00000


Target Position: 1038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038UAAUGAGCUUCCAUACAAU88.1593145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241056TAATGAGCTTCCATACAATATTGTATGGAAGCTCATTA0.207300.064500.525900.500001.000001.00000


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339GAGAUUCAACGUUGGUGAG74.7449725

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451357GAGATTCAACGTTGGTGAGCTCACCAACGTTGAATCTC0.055900.018300.500000.500001.000001.00000


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389AGUCAAAACAGAGGAUGAA86.5371201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831407AGTCAAAACAGAGGATGAATTCATCCTCTGTTTTGACT0.500800.287500.534500.750001.000001.00000


Target Position: 1605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1605UAUAAAAAUUUAUUAAAUA95.014833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4381623TATAAAAATTTATTAAATATATTTAATAAATTTTTATA0.078200.017900.500000.500001.000001.00000


Target Position: 1049, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CAUACAAUGACUACUUUGA89.6614103

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1047-1069TCCATACAATGACTACTTTGAATUCAAAGUAGUCAUUGUAUGGACAUACAAUGACUACUUUGAAUU11.86.720


Target Position: 1560, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1560CCCCAACCCCUCAGAUUUU73.383814

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8156019CCCCAACCCCTCAGATTTT1/1/0/094.96HDAC1NM_004964.21NANANA1:32798693..32798711(+)00HDAC1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2631578CCCCAACCCCTCAGATTTTAAAATCTGAGGGGTTGGGG0.122600.107800.991401.000000.967400.75000


Target Position: 113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
113GGGAUGUUGGAAAUUACUA92.191959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
118131GGGATGTTGGAAATTACTATAGTAATTTCCAACATCCC0.379800.068800.819001.000001.000001.00000


Target Position: 1988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1988CUGUCUUCUCCUAAUUCUG72.7327849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4462006CTGTCTTCTCCTAATTCTGCAGAATTAGGAGAAGACAG0.081800.034500.500000.500001.000001.00000


Target Position: 110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
110ACGGGGAUGUUGGAAAUUA80.9623415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393128ACGGGGATGTTGGAAATTATAATTTCCAACATCCCCGT0.180100.004800.741400.750001.000001.00000


Target Position: 1066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1066GAAUACUUUGGACCAGAUU81.0118410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781084GAATACTTTGGACCAGATTAATCTGGTCCAAAGTATTC0.059800.010500.663800.750001.000001.00000


Target Position: 1753, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1753GGGUGAAAGGGAUACUUUU89.7452101

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1175319GGGTGAAAGGGATACTTTT1/1/0/097.75HDAC1NM_004964.21NANANA1:32798886..32798904(+)00HDAC1(0.002)


Target Position: 1539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1539GCUGAGUCCCUCACGUUUC69.00291056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831557GCTGAGTCCCTCACGTTTCGAAACGTGAGGGACTCAGC0.664400.005400.681000.750000.918500.75000


Target Position: 1034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1034UCCCUAAUGAGCUUCCAUA80.5078441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2541052TCCCTAATGAGCTTCCATATATGGAAGCTCATTAGGGA0.135900.068700.827600.750000.956500.62500


Target Position: 121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
121GGAAAUUACUAUUAUGGAC82.4474343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
401139GGAAATTACTATTATGGACGTCCATAATAGTAATTTCC0.049300.036200.551700.750001.000001.00000


Target Position: 257, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
257CCAAGUACCACAGCGAUGA77.4834580

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
324275CCAAGTACCACAGCGATGATCATCGCTGTGGTACTTGG0.089100.066800.620700.750001.000001.00000


Target Position: 870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
870UCGGUUAGGUUGCUUCAAU72.1764886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455888TCGGTTAGGTTGCTTCAATATTGAAGCAACCTAACCGA0.051800.002600.784500.750001.000001.00000


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764ACGAGUCCUAUGAGGCCAU71.3257926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475782ACGAGTCCTATGAGGCCATATGGCCTCATAGGACTCGT0.024000.003800.620700.750000.934800.62500


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538GCCAUCCUGGAACUGCUAA79.7581466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312556GCCATCCTGGAACTGCTAATTAGCAGTTCCAGGATGGC0.095500.042700.965501.000001.000001.00000


Target Position: 2023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2023GUCUAGUUUCCUUUUUGAG72.3253876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5022041GTCTAGTTTCCTTTTTGAGCTCAAAAAGGAAACTAGAC0.018300.001500.508600.500001.000001.00000


Target Position: 908, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
908CCAAGUGUGUGGAAUUUGU80.7488430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
525926CCAAGTGTGTGGAATTTGTACAAATTCCACACACTTGG0.194100.001100.637900.750000.983700.62500


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071CUUUGGACCAGAUUUCAAG72.0356890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491089CTTTGGACCAGATTTCAAGCTTGAAATCTGGTCCAAAG0.194700.003600.500000.500001.000001.00000


Target Position: 116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
116AUGUUGGAAAUUACUAUUA80.2185453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
424134ATGTTGGAAATTACTATTATAATAGTAATTTCCAACAT0.363800.073400.620700.500001.000001.00000


Target Position: 710, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
710CUGGCAAAGGCAAGUAUUA86.324215

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_671019CTGGCAAAGGCAAGTATTA1/1/0/094.96HDAC1NM_004964.21NANANA1:220799723..220799741(+)|1:32794679..32794697(+)00HDAC1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
384728CTGGCAAAGGCAAGTATTATAATACTTGCCTTTGCCAG0.124600.005200.750000.750001.000001.00000


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373UCAAAAAAGCCAAGAGAGU64.56441308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671391TCAAAAAAGCCAAGAGAGTACTCTCTTGGCTTTTTTGA0.295300.238000.517200.500001.000001.00000


Target Position: 545, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
545UGGAACUGCUAAAGUAUCA79.4237482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486563TGGAACTGCTAAAGTATCATGATACTTTAGCAGTTCCA0.021400.016400.620700.500001.000001.00000


Target Position: 518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
518ACGUCAAUGAUAUCGUCUU77.4577582

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
360536ACGTCAATGATATCGTCTTAAGACGATATCATTGACGT0.068800.015400.637900.750001.000001.00000


Target Position: 918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
918GGAAUUUGUCAAGAGCUUU82.1064360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97936GGAATTTGTCAAGAGCTTTAAAGCTCTTGACAAATTCC0.342400.126600.870701.000001.000001.00000


Target Position: 1793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1793CUGAAAUGCCAAGUGCCUG63.69141356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071811CTGAAATGCCAAGTGCCTGCAGGCACTTGGCATTTCAG0.015900.014100.500000.500000.972800.87500


Target Position: 423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
423UGCUGUGAAACUUAAUAAG67.85651114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460441TGCTGTGAAACTTAATAAGCTTATTAAGTTTCACAGCA0.027700.013300.715500.500001.000001.00000


Target Position: 1091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1091UCCACAUCAGUCCUUCCAA78.3547534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2601109TCCACATCAGTCCTTCCAATTGGAAGGACTGATGTGGA0.124100.057600.724100.750001.000001.00000


Target Position: 567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
567GAGGGUGCUGUACAUUGAC74.5774737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
486585GAGGGTGCTGTACATTGACGTCAATGTACAGCACCCTC0.118900.001800.491400.500001.000001.00000


Target Position: 1608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1608AAAAAUUUAUUAAAUAUAA95.643425

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201626AAAAATTTATTAAATATAATTATATTTAATAAATTTTT0.112200.025000.465500.500001.000001.00000


Target Position: 1438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1438GUCACCGAAGAGGAGAAAA79.4664478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471456GTCACCGAAGAGGAGAAAATTTTCTCCTCTTCGGTGAC0.076700.022500.819000.750000.907600.62500


Target Position: 911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
911AGUGUGUGGAAUUUGUCAA86.1026221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351929AGTGTGTGGAATTTGTCAATTGACAAATTCCACACACT0.151300.009100.560300.750001.000001.00000


Target Position: 1542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1542GAGUCCCUCACGUUUCUUC71.0197939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3081560GAGTCCCTCACGTTTCTTCGAAGAAACGTGAGGGACTC0.702300.267600.637900.500001.000001.00000


Target Position: 1707, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1707CCAUUCUUCCCGUUCUUAA87.3597174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3081725CCATTCTTCCCGTTCTTAATTAAGAACGGGAAGAATGG0.097300.095800.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1705-1727ACCCATTCTTCCCGTTCTTAACTUUAAGAACGGGAAGAAUGGGUCCAUUCUUCCCGUUCUUAACUU14.612.020


Target Position: 2056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2056UUUGUGAGCCUCUUUGUAA80.0007460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5272074TTTGTGAGCCTCTTTGTAATTACAAAGAGGCTCACAAA0.356200.026100.465500.500001.000001.00000


Target Position: 2059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2059GUGAGCCUCUUUGUAAUAA85.8853228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2842077GTGAGCCTCTTTGTAATAATTATTACAAAGAGGCTCAC0.270400.015800.758600.750001.000001.00000


Target Position: 1595, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595UGUGUAUUUAUAUAAAAAU80.4787443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211613TGTGTATTTATATAAAAATATTTTTATATAAATACACA0.058100.003800.698300.750001.000001.00000


Target Position: 1053, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1053CAAUGACUACUUUGAAUAC82.8251320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221071CAATGACTACTTTGAATACGTATTCAAAGTAGTCATTG0.341100.289400.465500.500001.000001.00000


Target Position: 1610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1610AAAUUUAUUAAAUAUAAAU88.7395123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741628AAATTTATTAAATATAAATATTTATATTTAATAAATTT0.137500.037800.491400.500001.000001.00000


Target Position: 1953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1953CUCAAGUGAGCCAAGAAAC67.18981154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901971CTCAAGTGAGCCAAGAAACGTTTCTTGGCTCACTTGAG0.125400.020400.663800.500000.967400.62500


Target Position: 1035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1035CCCUAAUGAGCUUCCAUAC72.2253884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2801053CCCTAATGAGCTTCCATACGTATGGAAGCTCATTAGGG0.112200.054400.810300.750001.000001.00000


Target Position: 1125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1125CACGAAUGAGUACCUGGAG72.1972885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5231143CACGAATGAGTACCTGGAGCTCCAGGTACTCATTCGTG0.094900.053100.482800.500001.000001.00000


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711UCUUCCCGUUCUUAACUUU70.0465998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2251729TCTTCCCGTTCTTAACTTTAAAGTTAAGAACGGGAAGA0.947800.041800.724100.750001.000001.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476AGCCAAAGGGGUCAAGGAG62.9531400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5181494AGCCAAAGGGGTCAAGGAGCTCCTTGACCCCTTTGGCT0.014400.002000.543100.500001.000001.00000


Target Position: 1401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1401GGAUGAAAAAGAGAAAGAC79.1592493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3561419GGATGAAAAAGAGAAAGACGTCTTTCTCTTTTTCATCC0.499200.354300.551700.750001.000001.00000


Target Position: 265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
265CACAGCGAUGACUACAUUA94.02947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
160283CACAGCGATGACTACATTATAATGTAGTCATCGCTGTG0.494000.061000.758600.750000.989100.75000


Target Position: 1077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1077ACCAGAUUUCAAGCUCCAC60.68231504

