siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 33   62   63   263   264   265   317   325   327   349   350   351   352   355   356   404   405   409   413   414  
415   457   458   459   460   461   462   464   468   470   471   472   473   474   507   508   509   510   511   513  
514   520   521   522   524   584   585   586   587   588   589   590   591   605   620   629   630   631   641   642  
653   654   655   666   667   668   669   670   679   714   719   721   722   723   724   740   741   743   744   746  
747   748   749   755   758   759   761   762   767   768   771   772   773   784   785   786   787   788   789   791  
792   794   795   796   838   844   845   846   902   903   904   937   938   939   986   987   988   989   990   995  
996   1000   1001   1002   1028   1030   1032   1040   1041   1042   1043   1066   1068   1069   1070   1071   1072   1073   1074   1076  
1077   1078   1081   1082   1083   1084   1100   1101   1102   1103   1105   1106   1107   1108   1173   1174   1175   1176   1207   1210  
1240   1242   1245   1247   1248   1249   1250   1251   1276   1338   1342   1344   1366   1367   1368   1380   1381   1382   1383   1384  
1385   1386   1387   1388   1389   1390   1391   1392   1393   1396   1397  
Biltr, Ernai, Rnaxs 665   1104   1241   1243   1275   1339  
Biltr, Rnaxs, Sidirect 1394   1395  
Biltr, Ernai, Rnaxs, Sidirect 512  
Biltr, Ernai 501   1016   1359  


Target Position: 1338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1338CCUUGUCUCUCACUGCAUU85.146564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971356CCTTGTCTCTCACTGCATTAATGCAGTGAGAGACAAGG0.116600.059700.836201.000001.000001.00000


Target Position: 263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
263GGGGCCCUGGGGUCAGUCU66.7963501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193281GGGGCCCTGGGGTCAGTCTAGACTGACCCCAGGGCCCC0.042400.001400.767200.750000.907600.87500


Target Position: 1104, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1104CCCAGGACUGCAUUGUUUU76.4943201

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3110419CCCAGGACTGCATTGTTTT1/1/0/091.46RHOCNM_001042678.1+NM_175744.4+NM_001042679.11+1+1NANANA1:113244024..113244042(-)00RHOC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1241122CCCAGGACTGCATTGTTTTAAAACAATGCAGTCCTGGG0.391100.007800.991401.000001.000001.00000


Target Position: 508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
508CCUACUGUCUUUGAGAACU76.2013211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131526CCTACTGTCTTTGAGAACTAGTTCTCAAAGACAGTAGG0.069300.023400.637900.750001.000001.00000


Target Position: 1081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1081CUCCCAUUUUCAGUUCCCU69.8613396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1951099CTCCCATTTTCAGTTCCCTAGGGAACTGAAAATGGGAG0.019700.015500.465500.500001.000001.00000


Target Position: 679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
679GAAAACAUUCCUGAGAAGU72.8815304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196697GAAAACATTCCTGAGAAGTACTTCTCAGGAATGTTTTC0.224000.005300.465500.500001.000001.00000


Target Position: 1076, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1076GAAGGCUCCCAUUUUCAGU76.2471209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1991094GAAGGCTCCCATTTTCAGTACTGAAAATGGGAGCCTTC0.021500.002000.465500.500001.000001.00000


Target Position: 461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
461GCCUCCUCAUCGUCUUCAG72.7689308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
53479GCCTCCTCATCGTCTTCAGCTGAAGACGATGAGGAGGC0.217600.048500.715500.750001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590AGGAAGACUAUGAUCGACU77.1985188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195608AGGAAGACTATGATCGACTAGTCGATCATAGTCTTCCT0.096800.014400.637900.500001.000001.00000


Target Position: 522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
522GAACUAUAUUGCGGACAUU88.865229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
138540GAACTATATTGCGGACATTAATGTCCGCAATATAGTTC0.061100.038200.663800.750001.000001.00000


Target Position: 327, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
327CCUUGACUUCAUCUCAGCU83.130388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
194345CCTTGACTTCATCTCAGCTAGCTGAGATGAAGTCAAGG0.016200.005300.491400.750000.983700.62500


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584CAGGGCAGGAAGACUAUGA83.856877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184602CAGGGCAGGAAGACTATGATCATAGTCTTCCTGCCCTG0.095200.001700.560300.500001.000001.00000


Target Position: 1381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1381CUACAGGCUCCAACGUGAA86.060552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1761399CTACAGGCTCCAACGTGAATTCACGTTGGAGCCTGTAG0.333100.007200.500000.750001.000001.00000