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861095ACCAGATTTCAAGCTCCACGTGGAGCTTGAAATCTGGT0.450700.105300.560300.500000.972800.62500


Target Position: 1126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1126ACGAAUGAGUACCUGGAGA78.4668531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591144ACGAATGAGTACCTGGAGATCTCCAGGTACTCATTCGT0.095300.062800.551700.500001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500AGGCAUCUGGCUUCUGUUA82.6094333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
465518AGGCATCTGGCTTCTGTTATAACAGAAGCCAGATGCCT0.053500.002300.810300.750001.000001.00000


Target Position: 1600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1600AUUUAUAUAAAAAUUUAUU80.5092440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731618ATTTATATAAAAATTTATTAATAAATTTTTATATAAAT0.308300.012400.500000.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265CUGACAAGCGCAUCUCGAU83.7255288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3061283CTGACAAGCGCATCTCGATATCGAGATGCGCTTGTCAG0.133700.028700.603400.750000.940200.75000


Target Position: 41, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
41GGUAGGGACGGGAGGCGAG68.03981101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50559GGTAGGGACGGGAGGCGAGCTCGCCTCCCGTCCCTACC0.017000.002500.543100.750001.000001.00000


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878GUUGCUUCAAUCUAACUAU86.1612218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327896GTTGCTTCAATCTAACTATATAGTTAGATTGAAGCAAC0.087500.031600.603400.750001.000001.00000


Target Position: 1067, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1067AAUACUUUGGACCAGAUUU76.0136649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4831085AATACTTTGGACCAGATTTAAATCTGGTCCAAAGTATT0.139400.007400.508600.500001.000001.00000


Target Position: 1252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1252GACGAAGACGACCCUGACA88.4292136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301270GACGAAGACGACCCTGACATGTCAGGGTCGTCTTCGTC0.118100.019300.612100.500001.000001.00000


Target Position: 1451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1451AGAAAACCAAGGAGGAGAA84.8334262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3611469AGAAAACCAAGGAGGAGAATTCTCCTCCTTGGTTTTCT0.134000.089300.551700.750000.978301.00000


Target Position: 202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
202CUCUACCGAAAAAUGGAAA78.2049542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164220CTCTACCGAAAAATGGAAATTTCCATTTTTCGGTAGAG0.219500.059300.810300.750001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424AGGAGAAGAAAGAAGUCAC74.4535750

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581442AGGAGAAGAAAGAAGTCACGTGACTTCTTTCTTCTCCT0.075700.074400.551700.500001.000001.00000


Target Position: 446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
446AGACGGACAUCGCUGUGAA94.064146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483464AGACGGACATCGCTGTGAATTCACAGCGATGTCCGTCT0.022700.003900.551700.750000.951100.75000


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590UUCUCUGUGUAUUUAUAUA86.8078193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231608TTCTCTGTGTATTTATATATATATAAATACACAGAGAA0.043400.004500.629300.500001.000001.00000


Target Position: 1712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1712CUUCCCGUUCUUAACUUUG61.87631445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801730CTTCCCGTTCTTAACTTTGCAAAGTTAAGAACGGGAAG0.047400.027500.491400.500001.000001.00000


Target Position: 791, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791CGGUCAUGUCCAAAGUAAU91.484571

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_779119CGGTCATGTCCAAAGTAAT1/1/0/094.96HDAC1NM_004964.21NANANANA00HDAC1(0.002)&LOC100132172(0.007)


Target Position: 329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
329AGCAGAUGCAGAGAUUCAA86.7736195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
248347AGCAGATGCAGAGATTCAATTGAATCTCTGCATCTGCT0.160400.029900.706900.750000.972800.75000


Target Position: 1612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612AUUUAUUAAAUAUAAAUAU84.9569257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5161630ATTTATTAAATATAAATATATATTTATATTTAATAAAT0.118100.047500.465500.500001.000001.00000


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404CUGGUGGUUCUGUGGCAAG66.49881195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474422CTGGTGGTTCTGTGGCAAGCTTGCCACAGAACCACCAG0.041500.002000.646600.500001.000001.00000


Target Position: 46, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
46GGACGGGAGGCGAGCAAGA82.4858342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
45264GGACGGGAGGCGAGCAAGATCTTGCTCGCCTCCCGTCC0.205800.002800.646600.750001.000001.00000


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092CCACAUCAGUCCUUCCAAU87.8756158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1221110CCACATCAGTCCTTCCAATATTGGAAGGACTGATGTGG0.406800.066800.836201.000001.000001.00000


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043AGCUUCCAUACAAUGACUA81.7716374

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1721061AGCTTCCATACAATGACTATAGTCATTGTATGGAAGCT0.514200.097500.681000.750001.000001.00000


Target Position: 1714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1714UCCCGUUCUUAACUUUGAA78.0532550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251732TCCCGTTCTTAACTTTGAATTCAAAGTTAAGAACGGGA0.012700.006800.698300.750001.000001.00000


Target Position: 44, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
44AGGGACGGGAGGCGAGCAA68.79231066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
48562AGGGACGGGAGGCGAGCAATTGCTCGCCTCCCGTCCCT0.022200.002800.698300.750001.000001.00000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592CUCUGUGUAUUUAUAUAAA97.909110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421610CTCTGTGTATTTATATAAATTTATATAAATACACAGAG0.048500.003100.810300.750001.000001.00000


Target Position: 250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
250GAGAUGACCAAGUACCACA94.342641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
361268GAGATGACCAAGTACCACATGTGGTACTTGGTCATCTC0.348000.061500.603400.500001.000001.00000


Target Position: 106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
106UACGACGGGGAUGUUGGAA65.70161240

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
528124TACGACGGGGATGTTGGAATTCCAACATCCCCGTCGTA0.106100.001100.508600.500001.000001.00000


Target Position: 1697, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1697ACCUUGCCACCCAUUCUUC59.80511551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921715ACCTTGCCACCCATTCTTCGAAGAATGGGTGGCAAGGT0.335700.012200.681000.500001.000001.00000


Target Position: 2051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2051UCAUUUUUGUGAGCCUCUU66.24061207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3422069TCATTTTTGTGAGCCTCTTAAGAGGCTCACAAAAATGA0.078300.037600.586200.750001.000001.00000


Target Position: 175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
175ACUCAUAAUUUGCUGCUCA85.4168242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
516193ACTCATAATTTGCTGCTCATGAGCAGCAAATTATGAGT0.243600.038800.482800.500001.000001.00000


Target Position: 576, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
576GUACAUUGACAUUGAUAUU88.4333135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
250594GTACATTGACATTGATATTAATATCAATGTCAATGTAC0.155200.043100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
574-596CTGTACATTGACATTGATATTCAAAUAUCAAUGUCAAUGUACAGGUACAUUGACAUUGAUAUUCAU8.713.520


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415GUGGCAAGUGCUGUGAAAC68.76091068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491433GTGGCAAGTGCTGTGAAACGTTTCACAGCACTTGCCAC0.089000.001700.646600.500000.983700.87500


Target Position: 330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
330GCAGAUGCAGAGAUUCAAC78.291537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
283348GCAGATGCAGAGATTCAACGTTGAATCTCTGCATCTGC0.111200.025900.706900.750001.000001.00000


Target Position: 1701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1701UGCCACCCAUUCUUCCCGU58.1761640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4561719TGCCACCCATTCTTCCCGTACGGGAAGAATGGGTGGCA0.175400.021300.577600.500001.000001.00000


Target Position: 1567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567CCCUCAGAUUUUAUAUUUU86.8573191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
681585CCCTCAGATTTTATATTTTAAAATATAAAATCTGAGGG0.414100.122900.991401.000001.000001.00000


Target Position: 1704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1704CACCCAUUCUUCCCGUUCU76.4655628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291722CACCCATTCTTCCCGTTCTAGAACGGGAAGAATGGGTG0.129300.113700.569000.500001.000001.00000


Target Position: 2015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2015GGUUGCUAGUCUAGUUUCC70.5375973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4902033GGTTGCTAGTCTAGTTTCCGGAAACTAGACTAGCAACC0.020600.017600.482800.500001.000001.00000


Target Position: 243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
243UGCUGAGGAGAUGACCAAG66.47311196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463261TGCTGAGGAGATGACCAAGCTTGGTCATCTCCTCAGCA0.174400.002400.715500.500000.962000.87500


Target Position: 1458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1458CAAGGAGGAGAAGCCAGAA89.6347104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011476CAAGGAGGAGAAGCCAGAATTCTGGCTTCTCCTCCTTG0.247100.053300.474100.750001.000001.00000


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708CAUUCUUCCCGUUCUUAAC73.1247826

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271726CATTCTTCCCGTTCTTAACGTTAAGAACGGGAAGAATG0.091100.080500.508600.500001.000001.00000


Target Position: 713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
713GCAAAGGCAAGUAUUAUGC62.25161426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443731GCAAAGGCAAGTATTATGCGCATAATACTTGCCTTTGC0.046200.004300.500000.500000.918500.62500


Target Position: 869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
869AUCGGUUAGGUUGCUUCAA70.1697988

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
418887ATCGGTTAGGTTGCTTCAATTGAAGCAACCTAACCGAT0.041900.004200.534500.500001.000001.00000


Target Position: 338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338AGAGAUUCAACGUUGGUGA80.8745420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508356AGAGATTCAACGTTGGTGATCACCAACGTTGAATCTCT0.064900.021000.500000.500001.000001.00000


Target Position: 1987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1987UCUGUCUUCUCCUAAUUCU70.9542946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4312005TCTGTCTTCTCCTAATTCTAGAATTAGGAGAAGACAGA0.657000.203800.500000.500001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833UGGUCUUACAGUGUGGCUC56.41131719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496851TGGTCTTACAGTGTGGCTCGAGCCACACTGTAAGACCA0.032100.002600.534500.500001.000001.00000


Target Position: 542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
542UCCUGGAACUGCUAAAGUA88.5062132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400560TCCTGGAACTGCTAAAGTATACTTTAGCAGTTCCAGGA0.050400.008300.689700.750001.000001.00000


Target Position: 1781, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1781UAAGACAAACUCCUGAAAU73.6256795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951799TAAGACAAACTCCTGAAATATTTCAGGAGTTTGTCTTA0.224900.187000.525900.500000.956500.62500


Target Position: 572, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
572UGCUGUACAUUGACAUUGA86.5109203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
304590TGCTGTACATTGACATTGATCAATGTCAATGTACAGCA0.207600.054200.629300.500001.000001.00000


Target Position: 367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
367GUAUUCGAUGGCCUGUUUG65.28131256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526385GTATTCGATGGCCTGTTTGCAAACAGGCCATCGAATAC0.019800.001100.534500.500001.000001.00000


Target Position: 268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
268AGCGAUGACUACAUUAAAU87.1905176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
206286AGCGATGACTACATTAAATATTTAATGTAGTCATCGCT0.603000.094500.844800.750001.000001.00000


Target Position: 1100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100GUCCUUCCAAUAUGACUAA87.0192184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1651118GTCCTTCCAATATGACTAATTAGTCATATTGGAAGGAC0.251100.070900.784500.750001.000001.00000


Target Position: 263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
263ACCACAGCGAUGACUACAU76.0648647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
249281ACCACAGCGATGACTACATATGTAGTCATCGCTGTGGT0.212800.060200.698300.750000.989100.87500