Target Position: 1016, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1016CCUUCACAGGGGUACAGAA94.50886

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9101619CCTTCACAGGGGTACAGAA1/1/0/086.96RHOCNM_001042678.1+NM_175744.4+NM_001042679.11+1+1NANANANA00RHOC(0.002)


Target Position: 1248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1248ACCAGCACUUUAUACACUU75.6682225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801266ACCAGCACTTTATACACTTAAGTGTATAAAGTGCTGGT0.152700.034900.715500.750000.989101.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108GGACUGCAUUGUUUUCUAG83.705178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851126GGACTGCATTGTTTTCTAGCTAGAAAACAATGCAGTCC0.138700.043000.698300.750001.000001.00000


Target Position: 1070, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1070CAUGCUGAAGGCUCCCAUU81.9031111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1871088CATGCTGAAGGCTCCCATTAATGGGAGCCTTCAGCATG0.085100.001600.646600.750000.989100.87500


Target Position: 995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
995GCCUUUCCUACAUGCCCCC52.6659980

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1651013GCCTTTCCTACATGCCCCCGGGGGCATGTAGGAAAGGC0.213200.014800.508600.500001.000001.00000


Target Position: 460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
460UGCCUCCUCAUCGUCUUCA66.2782520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190478TGCCTCCTCATCGTCTTCATGAAGACGATGAGGAGGCA0.183300.034300.629300.500001.000001.00000


Target Position: 1339, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1339CUUGUCUCUCACUGCAUUU77.354185

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4133919CTTGTCTCTCACTGCATTT1/1/0/091.46RHOCNM_175744.4+NM_001042678.1+NM_001042679.11+1+1NANANA1:113243789..113243807(-)00RHOC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1011357CTTGTCTCTCACTGCATTTAAATGCAGTGAGAGACAAG0.110300.051400.637900.750001.000001.00000


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509CUACUGUCUUUGAGAACUA93.43018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
174527CTACTGTCTTTGAGAACTATAGTTCTCAAAGACAGTAG0.073900.026500.500000.750001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787AGAGAGCUGGCCAAGAUGA81.189122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168805AGAGAGCTGGCCAAGATGATCATCTTGGCCAGCTCTCT0.380400.008800.500000.500001.000001.00000


Target Position: 511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
511ACUGUCUUUGAGAACUAUA85.209962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
78529ACTGTCTTTGAGAACTATATATAGTTCTCAAAGACAGT0.568700.031200.663800.750001.000001.00000


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654CUCCAUCGACAGCCCUGAC65.6039544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188672CTCCATCGACAGCCCTGACGTCAGGGCTGTCGATGGAG0.089900.032200.491400.500001.000001.00000


Target Position: 938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
938UCCAGGUCCGCAAGAACAA72.3612316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
74956TCCAGGTCCGCAAGAACAATTGTTCTTGCGGACCTGGA0.878600.017500.724100.750000.913000.75000


Target Position: 404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
404UGGCUGCAAUCCGAAAGAA78.8554157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177422TGGCTGCAATCCGAAAGAATTCTTTCGGATTGCAGCCA0.173200.001900.672400.750000.994600.75000


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390CCAACGUGAAAAAAAAAAA85.363561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
111408CCAACGTGAAAAAAAAAAATTTTTTTTTTTCACGTTGG0.994500.421900.844801.000001.000001.00000


Target Position: 665, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665GCCCUGACAGCCUGGAAAA84.153173

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_766519GCCCTGACAGCCTGGAAAA1/1/0/087.68RHOCNM_175744.4+NM_001042678.1+NM_001042679.11+1+1NANANA1:113245312,113245621..113245315,113245635(-)00RHOC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188683GCCCTGACAGCCTGGAAAATTTTCCAGGCTGTCAGGGC0.018600.002701.000001.000000.951100.62500


Target Position: 795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795GGCCAAGAUGAAGCAGGAG69.43409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192813GGCCAAGATGAAGCAGGAGCTCCTGCTTCATCTTGGCC0.017200.011000.689700.750000.934800.62500


Target Position: 62, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
62UCCGCAGUCCAGGAAUCUC56.0852876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
19880TCCGCAGTCCAGGAATCTCGAGATTCCTGGACTGCGGA0.013000.001900.560300.500000.918500.62500


Target Position: 1032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1032GAAAUUAUCCCCCUACAAC76.317206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1581050GAAATTATCCCCCTACAACGTTGTAGGGGGATAATTTC0.273000.225000.525900.500001.000001.00000


Target Position: 773, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
773ACGAGCACACCAGGAGAGA69.0677423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
175791ACGAGCACACCAGGAGAGATCTCTCCTGGTGTGCTCGT0.023900.012400.551700.500001.000001.00000


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473UCUUCAGCAAGGAUCAGUU75.0274243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195491TCTTCAGCAAGGATCAGTTAACTGATCCTTGCTGAAGA0.015800.012600.577600.750000.978300.62500


Target Position: 1241, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1241GUCACACACCAGCACUUUA93.29379

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1124119GTCACACACCAGCACTTTA1/1/0/094.96RHOCNM_175744.4+NM_001042678.1+NM_001042679.11+1+1NANANANA00RHOC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
661259GTCACACACCAGCACTTTATAAAGTGCTGGTGTGTGAC0.253100.059300.784500.750001.000001.00000


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761ACCUGAGGCAAGACGAGCA80.3341140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
177779ACCTGAGGCAAGACGAGCATGCTCGTCTTGCCTCAGGT0.213400.034400.500000.500000.983700.75000


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382UACAGGCUCCAACGUGAAA76.4688202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1741400TACAGGCTCCAACGTGAAATTTCACGTTGGAGCCTGTA0.339700.007800.681000.500001.000001.00000


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514GUCUUUGAGAACUAUAUUG74.4888258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131532GTCTTTGAGAACTATATTGCAATATAGTTCTCAAAGAC0.172100.006900.672400.500001.000001.00000


Target Position: 474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474CUUCAGCAAGGAUCAGUUU77.5855180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172492CTTCAGCAAGGATCAGTTTAAACTGATCCTTGCTGAAG0.026300.010000.637900.750001.000001.00000


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344CUCUCACUGCAUUUGGUCA86.659242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1751362CTCTCACTGCATTTGGTCATGACCAAATGCAGTGAGAG0.042900.008100.586200.500001.000001.00000


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670GACAGCCUGGAAAACAUUC67.0803492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155688GACAGCCTGGAAAACATTCGAATGTTTTCCAGGCTGTC0.046600.003300.646600.500001.000001.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989CCCAAGGCCUUUCCUACAU71.0762359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1011007CCCAAGGCCTTTCCTACATATGTAGGAAAGGCCTTGGG0.159200.011600.836201.000000.945701.00000


Target Position: 1359, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1359GUCAGGGGGGCAUGAAUAA83.519583

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5135919GTCAGGGGGGCATGAATAA1/1/0/091.46RHOCNM_175744.4+NM_001042678.1+NM_001042679.11+1+1NANANA1:113243769..113243787(-)00RHOC(0.002)


Target Position: 1396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1396UGAAAAAAAAAAAAAAAAA78.6962163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1161414TGAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTCA0.997800.985600.724100.750001.000001.00000


Target Position: 1071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1071AUGCUGAAGGCUCCCAUUU64.4713575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981089ATGCTGAAGGCTCCCATTTAAATGGGAGCCTTCAGCAT0.085800.001400.655200.500000.989100.75000


Target Position: 350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
350AGCCCGCCCUCUCUUCCUG57.8722807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
193368AGCCCGCCCTCTCTTCCTGCAGGAAGAGAGGGCGGGCT0.107700.019800.569000.500001.000001.00000


Target Position: 1342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1342GUCUCUCACUGCAUUUGGU81.4633116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981360GTCTCTCACTGCATTTGGTACCAAATGCAGTGAGAGAC0.149400.022600.465500.500001.000001.00000


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631ACUGAUGUCAUCCUCAUGU71.2822351

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
195649ACTGATGTCATCCTCATGTACATGAGGATGACATCAGT0.048600.001300.500000.500000.972800.62500


Target Position: 749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
749GGAAUAAGAAGGACCUGAG81.0322126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
141767GGAATAAGAAGGACCTGAGCTCAGGTCCTTCTTATTCC0.063000.059800.560300.750001.000001.00000


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588GCAGGAAGACUAUGAUCGA93.83587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142606GCAGGAAGACTATGATCGATCGATCATAGTCTTCCTGC0.137200.010600.560300.750001.000001.00000


Target Position: 1030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1030CAGAAAUUAUCCCCCUACA89.424322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781048CAGAAATTATCCCCCTACATGTAGGGGGATAATTTCTG0.591400.470900.577600.500000.956500.62500


Target Position: 501, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501CUACGUCCCUACUGUCUUU85.62758