Target Position: 118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
118GUUGGAAAUUACUAUUAUG84.7748264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
481136GTTGGAAATTACTATTATGCATAATAGTAATTTCCAAC0.094500.035000.491400.500001.000001.00000


Target Position: 2071, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071GUAAUAAAAUGGUACAUUU91.983461

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3207119GTAATAAAATGGTACATTT1/1/0/096.22HDAC1NM_004964.21NANANA1:32799204..32799222(+)|10:95899788..95899806(+)|2:210267794..210267812(+)00HDAC1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2069-2091TTGTAATAAAATGGTACATTTCTAAAUGUACCAUUUUAUUACAAGUAAUAAAAUGGUACAUUUCUU14.6-7.510


Target Position: 55, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
55GCGAGCAAGAUGGCGCAGA70.6633966

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
39973GCGAGCAAGATGGCGCAGATCTGCGCCATCTTGCTCGC0.102200.004500.698300.750000.956500.87500


Target Position: 1521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1521CUCCAGCUCUGGCUUCCUG66.10651217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961539CTCCAGCTCTGGCTTCCTGCAGGAAGCCAGAGCTGGAG0.023300.001600.525900.500000.913000.75000


Target Position: 571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
571GUGCUGUACAUUGACAUUG66.45471198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
520589GTGCTGTACATTGACATTGCAATGTCAATGTACAGCAC0.192500.049600.646600.500001.000001.00000


Target Position: 1392, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392CAAAACAGAGGAUGAAAAA90.492391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2901410CAAAACAGAGGATGAAAAATTTTTCATCCTCTGTTTTG0.695800.459600.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1390-1412GTCAAAACAGAGGATGAAAAAGAUUUUUCAUCCUCUGUUUUGACCAAAACAGAGGAUGAAAAAGAU7.410.310


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037CUAAUGAGCUUCCAUACAA94.190244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4071055CTAATGAGCTTCCATACAATTGTATGGAAGCTCATTAG0.149900.061600.525900.750001.000001.00000


Target Position: 2044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2044ACUAUUUUCAUUUUUGUGA72.7286850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882062ACTATTTTCATTTTTGTGATCACAAAAATGAAAATAGT0.082300.009100.482800.500001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425GGAGAAGAAAGAAGUCACC71.8949900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031443GGAGAAGAAAGAAGTCACCGGTGACTTCTTTCTTCTCC0.065600.064700.517200.500001.000001.00000


Target Position: 1916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1916UUUUAGAUUGGUUCUGUUU67.35971140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571934TTTTAGATTGGTTCTGTTTAAACAGAACCAATCTAAAA0.041100.004000.500000.500001.000001.00000


Target Position: 2039, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2039GAGAUACUAUUUUCAUUUU90.761586

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2203919GAGATACTATTTTCATTTT1/1/0/096.22HDAC1NM_004964.21NANANA1:32799172..32799190(+)00HDAC1(0.002)&CPSF6(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3672057GAGATACTATTTTCATTTTAAAATGAAAATAGTATCTC0.089300.006600.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2037-2059TTGAGATACTATTTTCATTTTTGAAAAUGAAAAUAGUAUCUCAAGAGAUACUAUUUUCAUUUUUGU7.418.910


Target Position: 1477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1477GCCAAAGGGGUCAAGGAGG55.79941738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011495GCCAAAGGGGTCAAGGAGGCCTCCTTGACCCCTTTGGC0.041500.007200.655200.500001.000001.00000


Target Position: 1548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1548CUCACGUUUCUUCCCCAAC59.58441561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461566CTCACGTTTCTTCCCCAACGTTGGGGAAGAAACGTGAG0.736900.641000.663800.500000.956500.62500


Target Position: 1905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905ACAUCAGCCAUUUUUAGAU79.9142463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4041923ACATCAGCCATTTTTAGATATCTAAAAATGGCTGATGT0.577800.008200.525900.750001.000001.00000


Target Position: 1834, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1834CCUUAUUGAACAUUCUAGA86.868190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3591852CCTTATTGAACATTCTAGATCTAGAATGTTCAATAAGG0.070100.017500.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1832-1854GCCCTTATTGAACATTCTAGAAGUCUAGAAUGUUCAAUAAGGGCCCUUAUUGAACAUUCUAGAAGU11.63.530


Target Position: 2020, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2020CUAGUCUAGUUUCCUUUUU73.455808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5162038CTAGTCTAGTTTCCTTTTTAAAAAGGAAACTAGACTAG0.014500.004600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2018-2040TGCTAGTCTAGTTTCCTTTTTGAAAAAAGGAAACUAGACUAGCACUAGUCUAGUUUCCUUUUUGAU18.720.130


Target Position: 821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
821AGCCUAGUGCGGUGGUCUU74.3281755

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517839AGCCTAGTGCGGTGGTCTTAAGACCACCGCACTAGGCT0.014500.007600.715500.750000.929300.75000


Target Position: 1546, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1546CCCUCACGUUUCUUCCCCA85.7225230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2191564CCCTCACGTTTCTTCCCCATGGGGAAGAAACGTGAGGG0.734900.620000.646600.750001.000001.00000


Target Position: 2019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2019GCUAGUCUAGUUUCCUUUU81.5475381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4172037GCTAGTCTAGTTTCCTTTTAAAAGGAAACTAGACTAGC0.042400.015800.853401.000001.000001.00000


Target Position: 333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
333GAUGCAGAGAUUCAACGUU84.8623259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
398351GATGCAGAGATTCAACGTTAACGTTGAATCTCTGCATC0.067300.011900.534500.750001.000001.00000


Target Position: 2057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2057UUGUGAGCCUCUUUGUAAU75.953654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3372075TTGTGAGCCTCTTTGTAATATTACAAAGAGGCTCACAA0.342300.021600.637900.500001.000001.00000


Target Position: 568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
568AGGGUGCUGUACAUUGACA87.4446172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502586AGGGTGCTGTACATTGACATGTCAATGTACAGCACCCT0.128200.002300.637900.500001.000001.00000


Target Position: 421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
421AGUGCUGUGAAACUUAAUA86.5088204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
386439AGTGCTGTGAAACTTAATATATTAAGTTTCACAGCACT0.367800.005100.663800.750001.000001.00000


Target Position: 1128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1128GAAUGAGUACCUGGAGAAG78.3966533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981146GAATGAGTACCTGGAGAAGCTTCTCCAGGTACTCATTC0.102400.079600.534500.500001.000001.00000


Target Position: 707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
707GGGCUGGCAAAGGCAAGUA81.2108402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443725GGGCTGGCAAAGGCAAGTATACTTGCCTTTGCCAGCCC0.039600.002900.810301.000000.967400.62500


Target Position: 1449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1449GGAGAAAACCAAGGAGGAG73.469807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3531467GGAGAAAACCAAGGAGGAGCTCCTCCTTGGTTTTCTCC0.132300.052000.560300.750000.978300.75000


Target Position: 1823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1823UGGAAAGGUGCCCUUAUUG60.85971499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4271841TGGAAAGGTGCCCTTATTGCAATAAGGGCACCTTTCCA0.041300.003700.698300.500000.940200.62500


Target Position: 2022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2022AGUCUAGUUUCCUUUUUGA87.8024159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5092040AGTCTAGTTTCCTTTTTGATCAAAAAGGAAACTAGACT0.060000.001600.482800.500001.000001.00000


Target Position: 2062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2062AGCCUCUUUGUAAUAAAAU74.5047743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2672080AGCCTCTTTGTAATAAAATATTTTATTACAAAGAGGCT0.159400.074200.844800.750001.000001.00000


Target Position: 425, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
425CUGUGAAACUUAAUAAGCA94.805834

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
423-445TGCTGTGAAACTTAATAAGCAGCUGCUUAUUAAGUUUCACAGCACUGUGAAACUUAAUAAGCAGCU13.620.520


Target Position: 1702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1702GCCACCCAUUCUUCCCGUU70.0669997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2191720GCCACCCATTCTTCCCGTTAACGGGAAGAATGGGTGGC0.157000.032300.853401.000001.000001.00000


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509GCUUCUGUUACGUCAAUGA88.7618121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451527GCTTCTGTTACGTCAATGATCATTGACGTAACAGAAGC0.093100.002800.629300.750001.000001.00000


Target Position: 1986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1986GUCUGUCUUCUCCUAAUUC73.7993775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4342004GTCTGTCTTCTCCTAATTCGAATTAGGAGAAGACAGAC0.623300.205500.646600.500001.000001.00000


Target Position: 206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
206ACCGAAAAAUGGAAAUCUA88.4194138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
330224ACCGAAAAATGGAAATCTATAGATTTCCATTTTTCGGT0.086100.049100.681000.750001.000001.00000


Target Position: 1419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1419CCCAGAGGAGAAGAAAGAA87.097181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491437CCCAGAGGAGAAGAAAGAATTCTTTCTTCTCCTCTGGG0.898600.365600.819001.000001.000001.00000


Target Position: 1596, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596GUGUAUUUAUAUAAAAAUU89.5793105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3481614GTGTATTTATATAAAAATTAATTTTTATATAAATACAC0.137500.007900.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1594-1616CTGTGTATTTATATAAAAATTTAAAUUUUUAUAUAAAUACACAGGUGUAUUUAUAUAAAAAUUUAU-9.76.910


Target Position: 1423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1423GAGGAGAAGAAAGAAGUCA86.4842207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3141441GAGGAGAAGAAAGAAGTCATGACTTCTTTCTTCTCCTC0.221100.115600.586200.500001.000001.00000


Target Position: 1277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1277UCUCGAUCUGCUCCUCUGA74.5907736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931295TCTCGATCTGCTCCTCTGATCAGAGGAGCAGATCGAGA0.041500.001700.500000.500001.000001.00000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767AGUCCUAUGAGGCCAUUUU76.7351613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
436785AGTCCTATGAGGCCATTTTAAAATGGCCTCATAGGACT0.037800.008000.706900.750000.951100.62500


Target Position: 519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
519CGUCAAUGAUAUCGUCUUG80.6845432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433537CGTCAATGATATCGTCTTGCAAGACGATATCATTGACG0.038200.008400.629300.750001.000001.00000


Target Position: 246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
246UGAGGAGAUGACCAAGUAC71.8238907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475264TGAGGAGATGACCAAGTACGTACTTGGTCATCTCCTCA0.457100.009700.543100.500000.962000.87500


Target Position: 1892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1892GGCUCCUAAAGUAACAUCA87.8808156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921910GGCTCCTAAAGTAACATCATGATGTTACTTTAGGAGCC0.197400.037600.775900.750001.000001.00000


Target Position: 1280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1280CGAUCUGCUCCUCUGACAA95.527426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581298CGATCTGCTCCTCTGACAATTGTCAGAGGAGCAGATCG0.108200.007300.646601.000001.000001.00000


Target Position: 1952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1952CCUCAAGUGAGCCAAGAAA88.2766143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2901970CCTCAAGTGAGCCAAGAAATTTCTTGGCTCACTTGAGG0.244700.015100.844801.000000.902200.62500


Target Position: 1755, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1755GUGAAAGGGAUACUUUUAU79.5057475

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10175519GTGAAAGGGATACTTTTAT1/1/0/094.96HDAC1NM_004964.21NANANA1:32798888..32798906(+)00HDAC1(0.002)&SLC40A1(0.007)


Target Position: 1420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1420CCAGAGGAGAAGAAAGAAG72.7217851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1311438CCAGAGGAGAAGAAAGAAGCTTCTTTCTTCTCCTCTGG0.822700.302200.706900.750001.000001.00000


Target Position: 174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
174GACUCAUAAUUUGCUGCUC72.3863872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
422192GACTCATAATTTGCTGCTCGAGCAGCAAATTATGAGTC0.336400.030600.508600.500001.000001.00000


Target Position: 1889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1889UCAGGCUCCUAAAGUAACA75.5896681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481907TCAGGCTCCTAAAGTAACATGTTACTTTAGGAGCCTGA0.342100.005500.517200.500001.000001.00000


Target Position: 1890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1890CAGGCUCCUAAAGUAACAU79.7302467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3421908CAGGCTCCTAAAGTAACATATGTTACTTTAGGAGCCTG0.331200.008300.629300.750001.000001.00000


Target Position: 1540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1540CUGAGUCCCUCACGUUUCU73.3758815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5151558CTGAGTCCCTCACGTTTCTAGAAACGTGAGGGACTCAG0.686700.028200.560300.500000.918500.62500


Target Position: 1853, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1853AGGGGUGGCUGGGUCUUCA78.0095553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3921871AGGGGTGGCTGGGTCTTCATGAAGACCCAGCCACCCCT0.190000.004800.620700.500001.000001.00000


Target Position: 448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
448ACGGACAUCGCUGUGAAUU64.8781288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464466ACGGACATCGCTGTGAATTAATTCACAGCGATGTCCGT0.027200.004000.767200.750000.972800.62500


Target Position: 1698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1698CCUUGCCACCCAUUCUUCC58.741606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5081716CCTTGCCACCCATTCTTCCGGAAGAATGGGTGGCAAGG0.482800.032400.474100.500001.000001.00000


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698GGGAUAUCGGGGCUGGCAA82.737325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510716GGGATATCGGGGCTGGCAATTGCCAGCCCCGATATCCC0.031700.001400.844801.000001.000001.00000


Target Position: 447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
447GACGGACAUCGCUGUGAAU90.153193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466465GACGGACATCGCTGTGAATATTCACAGCGATGTCCGTC0.026800.004500.810300.750000.951100.62500


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756GAUUGAUGACGAGUCCUAU93.803749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362774GATTGATGACGAGTCCTATATAGGACTCGTCATCAATC0.067700.011300.637900.750001.000001.00000


Target Position: 1719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1719UUCUUAACUUUGAACCAUA83.4321300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991737TTCTTAACTTTGAACCATATATGGTTCAAAGTTAAGAA0.019100.002800.629300.500001.000001.00000


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414UGUGGCAAGUGCUGUGAAA84.3976274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494432TGTGGCAAGTGCTGTGAAATTTCACAGCACTTGCCACA0.153600.001700.706900.750000.983701.00000


Target Position: 1398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1398AGAGGAUGAAAAAGAGAAA90.983480

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2711416AGAGGATGAAAAAGAGAAATTTCTCTTTTTCATCCTCT0.951300.509200.724100.750001.000001.00000


Target Position: 711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
711UGGCAAAGGCAAGUAUUAU75.9295659

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
357729TGGCAAAGGCAAGTATTATATAATACTTGCCTTTGCCA0.120400.007400.801700.750001.000001.00000


Target Position: 1566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1566CCCCUCAGAUUUUAUAUUU79.8536464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
701584CCCCTCAGATTTTATATTTAAATATAAAATCTGAGGGG0.461400.122300.991401.000001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755GGAUUGAUGACGAGUCCUA96.241921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358773GGATTGATGACGAGTCCTATAGGACTCGTCATCAATCC0.070600.012000.698301.000001.000001.00000


Target Position: 1887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887UUUCAGGCUCCUAAAGUAA76.2723640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211905TTTCAGGCTCCTAAAGTAATTACTTTAGGAGCCTGAAA0.208500.005000.465500.500000.907600.62500


Target Position: 1380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380AGCCAAGAGAGUCAAAACA81.5206384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3391398AGCCAAGAGAGTCAAAACATGTTTTGACTCTCTTGGCT0.364800.253000.646600.500001.000001.00000


Target Position: 271, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
271GAUGACUACAUUAAAUUCU80.7767428

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
269-291GCGATGACTACATTAAATTCTTGAGAAUUUAAUGUAGUCAUCGCGAUGACUACAUUAAAUUCUUGU2.120.330


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539CCAUCCUGGAACUGCUAAA86.5197202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
315557CCATCCTGGAACTGCTAAATTTAGCAGTTCCAGGATGG0.095300.043500.844801.000001.000001.00000


Target Position: 137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
137GACAAGGCCACCCAAUGAA85.9304226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502155GACAAGGCCACCCAATGAATTCATTGGGTGGCCTTGTC0.452500.001500.646600.750000.940201.00000


Target Position: 1584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1584UUCUAUUUCUCUGUGUAUU67.981105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4531602TTCTATTTCTCTGTGTATTAATACACAGAGAAATAGAA0.030700.030100.663800.500001.000001.00000


Target Position: 1359, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1359GAACUCUUCCAACUUCAAA91.478272

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1357-1379AAGAACTCTTCCAACTTCAAAAAUUUGAAGUUGGAAGAGUUCUUGAACUCUUCCAACUUCAAAAAU19.217.710


Target Position: 36, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
36CUGACGGUAGGGACGGGAG61.75451455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
51754CTGACGGTAGGGACGGGAGCTCCCGTCCCTACCGTCAG0.038000.003800.474100.500001.000001.00000


Target Position: 117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
117UGUUGGAAAUUACUAUUAU84.3992273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
222135TGTTGGAAATTACTATTATATAATAGTAATTTCCAACA0.249200.063100.663800.750001.000001.00000


Target Position: 1744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1744GCCAGGUCUGGGUGAAAGG60.84011500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041762GCCAGGTCTGGGTGAAAGGCCTTTCACCCAGACCTGGC0.036800.002000.655200.500000.945700.62500


Target Position: 917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917UGGAAUUUGUCAAGAGCUU71.0783935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190935TGGAATTTGTCAAGAGCTTAAGCTCTTGACAAATTCCA0.348900.128000.706900.750001.000001.00000


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822GCCUAGUGCGGUGGUCUUA82.3415350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515840GCCTAGTGCGGTGGTCTTATAAGACCACCGCACTAGGC0.014600.006300.965501.000000.929300.75000


Target Position: 1197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1197GGUCCAAAUGCAGGCGAUU77.3606588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041215GGTCCAAATGCAGGCGATTAATCGCCTGCATTTGGACC0.017900.007400.844801.000000.962000.87500


Target Position: 1564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1564AACCCCUCAGAUUUUAUAU75.5359688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4281582AACCCCTCAGATTTTATATATATAAAATCTGAGGGGTT0.463200.121900.603400.500001.000001.00000


Target Position: 45, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
45GGGACGGGAGGCGAGCAAG64.83781292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
45463GGGACGGGAGGCGAGCAAGCTTGCTCGCCTCCCGTCCC0.033900.002700.853400.750001.000001.00000


Target Position: 1559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1559UCCCCAACCCCUCAGAUUU63.62211362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2541577TCCCCAACCCCTCAGATTTAAATCTGAGGGGTTGGGGA0.127000.109900.870700.750000.967400.62500


Target Position: 1786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1786CAAACUCCUGAAAUGCCAA89.973195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4651804CAAACTCCTGAAATGCCAATTGGCATTTCAGGAGTTTG0.113300.071900.500000.750001.000001.00000


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047UCCAUACAAUGACUACUUU75.9186660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2281065TCCATACAATGACTACTTTAAAGTAGTCATTGTATGGA0.385300.170800.870700.750001.000001.00000


Target Position: 122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
122GAAAUUACUAUUAUGGACA89.888498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
524140GAAATTACTATTATGGACATGTCCATAATAGTAATTTC0.047500.034600.465500.500001.000001.00000


Target Position: 717, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
717AGGCAAGUAUUAUGCUGUU82.3725348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487735AGGCAAGTATTATGCTGTTAACAGCATAATACTTGCCT0.021400.002400.698300.750000.907600.75000


Target Position: 569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
569GGGUGCUGUACAUUGACAU86.6868196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466587GGGTGCTGTACATTGACATATGTCAATGTACAGCACCC0.198500.002300.836201.000001.000001.00000


Target Position: 1157, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1157GACUGUUUGAGAACCUUAG76.5514622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221175GACTGTTTGAGAACCTTAGCTAAGGTTCTCAAACAGTC0.106000.001200.646600.500001.000001.00000


Target Position: 176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
176CUCAUAAUUUGCUGCUCAA92.432355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196194CTCATAATTTGCTGCTCAATTGAGCAGCAAATTATGAG0.241100.050600.663800.750001.000001.00000


Target Position: 1585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1585UCUAUUUCUCUGUGUAUUU73.4885806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571603TCTATTTCTCTGTGTATTTAAATACACAGAGAAATAGA0.029700.030800.724100.750001.000001.00000


Target Position: 1598, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1598GUAUUUAUAUAAAAAUUUA100.3934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3241616GTATTTATATAAAAATTTATAAATTTTTATATAAATAC0.324000.009400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1596-1618GTGTATTTATATAAAAATTTATTUAAAUUUUUAUAUAAAUACACGUAUUUAUAUAAAAAUUUAUUU-12.0-8.020


Target Position: 109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
109GACGGGGAUGUUGGAAAUU72.5879860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
432127GACGGGGATGTTGGAAATTAATTTCCAACATCCCCGTC0.179500.003400.810300.750001.000001.00000


Target Position: 1033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1033AUCCCUAAUGAGCUUCCAU74.4913745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4011051ATCCCTAATGAGCTTCCATATGGAAGCTCATTAGGGAT0.121600.042000.525900.500000.956500.75000


Target Position: 1609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1609AAAAUUUAUUAAAUAUAAA96.707115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4721627AAAATTTATTAAATATAAATTTATATTTAATAAATTTT0.125800.030400.500000.500001.000001.00000


Target Position: 699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
699GGAUAUCGGGGCUGGCAAA89.920697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523717GGATATCGGGGCTGGCAAATTTGCCAGCCCCGATATCC0.066100.001200.870701.000001.000001.00000


Target Position: 1057, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1057GACUACUUUGAAUACUUUG75.3196701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321075GACTACTTTGAATACTTTGCAAAGTATTCAAAGTAGTC0.038600.020100.672400.500001.000001.00000


Target Position: 1568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568CCUCAGAUUUUAUAUUUUC75.828667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1811586CCTCAGATTTTATATTTTCGAAAATATAAAATCTGAGG0.414200.123300.672400.750001.000001.00000


Target Position: 1976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1976CCUGCCCUCUGUCUGUCUU74.7359726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2331994CCTGCCCTCTGTCTGTCTTAAGACAGACAGAGGGCAGG0.236600.027900.706901.000001.000001.00000