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_850119CTACGTCCCTACTGTCTTT1/1/0/087.05RHOCNM_001042678.1+NM_175744.4+NM_001042679.11+1+1NANANA1:113246305..113246323(-)00RHOC(0.002)


Target Position: 1249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1249CCAGCACUUUAUACACUUC78.2356169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1461267CCAGCACTTTATACACTTCGAAGTGTATAAAGTGCTGG0.053300.019400.672400.750000.989100.87500


Target Position: 510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
510UACUGUCUUUGAGAACUAU80.2607141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
160528TACTGTCTTTGAGAACTATATAGTTCTCAAAGACAGTA0.364400.028900.637900.500001.000001.00000


Target Position: 990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990CCAAGGCCUUUCCUACAUG70.7843367

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1571008CCAAGGCCTTTCCTACATGCATGTAGGAAAGGCCTTGG0.043600.008900.689700.750000.945700.87500


Target Position: 1395, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1395GUGAAAAAAAAAAAAAAAA84.834366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
561413GTGAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTCAC0.997700.878400.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1393-1415ACGTGAAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUUCACGUGUGAAAAAAAAAAAAAAAAAAU-11.37.700


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669UGACAGCCUGGAAAACAUU74.6864250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150687TGACAGCCTGGAAAACATTAATGTTTTCCAGGCTGTCA0.048700.005300.715500.750001.000001.00000


Target Position: 748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748GGGAAUAAGAAGGACCUGA83.179886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127766GGGAATAAGAAGGACCTGATCAGGTCCTTCTTATTCCC0.079100.036500.767200.750001.000001.00000


Target Position: 759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759GGACCUGAGGCAAGACGAG75.3885233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
145777GGACCTGAGGCAAGACGAGCTCGTCTTGCCTCAGGTCC0.206800.039800.560300.750000.940200.62500


Target Position: 1084, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1084CCAUUUUCAGUUCCCUCCU68.7188436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1701102CCATTTTCAGTTCCCTCCTAGGAGGGAACTGAAAATGG0.134600.015200.500000.750001.000001.00000


Target Position: 591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
591GGAAGACUAUGAUCGACUG85.443360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125609GGAAGACTATGATCGACTGCAGTCGATCATAGTCTTCC0.235500.016300.586200.750001.000001.00000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210UCUUGCCCCCUUUGACCUU58.6327781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1701228TCTTGCCCCCTTTGACCTTAAGGTCAAAGGGGGCAAGA0.049900.002300.586200.750000.923900.87500


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389UCCAACGUGAAAAAAAAAA66.4068516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
781407TCCAACGTGAAAAAAAAAATTTTTTTTTTCACGTTGGA0.994700.402500.870700.750001.000001.00000


Target Position: 521, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
521AGAACUAUAUUGCGGACAU83.627581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
148539AGAACTATATTGCGGACATATGTCCGCAATATAGTTCT0.052800.038600.569000.750001.000001.00000


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392AACGUGAAAAAAAAAAAAA78.7486160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1891410AACGTGAAAAAAAAAAAAATTTTTTTTTTTTTCACGTT0.995600.494700.646600.500001.000001.00000


Target Position: 1276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1276AGGAAAGUGUCUGCAGUAG68.8051432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1411294AGGAAAGTGTCTGCAGTAGCTACTGCAGACACTTTCCT0.217200.032900.672400.500001.000001.00000


Target Position: 744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
744GGUGGGGAAUAAGAAGGAC72.0825328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169762GGTGGGGAATAAGAAGGACGTCCTTCTTATTCCCCACC0.127000.002300.534500.750001.000001.00000


Target Position: 1368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1368GCAUGAAUAAAGGCUACAG76.9996190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1361386GCATGAATAAAGGCTACAGCTGTAGCCTTTATTCATGC0.119200.114000.569000.750001.000001.00000


Target Position: 796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
796GCCAAGAUGAAGCAGGAGC57.465820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199814GCCAAGATGAAGCAGGAGCGCTCCTGCTTCATCTTGGC0.012200.010700.646600.500000.940200.75000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767GGCAAGACGAGCACACCAG73.8685281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173785GGCAAGACGAGCACACCAGCTGGTGTGCTCGTCTTGCC0.026100.003100.715500.750000.983700.75000


Target Position: 1385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1385AGGCUCCAACGUGAAAAAA76.2968208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1191403AGGCTCCAACGTGAAAAAATTTTTTCACGTTGGAGCCT0.377700.008400.844800.750001.000001.00000