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382CCAAGAGAGUCAAAACAGA91.947862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2861400CCAAGAGAGTCAAAACAGATCTGTTTTGACTCTCTTGG0.636600.225300.620700.750001.000001.00000


Target Position: 1051, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1051UACAAUGACUACUUUGAAU80.8239424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741069TACAATGACTACTTTGAATATTCAAAGTAGTCATTGTA0.343700.289000.672400.500001.000001.00000


Target Position: 54, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
54GGCGAGCAAGAUGGCGCAG60.89781496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
43672GGCGAGCAAGATGGCGCAGCTGCGCCATCTTGCTCGCC0.103600.003200.715500.750000.956500.75000


Target Position: 1421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1421CAGAGGAGAAGAAAGAAGU80.2471451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861439CAGAGGAGAAGAAAGAAGTACTTCTTTCTTCTCCTCTG0.303900.145000.577600.500001.000001.00000


Target Position: 1428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428GAAGAAAGAAGUCACCGAA96.474316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321446GAAGAAAGAAGTCACCGAATTCGGTGACTTCTTTCTTC0.055700.054900.500000.750001.000001.00000


Target Position: 177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
177UCAUAAUUUGCUGCUCAAC58.75021605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
396195TCATAATTTGCTGCTCAACGTTGAGCAGCAAATTATGA0.288200.051600.577600.500001.000001.00000


Target Position: 1538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1538UGCUGAGUCCCUCACGUUU73.4914805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971556TGCTGAGTCCCTCACGTTTAAACGTGAGGGACTCAGCA0.664500.001600.853400.750000.918500.87500


Target Position: 1448, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1448AGGAGAAAACCAAGGAGGA79.6318471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021466AGGAGAAAACCAAGGAGGATCCTCCTTGGTTTTCTCCT0.142700.053800.474100.500000.962000.75000


Target Position: 543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
543CCUGGAACUGCUAAAGUAU86.8429192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392561CCTGGAACTGCTAAAGTATATACTTTAGCAGTTCCAGG0.052000.008700.801701.000001.000001.00000


Target Position: 112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
112GGGGAUGUUGGAAAUUACU80.6952431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183130GGGGATGTTGGAAATTACTAGTAATTTCCAACATCCCC0.406200.069800.784500.750001.000001.00000


Target Position: 1586, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1586CUAUUUCUCUGUGUAUUUA91.914564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461604CTATTTCTCTGTGTATTTATAAATACACAGAGAAATAG0.032900.009200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1584-1606TTCTATTTCTCTGTGTATTTATAUAAAUACACAGAGAAAUAGAACUAUUUCUCUGUGUAUUUAUAU6.96.920


Target Position: 1570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1570UCAGAUUUUAUAUUUUCUA80.5999435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3571588TCAGATTTTATATTTTCTATAGAAAATATAAAATCTGA0.403300.131100.551700.750001.000001.00000


Target Position: 316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
316UCGGAGUACAGCAAGCAGA73.0789829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454334TCGGAGTACAGCAAGCAGATCTGCTTGCTGTACTCCGA0.030600.004500.569000.500000.994600.75000


Target Position: 1851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1851GAAGGGGUGGCUGGGUCUU68.12131096

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691869GAAGGGGTGGCTGGGTCTTAAGACCCAGCCACCCCTTC0.059600.002100.534500.750001.000001.00000


Target Position: 1106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106CCAAUAUGACUAACCAGAA94.696336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131124CCAATATGACTAACCAGAATTCTGGTTAGTCATATTGG0.166500.041100.672401.000001.000001.00000


Target Position: 270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
270CGAUGACUACAUUAAAUUC85.1767250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
291288CGATGACTACATTAAATTCGAATTTAATGTAGTCATCG0.429900.176600.620700.750001.000001.00000


Target Position: 1396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396ACAGAGGAUGAAAAAGAGA80.3772446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901414ACAGAGGATGAAAAAGAGATCTCTTTTTCATCCTCTGT0.956000.475000.482800.500001.000001.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044GCUUCCAUACAAUGACUAC77.1593599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1831062GCTTCCATACAATGACTACGTAGTCATTGTATGGAAGC0.507800.117500.672400.750001.000001.00000


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412AGAAAGACCCAGAGGAGAA89.1692112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651430AGAAAGACCCAGAGGAGAATTCTCCTCTGGGTCTTTCT0.433100.224200.551700.750001.000001.00000


Target Position: 1080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1080AGAUUUCAAGCUCCACAUC66.86511174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401098AGATTTCAAGCTCCACATCGATGTGGAGCTTGAAATCT0.477800.146700.543100.500001.000001.00000


Target Position: 1360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1360AACUCUUCCAACUUCAAAA87.0679183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211378AACTCTTCCAACTTCAAAATTTTGAAGTTGGAAGAGTT0.135800.001200.646600.500001.000001.00000


Target Position: 185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
185UGCUGCUCAACUAUGGUCU64.921286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509203TGCTGCTCAACTATGGTCTAGACCATAGTTGAGCAGCA0.015700.008600.629300.500001.000001.00000


Target Position: 2013, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2013GAGGUUGCUAGUCUAGUUU82.061361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4792031GAGGTTGCTAGTCTAGTTTAAACTAGACTAGCAACCTC0.034200.001900.810300.750001.000001.00000


Target Position: 1361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1361ACUCUUCCAACUUCAAAAA79.7738465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591379ACTCTTCCAACTTCAAAAATTTTTGAAGTTGGAAGAGT0.150500.002400.706900.750001.000001.00000


Target Position: 1486, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1486GUCAAGGAGGAGGUCAAGU67.86831113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701504GTCAAGGAGGAGGTCAAGTACTTGACCTCCTCCTTGAC0.025700.007200.612100.500001.000001.00000


Target Position: 1694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1694GCCACCUUGCCACCCAUUC55.19951769

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5201712GCCACCTTGCCACCCATTCGAATGGGTGGCAAGGTGGC0.138000.001200.827600.750000.983700.62500


Target Position: 912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912GUGUGUGGAAUUUGUCAAG72.4881865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404930GTGTGTGGAATTTGTCAAGCTTGACAAATTCCACACAC0.151700.009800.655200.500001.000001.00000


Target Position: 1594, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594CUGUGUAUUUAUAUAAAAA100.8523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121612CTGTGTATTTATATAAAAATTTTTATATAAATACACAG0.057500.004100.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1592-1614CTCTGTGTATTTATATAAAAATTUUUUUAUAUAAAUACACAGAGCUGUGUAUUUAUAUAAAAAUUU-7.520.420


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768GUCCUAUGAGGCCAUUUUC68.29331090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
481786GTCCTATGAGGCCATTTTCGAAAATGGCCTCATAGGAC0.076300.008500.646600.500000.956500.75000


Target Position: 398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
398UGUCUACUGGUGGUUCUGU67.29521147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494416TGTCTACTGGTGGTTCTGTACAGAACCACCAGTAGACA0.019800.004000.500000.500001.000001.00000


Target Position: 88, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
88AGGAAAGUCUGUUACUACU83.8158284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393106AGGAAAGTCTGTTACTACTAGTAGTAACAGACTTTCCT0.178300.093300.637900.500001.000001.00000


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722AGUAUUAUGCUGUUAACUA94.410839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
399740AGTATTATGCTGTTAACTATAGTTAACAGCATAATACT0.117200.014200.534500.750001.000001.00000


Target Position: 1773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1773UGCAACCAUAAGACAAACU65.12761274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921791TGCAACCATAAGACAAACTAGTTTGTCTTATGGTTGCA0.402200.047900.646600.500001.000001.00000


Target Position: 920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
920AAUUUGUCAAGAGCUUUAA79.1624492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
509938AATTTGTCAAGAGCTTTAATTAAAGCTCTTGACAAATT0.358600.122200.474100.500001.000001.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656UUCAUAAGUAUGGAGAGUA76.329634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
521674TTCATAAGTATGGAGAGTATACTCTCCATACTTATGAA0.043400.008600.491400.500001.000001.00000


Target Position: 83, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
83CCCGGAGGAAAGUCUGUUA86.3475211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441101CCCGGAGGAAAGTCTGTTATAACAGACTTTCCTCCGGG0.096500.003100.956901.000000.962000.75000


Target Position: 1901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1901AGUAACAUCAGCCAUUUUU73.7955776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4291919AGTAACATCAGCCATTTTTAAAAATGGCTGATGTTACT0.040700.026900.706900.750000.967400.75000


Target Position: 1478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1478CCAAAGGGGUCAAGGAGGA74.9581718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031496CCAAAGGGGTCAAGGAGGATCCTCCTTGACCCCTTTGG0.080800.006600.474100.750001.000001.00000


Target Position: 1141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1141GAGAAGAUCAAACAGCGAC73.492804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791159GAGAAGATCAAACAGCGACGTCGCTGTTTGATCTTCTC0.030500.020700.491400.500001.000001.00000


Target Position: 273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
273UGACUACAUUAAAUUCUUG74.5226742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
442291TGACTACATTAAATTCTTGCAAGAATTTAATGTAGTCA0.174100.102700.577600.500001.000001.00000


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430AGAAAGAAGUCACCGAAGA81.1537404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761448AGAAAGAAGTCACCGAAGATCTTCGGTGACTTCTTTCT0.084800.046200.500000.500001.000001.00000


Target Position: 1980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1980CCCUCUGUCUGUCUUCUCC67.73121117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981998CCCTCTGTCTGTCTTCTCCGGAGAAGACAGACAGAGGG0.264200.207000.620700.500001.000001.00000


Target Position: 1378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1378AAAGCCAAGAGAGUCAAAA78.1029548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411396AAAGCCAAGAGAGTCAAAATTTTGACTCTCTTGGCTTT0.338600.257500.500000.500001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583GACAUUGAUAUUCACCAUG72.2982878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526601GACATTGATATTCACCATGCATGGTGAATATCAATGTC0.012700.009200.663800.500001.000001.00000


Target Position: 56, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
56CGAGCAAGAUGGCGCAGAC79.3887484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
50774CGAGCAAGATGGCGCAGACGTCTGCGCCATCTTGCTCG0.099200.003200.474100.750000.956500.87500


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501GGCAUCUGGCUUCUGUUAC66.04221222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431519GGCATCTGGCTTCTGTTACGTAACAGAAGCCAGATGCC0.081000.003400.819000.750001.000001.00000


Target Position: 416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
416UGGCAAGUGCUGUGAAACU73.3856812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458434TGGCAAGTGCTGTGAAACTAGTTTCACAGCACTTGCCA0.102800.002500.637900.500000.983700.75000


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387AGAGUCAAAACAGAGGAUG60.26151526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4131405AGAGTCAAAACAGAGGATGCATCCTCTGTTTTGACTCT0.487300.188400.569000.500001.000001.00000


Target Position: 2031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2031UCCUUUUUGAGAUACUAUU70.0128999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3692049TCCTTTTTGAGATACTATTAATAGTATCTCAAAAAGGA0.125400.006500.862100.750001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823CCUAGUGCGGUGGUCUUAC64.15881332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514841CCTAGTGCGGTGGTCTTACGTAAGACCACCGCACTAGG0.014700.005100.663800.750000.962000.75000


Target Position: 2033, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2033CUUUUUGAGAUACUAUUUU76.1611643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3652051CTTTTTGAGATACTATTTTAAAATAGTATCTCAAAAAG0.066700.014600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2031-2053TCCTTTTTGAGATACTATTTTCAAAAAUAGUAUCUCAAAAAGGACUUUUUGAGAUACUAUUUUCAU4.67.720


Target Position: 2064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2064CCUCUUUGUAAUAAAAUGG64.99491283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082082CCTCTTTGTAATAAAATGGCCATTTTATTACAAAGAGG0.015800.010300.500000.500001.000001.00000


Target Position: 156, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
156GCCUCACCGAAUCCGCAUG63.2311384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
309174GCCTCACCGAATCCGCATGCATGCGGATTCGGTGAGGC0.098100.010900.844800.750000.967400.62500


Target Position: 1278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1278CUCGAUCUGCUCCUCUGAC66.96251168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271296CTCGATCTGCTCCTCTGACGTCAGAGGAGCAGATCGAG0.032400.001100.491400.500001.000001.00000


Target Position: 1630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1630UCCCCAGGGACAGAAACCA63.35741377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001648TCCCCAGGGACAGAAACCATGGTTTCTGTCCCTGGGGA0.343700.006500.525900.500000.956500.62500


Target Position: 299, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
299UCCGUCCAGAUAACAUGUC49.51941921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402317TCCGTCCAGATAACATGTCGACATGTTATCTGGACGGA0.063900.041300.551700.500001.000001.00000


Target Position: 49, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
49CGGGAGGCGAGCAAGAUGG58.58941612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46467CGGGAGGCGAGCAAGATGGCCATCTTGCTCGCCTCCCG0.037600.002800.569000.500001.000001.00000


Target Position: 1984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1984CUGUCUGUCUUCUCCUAAU88.2179144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1922002CTGTCTGTCTTCTCCTAATATTAGGAGAAGACAGACAG0.552900.206000.775900.750001.000001.00000


Target Position: 1824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1824GGAAAGGUGCCCUUAUUGA87.5139169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091842GGAAAGGTGCCCTTATTGATCAATAAGGGCACCTTTCC0.045300.011100.646600.750000.951100.87500


Target Position: 512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512UCUGUUACGUCAAUGAUAU78.0282552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275530TCTGTTACGTCAATGATATATATCATTGACGTAACAGA0.117000.062200.681000.750001.000001.00000


Target Position: 1442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1442CCGAAGAGGAGAAAACCAA86.0002223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1761460CCGAAGAGGAGAAAACCAATTGGTTTTCTCCTCTTCGG0.232200.045700.767201.000000.962000.75000


Target Position: 708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
708GGCUGGCAAAGGCAAGUAU82.6797327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452726GGCTGGCAAAGGCAAGTATATACTTGCCTTTGCCAGCC0.031300.003200.956901.000000.967400.62500


Target Position: 657, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657UCAUAAGUAUGGAGAGUAC73.7255786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
507675TCATAAGTATGGAGAGTACGTACTCTCCATACTTATGA0.067800.008600.543100.500001.000001.00000


Target Position: 203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
203UCUACCGAAAAAUGGAAAU61.66051459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
259221TCTACCGAAAAATGGAAATATTTCCATTTTTCGGTAGA0.195400.056900.715500.750001.000001.00000


Target Position: 1917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1917UUUAGAUUGGUUCUGUUUU64.3611319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331935TTTAGATTGGTTCTGTTTTAAAACAGAACCAATCTAAA0.133900.004300.500000.500001.000001.00000


Target Position: 40, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
40CGGUAGGGACGGGAGGCGA73.0201833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
46758CGGTAGGGACGGGAGGCGATCGCCTCCCGTCCCTACCG0.033900.002200.620700.750001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899AAAGUAACAUCAGCCAUUU77.7915568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051917AAAGTAACATCAGCCATTTAAATGGCTGATGTTACTTT0.048400.039100.500000.500000.967400.87500


Target Position: 1118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1118ACCAGAACACGAAUGAGUA88.9135119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2051136ACCAGAACACGAATGAGTATACTCATTCGTGTTCTGGT0.175900.033800.672400.750001.000001.00000


Target Position: 2030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2030UUCCUUUUUGAGAUACUAU72.9759836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4602048TTCCTTTTTGAGATACTATATAGTATCTCAAAAAGGAA0.090700.002400.629300.500001.000001.00000


Target Position: 1279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279UCGAUCUGCUCCUCUGACA75.2975703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581297TCGATCTGCTCCTCTGACATGTCAGAGGAGCAGATCGA0.050700.007400.586200.500001.000001.00000


Target Position: 2018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2018UGCUAGUCUAGUUUCCUUU73.7556780

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4742036TGCTAGTCTAGTTTCCTTTAAAGGAAACTAGACTAGCA0.024000.015600.853400.750001.000001.00000


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973CUGCCUGCCCUCUGUCUGU71.4927920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3221991CTGCCTGCCCTCTGTCTGTACAGACAGAGGGCAGGCAG0.224100.037500.577600.500001.000001.00000


Target Position: 1245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245CGAUGAGGACGAAGACGAC82.213357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991263CGATGAGGACGAAGACGACGTCGTCTTCGTCCTCATCG0.162600.003100.474100.750001.000001.00000


Target Position: 835, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
835GUCUUACAGUGUGGCUCAG70.3367982

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519853GTCTTACAGTGTGGCTCAGCTGAGCCACACTGTAAGAC0.014300.002200.534500.500001.000001.00000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390GUCAAAACAGAGGAUGAAA87.9364153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1501408GTCAAAACAGAGGATGAAATTTCATCCTCTGTTTTGAC0.530300.452800.819000.750001.000001.00000


Target Position: 336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
336GCAGAGAUUCAACGUUGGU76.5577621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
459354GCAGAGATTCAACGTTGGTACCAACGTTGAATCTCTGC0.086500.033300.500000.750001.000001.00000


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876AGGUUGCUUCAAUCUAACU77.6893571

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353894AGGTTGCTTCAATCTAACTAGTTAGATTGAAGCAACCT0.073900.015800.637900.500001.000001.00000


Target Position: 1232, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232CUGAGGAGAGUGGCGAUGA77.8622562

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241250CTGAGGAGAGTGGCGATGATCATCGCCACTCTCCTCAG0.016100.001100.560300.500001.000001.00000


Target Position: 882, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
882CUUCAAUCUAACUAUCAAA95.241530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458900CTTCAATCTAACTATCAAATTTGATAGTTAGATTGAAG0.029400.010000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
880-902TGCTTCAATCTAACTATCAAAGGUUUGAUAGUUAGAUUGAAGCACUUCAAUCUAACUAUCAAAGGU13.416.330


Target Position: 1088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1088AGCUCCACAUCAGUCCUUC63.9231343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441106AGCTCCACATCAGTCCTTCGAAGGACTGATGTGGAGCT0.077400.053800.681000.500001.000001.00000


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544CUGGAACUGCUAAAGUAUC69.40541022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460562CTGGAACTGCTAAAGTATCGATACTTTAGCAGTTCCAG0.051200.007300.603400.500001.000001.00000


Target Position: 2011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2011UGGAGGUUGCUAGUCUAGU65.17571270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5182029TGGAGGTTGCTAGTCTAGTACTAGACTAGCAACCTCCA0.045800.001200.637900.500001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046UUCCAUACAAUGACUACUU68.33131085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3841064TTCCATACAATGACTACTTAAGTAGTCATTGTATGGAA0.397900.118900.534500.500001.000001.00000


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161GUUUGAGAACCUUAGAAUG77.086601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4881179GTTTGAGAACCTTAGAATGCATTCTAAGGTTCTCAAAC0.066300.001800.491400.500001.000001.00000


Target Position: 1381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1381GCCAAGAGAGUCAAAACAG75.7747672

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1241399GCCAAGAGAGTCAAAACAGCTGTTTTGACTCTCTTGGC0.394300.218800.715500.750001.000001.00000


Target Position: 1777, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1777ACCAUAAGACAAACUCCUG68.1291095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3351795ACCATAAGACAAACTCCTGCAGGAGTTTGTCTTATGGT0.270100.247400.569000.500000.956500.62500


Target Position: 1065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1065UGAAUACUUUGGACCAGAU82.3951347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3831083TGAATACTTTGGACCAGATATCTGGTCCAAAGTATTCA0.057900.011600.543100.750001.000001.00000


Target Position: 266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
266ACAGCGAUGACUACAUUAA87.6514164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275284ACAGCGATGACTACATTAATTAATGTAGTCATCGCTGT0.513400.061600.672400.750000.989100.62500


Target Position: 315, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
315GUCGGAGUACAGCAAGCAG74.9724717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510333GTCGGAGTACAGCAAGCAGCTGCTTGCTGTACTCCGAC0.021200.004400.534500.500000.994600.62500


Target Position: 180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
180UAAUUUGCUGCUCAACUAU75.5172690

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
518198TAATTTGCTGCTCAACTATATAGTTGAGCAGCAAATTA0.193700.062600.491400.500001.000001.00000


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463AGGAGAAGCCAGAAGCCAA91.87766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291481AGGAGAAGCCAGAAGCCAATTGGCTTCTGGCTTCTCCT0.293100.073900.698300.750000.907600.75000


Target Position: 1456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1456ACCAAGGAGGAGAAGCCAG59.87661549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901474ACCAAGGAGGAGAAGCCAGCTGGCTTCTCCTCCTTGGT0.205100.054500.569000.500000.978300.75000


Target Position: 1078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078CCAGAUUUCAAGCUCCACA84.7721265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2391096CCAGATTTCAAGCTCCACATGTGGAGCTTGAAATCTGG0.397200.116600.637900.750000.972800.62500


Target Position: 1926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1926GUUCUGUUUUCGUACCUUC72.8211843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981944GTTCTGTTTTCGTACCTTCGAAGGTACGAAAACAGAAC0.471800.123200.474100.500001.000001.00000


Target Position: 1571, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571CAGAUUUUAUAUUUUCUAU92.165960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981589CAGATTTTATATTTTCTATATAGAAAATATAAAATCTG0.410200.162300.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1569-1591CTCAGATTTTATATTTTCTATTTAUAGAAAAUAUAAAAUCUGAGCAGAUUUUAUAUUUUCUAUUUU7.15.320


Target Position: 1974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974UGCCUGCCCUCUGUCUGUC54.7391784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3851992TGCCTGCCCTCTGTCTGTCGACAGACAGAGGGCAGGCA0.214200.036500.534500.500001.000001.00000


Target Position: 1441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441ACCGAAGAGGAGAAAACCA78.6147520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241459ACCGAAGAGGAGAAAACCATGGTTTTCTCCTCTTCGGT0.207600.043700.508600.500000.962000.75000


Target Position: 770, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
770CCUAUGAGGCCAUUUUCAA88.5916129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
275788CCTATGAGGCCATTTTCAATTGAAAATGGCCTCATAGG0.506300.016900.698301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
768-790GTCCTATGAGGCCATTTTCAAGCUUGAAAAUGGCCUCAUAGGACCCUAUGAGGCCAUUUUCAAGCU7.417.820


Target Position: 873, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
873GUUAGGUUGCUUCAAUCUA87.7422161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
871-893CGGTTAGGTTGCTTCAATCTAACUAGAUUGAAGCAACCUAACCGGUUAGGUUGCUUCAAUCUAACU20.418.630


Target Position: 47, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
47GACGGGAGGCGAGCAAGAU79.0126498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
42665GACGGGAGGCGAGCAAGATATCTTGCTCGCCTCCCGTC0.214700.003700.637900.750001.000001.00000


Target Position: 2038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2038UGAGAUACUAUUUUCAUUU77.8982559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3912056TGAGATACTATTTTCATTTAAATGAAAATAGTATCTCA0.101300.005000.724100.750001.000001.00000


Target Position: 1850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850AGAAGGGGUGGCUGGGUCU68.0271102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031868AGAAGGGGTGGCTGGGTCTAGACCCAGCCACCCCTTCT0.044000.001400.500000.500001.000001.00000


Target Position: 272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
272AUGACUACAUUAAAUUCUU78.9166501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409290ATGACTACATTAAATTCTTAAGAATTTAATGTAGTCAT0.243000.126100.517200.500001.000001.00000


Target Position: 424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
424GCUGUGAAACUUAAUAAGC67.20351153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
511442GCTGTGAAACTTAATAAGCGCTTATTAAGTTTCACAGC0.015300.007200.500000.500001.000001.00000


Target Position: 2058, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2058UGUGAGCCUCUUUGUAAUA82.3495349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2982076TGTGAGCCTCTTTGTAATATATTACAAAGAGGCTCACA0.308400.013100.663800.750001.000001.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834GGUCUUACAGUGUGGCUCA92.376656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447852GGTCTTACAGTGTGGCTCATGAGCCACACTGTAAGACC0.032900.004700.629300.750001.000001.00000


Target Position: 1906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906CAUCAGCCAUUUUUAGAUU84.9748256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801924CATCAGCCATTTTTAGATTAATCTAAAAATGGCTGATG0.111900.005800.646600.750001.000001.00000


Target Position: 326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
326GCAAGCAGAUGCAGAGAUU87.0896182

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
373344GCAAGCAGATGCAGAGATTAATCTCTGCATCTGCTTGC0.064200.016600.844801.000000.929300.62500


Target Position: 1487, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1487UCAAGGAGGAGGUCAAGUU72.4595868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951505TCAAGGAGGAGGTCAAGTTAACTTGACCTCCTCCTTGA0.019800.004700.577600.750001.000001.00000


Target Position: 1696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1696CACCUUGCCACCCAUUCUU72.6131858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4751714CACCTTGCCACCCATTCTTAAGAATGGGTGGCAAGGTG0.315900.002000.655200.750001.000001.00000


Target Position: 138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
138ACAAGGCCACCCAAUGAAG64.50851312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
440156ACAAGGCCACCCAATGAAGCTTCATTGGGTGGCCTTGT0.064300.003100.569000.500000.940201.00000


Target Position: 1587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1587UAUUUCUCUGUGUAUUUAU76.9214607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611605TATTTCTCTGTGTATTTATATAAATACACAGAGAAATA0.027700.007600.500000.500001.000001.00000


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108CGACGGGGAUGUUGGAAAU84.5046271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489126CGACGGGGATGTTGGAAATATTTCCAACATCCCCGTCG0.122800.001800.784501.000001.000001.00000


Target Position: 311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
311ACAUGUCGGAGUACAGCAA86.3438212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501329ACATGTCGGAGTACAGCAATTGCTGTACTCCGACATGT0.040200.001500.560300.750001.000001.00000


Target Position: 167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
167UCCGCAUGACUCAUAAUUU76.3102639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
263185TCCGCATGACTCATAATTTAAATTATGAGTCATGCGGA0.131900.025600.870700.750001.000001.00000


Target Position: 1602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1602UUAUAUAAAAAUUUAUUAA88.3147141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911620TTATATAAAAATTTATTAATTAATAAATTTTTATATAA0.334300.016300.500000.500001.000001.00000


Target Position: 1742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1742GUGCCAGGUCUGGGUGAAA84.3157276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241760GTGCCAGGTCTGGGTGAAATTTCACCCAGACCTGGCAC0.012800.003500.793100.750000.945700.87500


Target Position: 881, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
881GCUUCAAUCUAACUAUCAA103.4712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468899GCTTCAATCTAACTATCAATTGATAGTTAGATTGAAGC0.026700.009200.706901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
879-901TTGCTTCAATCTAACTATCAAAGUUGAUAGUUAGAUUGAAGCAAGCUUCAAUCUAACUAUCAAAGU20.312.030


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824CUAGUGCGGUGGUCUUACA87.9847152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
528842CTAGTGCGGTGGTCTTACATGTAAGACCACCGCACTAG0.011800.003500.465500.500001.000001.00000


Target Position: 267, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
267CAGCGAUGACUACAUUAAA99.16798

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_426719CAGCGATGACTACATTAAA1/1/0/094.96HDAC1NM_004964.21NANANANA00HDAC1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125285CAGCGATGACTACATTAAATTTAATGTAGTCATCGCTG0.612000.067300.784500.750001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159CUGUUUGAGAACCUUAGAA86.9628188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4801177CTGTTTGAGAACCTTAGAATTCTAAGGTTCTCAAACAG0.095400.001900.612100.750001.000001.00000


Target Position: 1898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1898UAAAGUAACAUCAGCCAUU75.1012711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4021916TAAAGTAACATCAGCCATTAATGGCTGATGTTACTTTA0.057600.046700.525900.500000.967400.75000


Target Position: 207, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
207CCGAAAAAUGGAAAUCUAU84.1839279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
209225CCGAAAAATGGAAATCTATATAGATTTCCATTTTTCGG0.169600.060600.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
205-227TACCGAAAAATGGAAATCTATCGAUAGAUUUCCAUUUUUCGGUACCGAAAAAUGGAAAUCUAUCGU6.97.720


Target Position: 269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
269GCGAUGACUACAUUAAAUU83.5492294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
59287GCGATGACTACATTAAATTAATTTAATGTAGTCATCGC0.434000.145900.913801.000001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036CCUAAUGAGCUUCCAUACA83.2977306

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2521054CCTAATGAGCTTCCATACATGTATGGAAGCTCATTAGG0.140800.058200.637900.750001.000001.00000


Target Position: 449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
449CGGACAUCGCUGUGAAUUG76.6687617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487467CGGACATCGCTGTGAATTGCAATTCACAGCGATGTCCG0.026100.001800.767200.750001.000001.00000


Target Position: 264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
264CCACAGCGAUGACUACAUU87.683163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141282CCACAGCGATGACTACATTAATGTAGTCATCGCTGTGG0.330400.059300.836201.000000.989100.87500


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465GAGAAGCCAGAAGCCAAAG66.40991202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3681483GAGAAGCCAGAAGCCAAAGCTTTGGCTTCTGGCTTCTC0.066000.017900.672400.500000.907601.00000


Target Position: 1902, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1902GUAACAUCAGCCAUUUUUA93.07953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111920GTAACATCAGCCATTTTTATAAAAATGGCTGATGTTAC0.044400.018700.646600.750000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1900-1922AAGTAACATCAGCCATTTTTAGAUAAAAAUGGCUGAUGUUACUUGUAACAUCAGCCAUUUUUAGAU-3.316.120


Target Position: 994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
994UGCUGGACAUAUGAGACAG69.54911016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711012TGCTGGACATATGAGACAGCTGTCTCATATGTCCAGCA0.029800.002000.569000.500001.000001.00000


Target Position: 993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
993GUGCUGGACAUAUGAGACA84.8553260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201011GTGCTGGACATATGAGACATGTCTCATATGTCCAGCAC0.041600.005100.586200.500001.000001.00000


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900AAGUAACAUCAGCCAUUUU81.8344371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571918AAGTAACATCAGCCATTTTAAAATGGCTGATGTTACTT0.041500.035300.637900.500000.967400.87500


Target Position: 1721, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1721CUUAACUUUGAACCAUAAA80.8209425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1719-1741TTCTTAACTTTGAACCATAAAGGUUUAUGGUUCAAAGUUAAGAACUUAACUUUGAACCAUAAAGGU20.04.920


Target Position: 312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312CAUGUCGGAGUACAGCAAG69.22181034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463330CATGTCGGAGTACAGCAAGCTTGCTGTACTCCGACATG0.027400.002400.517200.500001.000001.00000


Target Position: 256, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
256ACCAAGUACCACAGCGAUG63.29171380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
445274ACCAAGTACCACAGCGATGCATCGCTGTGGTACTTGGT0.097000.070900.698300.500001.000001.00000


Target Position: 1569, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569CUCAGAUUUUAUAUUUUCU83.1529313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3161587CTCAGATTTTATATTTTCTAGAAAATATAAAATCTGAG0.416300.127100.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1567-1589CCCTCAGATTTTATATTTTCTATAGAAAAUAUAAAAUCUGAGGGCUCAGAUUUUAUAUUUUCUAUU2.120.420


Target Position: 1017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1017GGCCCUGGAUACGGAGAUC68.35941084

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211035GGCCCTGGATACGGAGATCGATCTCCGTATCCAGGGCC0.013400.001900.819000.750000.929300.75000


Target Position: 763, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
763GACGAGUCCUAUGAGGCCA82.9748317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506781GACGAGTCCTATGAGGCCATGGCCTCATAGGACTCGTC0.023800.002800.474100.500000.934800.62500


Target Position: 50, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
50GGGAGGCGAGCAAGAUGGC60.42091514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
47268GGGAGGCGAGCAAGATGGCGCCATCTTGCTCGCCTCCC0.290900.002800.491400.500001.000001.00000


Target Position: 85, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
85CGGAGGAAAGUCUGUUACU82.3368351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
226103CGGAGGAAAGTCTGTTACTAGTAACAGACTTTCCTCCG0.241800.029700.706900.750001.000001.00000


Target Position: 417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
417GGCAAGUGCUGUGAAACUU82.5173339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414435GGCAAGTGCTGTGAAACTTAAGTTTCACAGCACTTGCC0.090600.004100.862101.000000.983700.75000


Target Position: 836, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
836UCUUACAGUGUGGCUCAGA69.98181003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
489854TCTTACAGTGTGGCTCAGATCTGAGCCACACTGTAAGA0.020700.002800.500000.500001.000001.00000


Target Position: 1706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1706CCCAUUCUUCCCGUUCUUA78.7297515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2881724CCCATTCTTCCCGTTCTTATAAGAACGGGAAGAATGGG0.108200.110000.956901.000001.000001.00000


Target Position: 1705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1705ACCCAUUCUUCCCGUUCUU67.01071164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701723ACCCATTCTTCCCGTTCTTAAGAACGGGAAGAATGGGT0.118700.119400.715500.750001.000001.00000


Target Position: 165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
165AAUCCGCAUGACUCAUAAU83.5234295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
440183AATCCGCATGACTCATAATATTATGAGTCATGCGGATT0.263100.035700.500000.500001.000001.00000


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513CUGUUACGUCAAUGAUAUC75.6289677

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
374531CTGTTACGTCAATGATATCGATATCATTGACGTAACAG0.074400.052900.603400.500001.000001.00000


Target Position: 1399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1399GAGGAUGAAAAAGAGAAAG70.4366978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521417GAGGATGAAAAAGAGAAAGCTTTCTCTTTTTCATCCTC0.821400.422700.672400.500001.000001.00000


Target Position: 1417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1417GACCCAGAGGAGAAGAAAG78.2981536

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141435GACCCAGAGGAGAAGAAAGCTTTCTTCTCCTCTGGGTC0.724400.279800.681000.500001.000001.00000


Target Position: 1978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1978UGCCCUCUGUCUGUCUUCU67.07041162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431996TGCCCTCTGTCTGTCTTCTAGAAGACAGACAGAGGGCA0.238300.201800.629300.500001.000001.00000


Target Position: 689, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
689GGGACCUACGGGAUAUCGG62.36481424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
523707GGGACCTACGGGATATCGGCCGATATCCCGTAGGTCCC0.012900.001400.577600.500001.000001.00000


Target Position: 1835, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1835CUUAUUGAACAUUCUAGAA90.699688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121853CTTATTGAACATTCTAGAATTCTAGAATGTTCAATAAG0.024500.024600.465500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1833-1855CCCTTATTGAACATTCTAGAAGGUUCUAGAAUGUUCAAUAAGGGCUUAUUGAACAUUCUAGAAGGU20.28.920


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928AAGAGCUUUAACCUGCCUA77.4624581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
514946AAGAGCTTTAACCTGCCTATAGGCAGGTTAAAGCTCTT0.036000.003800.465500.500000.907600.62500


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897CUAAAGUAACAUCAGCCAU80.9655414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101915CTAAAGTAACATCAGCCATATGGCTGATGTTACTTTAG0.088500.053800.517200.750000.967400.62500


Target Position: 2060, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2060UGAGCCUCUUUGUAAUAAA87.1779177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1602078TGAGCCTCTTTGTAATAAATTTATTACAAAGAGGCTCA0.223300.065600.724100.750001.000001.00000


Target Position: 1631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1631CCCCAGGGACAGAAACCAA86.3377213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3661649CCCCAGGGACAGAAACCAATTGGTTTCTGTCCCTGGGG0.346600.006700.844801.000001.000001.00000


Target Position: 1982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1982CUCUGUCUGUCUUCUCCUA91.758568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2492000CTCTGTCTGTCTTCTCCTATAGGAGAAGACAGACAGAG0.546800.203900.637900.750001.000001.00000


Target Position: 1377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377AAAAGCCAAGAGAGUCAAA83.6218292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301395AAAAGCCAAGAGAGTCAAATTTGACTCTCTTGGCTTTT0.313900.251800.500000.500001.000001.00000


Target Position: 248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
248AGGAGAUGACCAAGUACCA87.2991175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506266AGGAGATGACCAAGTACCATGGTACTTGGTCATCTCCT0.458800.051400.500000.500000.962000.75000


Target Position: 1254, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1254CGAAGACGACCCUGACAAG81.7008378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2731272CGAAGACGACCCTGACAAGCTTGTCAGGGTCGTCTTCG0.120400.017200.655200.750001.000001.00000


Target Position: 1056, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1056UGACUACUUUGAAUACUUU84.6117266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2781074TGACTACTTTGAATACTTTAAAGTATTCAAAGTAGTCA0.230800.122700.724100.750001.000001.00000


Target Position: 395, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395AGUUGUCUACUGGUGGUUC66.35841205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
517413AGTTGTCTACTGGTGGTTCGAACCACCAGTAGACAACT0.072400.001200.534500.500001.000001.00000


Target Position: 712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
712GGCAAAGGCAAGUAUUAUG77.1048600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
419730GGCAAAGGCAAGTATTATGCATAATACTTGCCTTTGCC0.041800.004100.844800.750001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412UCUGUGGCAAGUGCUGUGA63.67491357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
519430TCTGTGGCAAGTGCTGTGATCACAGCACTTGCCACAGA0.071800.001200.500000.500000.983701.00000


Target Position: 86, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
86GGAGGAAAGUCUGUUACUA99.45225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
266104GGAGGAAAGTCTGTTACTATAGTAACAGACTTTCCTCC0.121200.030500.698301.000001.000001.00000


Target Position: 573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
573GCUGUACAUUGACAUUGAU91.27976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188591GCTGTACATTGACATTGATATCAATGTCAATGTACAGC0.262200.073200.672401.000001.000001.00000


Target Position: 1547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1547CCUCACGUUUCUUCCCCAA81.5303382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1591565CCTCACGTTTCTTCCCCAATTGGGGAAGAAACGTGAGG0.729300.616600.698301.000001.000001.00000


Target Position: 499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
499GAGGCAUCUGGCUUCUGUU88.3206140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
515517GAGGCATCTGGCTTCTGTTAACAGAAGCCAGATGCCTC0.019400.001300.663800.750001.000001.00000


Target Position: 877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
877GGUUGCUUCAAUCUAACUA91.649969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341895GGTTGCTTCAATCTAACTATAGTTAGATTGAAGCAACC0.080100.023700.681001.000001.000001.00000


Target Position: 204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
204CUACCGAAAAAUGGAAAUC60.22671530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475222CTACCGAAAAATGGAAATCGATTTCCATTTTTCGGTAG0.194000.056900.491400.500001.000001.00000


Target Position: 1462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1462GAGGAGAAGCCAGAAGCCA82.5489337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281480GAGGAGAAGCCAGAAGCCATGGCTTCTGGCTTCTCCTC0.296700.042400.465500.500000.907600.62500


Target Position: 1262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1262ACCCUGACAAGCGCAUCUC54.45691795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221280ACCCTGACAAGCGCATCTCGAGATGCGCTTGTCAGGGT0.061200.020200.543100.500000.945700.62500


Target Position: 1703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1703CCACCCAUUCUUCCCGUUC57.3151676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291721CCACCCATTCTTCCCGTTCGAACGGGAAGAATGGGTGG0.142700.070700.672400.750001.000001.00000


Target Position: 1573, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573GAUUUUAUAUUUUCUAUUU91.326674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1751591GATTTTATATTTTCTATTTAAATAGAAAATATAAAATC0.425600.323000.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1571-1593CAGATTTTATATTTTCTATTTCTAAAUAGAAAAUAUAAAAUCUGGAUUUUAUAUUUUCUAUUUCUU6.9-10.320


Target Position: 1985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985UGUCUGUCUUCUCCUAAUU75.1908706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1452003TGTCTGTCTTCTCCTAATTAATTAGGAGAAGACAGACA0.605500.208200.698300.750001.000001.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231CCUGAGGAGAGUGGCGAUG57.88081651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101249CCTGAGGAGAGTGGCGATGCATCGCCACTCTCCTCAGG0.015700.001700.689700.750001.000001.00000


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470GCCAGAAGCCAAAGGGGUC63.77561350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771488GCCAGAAGCCAAAGGGGTCGACCCCTTTGGCTTCTGGC0.023800.008000.681000.750001.000001.00000


Target Position: 168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
168CCGCAUGACUCAUAAUUUG75.9458656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
293186CCGCATGACTCATAATTTGCAAATTATGAGTCATGCGG0.105700.020900.767200.750001.000001.00000


Target Position: 1416, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1416AGACCCAGAGGAGAAGAAA83.1365314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2551434AGACCCAGAGGAGAAGAAATTTCTTCTCCTCTGGGTCT0.745200.212400.724100.750001.000001.00000


Target Position: 1695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1695CCACCUUGCCACCCAUUCU75.3556698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5141713CCACCTTGCCACCCATTCTAGAATGGGTGGCAAGGTGG0.209500.001300.620700.750001.000001.00000


Target Position: 1142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1142AGAAGAUCAAACAGCGACU77.5659577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911160AGAAGATCAAACAGCGACTAGTCGCTGTTTGATCTTCT0.020600.011600.517200.500001.000001.00000


Target Position: 107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
107ACGACGGGGAUGUUGGAAA75.9937650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513125ACGACGGGGATGTTGGAAATTTCCAACATCCCCGTCGT0.113100.001400.775900.750001.000001.00000


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597UGUAUUUAUAUAAAAAUUU74.324756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3441615TGTATTTATATAAAAATTTAAATTTTTATATAAATACA0.319500.008100.706900.750001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240AGUGGCGAUGAGGACGAAG61.84941449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281258AGTGGCGATGAGGACGAAGCTTCGTCCTCATCGCCACT0.013400.002800.569000.500001.000001.00000


Target Position: 1603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603UAUAUAAAAAUUUAUUAAA89.534107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261621TATATAAAAATTTATTAAATTTAATAAATTTTTATATA0.095900.019200.543100.500001.000001.00000


Target Position: 1607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1607UAAAAAUUUAUUAAAUAUA88.3608139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4761625TAAAAATTTATTAAATATATATATTTAATAAATTTTTA0.098900.021500.491400.500001.000001.00000


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076GACCAGAUUUCAAGCUCCA89.8063100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5251094GACCAGATTTCAAGCTCCATGGAGCTTGAAATCTGGTC0.424100.094500.474100.500000.972800.62500


Target Position: 1030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030GAGAUCCCUAAUGAGCUUC61.71391456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781048GAGATCCCTAATGAGCTTCGAAGCTCATTAGGGATCTC0.116700.032000.637900.500000.956501.00000


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055AUGACUACUUUGAAUACUU81.414392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111073ATGACTACTTTGAATACTTAAGTATTCAAAGTAGTCAT0.281800.243900.517200.500001.000001.00000


Target Position: 1825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1825GAAAGGUGCCCUUAUUGAA95.151132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4601843GAAAGGTGCCCTTATTGAATTCAATAAGGGCACCTTTC0.059500.010200.500000.750000.951100.75000


Target Position: 2032, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2032CCUUUUUGAGAUACUAUUU82.8239321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2532050CCTTTTTGAGATACTATTTAAATAGTATCTCAAAAAGG0.164800.021200.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2030-2052TTCCTTTTTGAGATACTATTTTCAAAUAGUAUCUCAAAAAGGAACCUUUUUGAGAUACUAUUUUCU6.32.120


Target Position: 1606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1606AUAAAAAUUUAUUAAAUAU89.921396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471624ATAAAAATTTATTAAATATATATTTAATAAATTTTTAT0.086000.019400.500000.500001.000001.00000


Target Position: 1243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243GGCGAUGAGGACGAAGACG64.72011299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821261GGCGATGAGGACGAAGACGCGTCTTCGTCCTCATCGCC0.176100.001900.724100.500001.000001.00000


Target Position: 2026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2026UAGUUUCCUUUUUGAGAUA81.8759369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082044TAGTTTCCTTTTTGAGATATATCTCAAAAAGGAAACTA0.132700.001400.629300.500001.000001.00000


Target Position: 87, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
87GAGGAAAGUCUGUUACUAC87.161178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493105GAGGAAAGTCTGTTACTACGTAGTAACAGACTTTCCTC0.141100.093200.629300.500001.000001.00000


Target Position: 565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
565CAGAGGGUGCUGUACAUUG77.5887574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473583CAGAGGGTGCTGTACATTGCAATGTACAGCACCCTCTG0.108100.002000.637900.500001.000001.00000


Target Position: 244, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
244GCUGAGGAGAUGACCAAGU74.8782722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
405262GCTGAGGAGATGACCAAGTACTTGGTCATCTCCTCAGC0.208100.004400.646600.750000.962001.00000