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415CGAAAGAAGCUGGUGAUCG67.1787483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183433CGAAAGAAGCTGGTGATCGCGATCACCAGCTTCTTTCG0.030800.022200.500000.500001.000001.00000


Target Position: 1101, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1101CUGCCCAGGACUGCAUUGU60.3203713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1771119CTGCCCAGGACTGCATTGTACAATGCAGTCCTGGGCAG0.206200.004200.577600.500000.907600.62500


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001CCUACAUGCCCCCUCCCUU74.0725271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501019CCTACATGCCCCCTCCCTTAAGGGAGGGGGCATGTAGG0.232200.122600.706901.000001.000001.00000


Target Position: 1397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1397GAAAAAAAAAAAAAAAAAA89.083527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
841415GAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTC0.998100.987800.672400.750001.000001.00000


Target Position: 1243, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243CACACACCAGCACUUUAUA91.987910

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2124319CACACACCAGCACTTTATA1/1/0/094.96RHOCNM_175744.4+NM_001042678.1+NM_001042679.11+1+1NANANA1:113243885..113243903(-)00RHOC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
401261CACACACCAGCACTTTATATATAAAGTGCTGGTGTGTG0.297300.184300.750000.750001.000001.00000


Target Position: 458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
458CCUGCCUCCUCAUCGUCUU74.2028266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
86476CCTGCCTCCTCATCGTCTTAAGACGATGAGGAGGCAGG0.141600.015000.706901.000001.000001.00000


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786GAGAGAGCUGGCCAAGAUG76.9782191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173804GAGAGAGCTGGCCAAGATGCATCTTGGCCAGCTCTCTC0.294700.011200.655200.500001.000001.00000


Target Position: 1394, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1394CGUGAAAAAAAAAAAAAAA89.247224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251412CGTGAAAAAAAAAAAAAAATTTTTTTTTTTTTTTCACG0.996500.674100.775901.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1392-1414AACGTGAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUCACGUUCGUGAAAAAAAAAAAAAAAAAU-11.314.900


Target Position: 788, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
788GAGAGCUGGCCAAGAUGAA90.019317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
127806GAGAGCTGGCCAAGATGAATTCATCTTGGCCAGCTCTC0.452300.007200.637900.750001.000001.00000


Target Position: 520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
520GAGAACUAUAUUGCGGACA76.107214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
181538GAGAACTATATTGCGGACATGTCCGCAATATAGTTCTC0.044200.039100.603400.500001.000001.00000


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207GGAUCUUGCCCCCUUUGAC74.0327275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1531225GGATCTTGCCCCCTTTGACGTCAAAGGGGGCAAGATCC0.047200.051100.551700.750000.907600.62500


Target Position: 1042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042CCCUACAACCCCAGCCUCC54.2304934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1961060CCCTACAACCCCAGCCTCCGGAGGCTGGGGTTGTAGGG0.088700.050800.620700.500000.989100.75000


Target Position: 721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
721UGCCCCAACGUGCCCAUCA65.9077534

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
163739TGCCCCAACGTGCCCATCATGATGGGCACGTTGGGGCA0.038100.014000.629300.500000.929300.62500


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586GGGCAGGAAGACUAUGAUC77.0587189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180604GGGCAGGAAGACTATGATCGATCATAGTCTTCCTGCCC0.116200.001800.810300.750001.000001.00000


Target Position: 1251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1251AGCACUUUAUACACUUCUG74.1166269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1931269AGCACTTTATACACTTCTGCAGAAGTGTATAAAGTGCT0.016400.017300.569000.500000.989100.62500


Target Position: 352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
352CCCGCCCUCUCUUCCUGCA72.0158332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
139370CCCGCCCTCTCTTCCTGCATGCAGGAAGAGAGGGCGGG0.060100.011400.637900.750001.000001.00000


Target Position: 325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
325AGCCUUGACUUCAUCUCAG73.3078292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187343AGCCTTGACTTCATCTCAGCTGAGATGAAGTCAAGGCT0.018800.004700.569000.500000.994600.62500


Target Position: 507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
507CCCUACUGUCUUUGAGAAC66.4252515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
137525CCCTACTGTCTTTGAGAACGTTCTCAAAGACAGTAGGG0.061300.018800.844800.750001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768GCAAGACGAGCACACCAGG68.1022460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
168786GCAAGACGAGCACACCAGGCCTGGTGTGCTCGTCTTGC0.046100.002500.508600.500001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642CCUCAUGUGCUUCUCCAUC67.7182467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
145660CCTCATGTGCTTCTCCATCGATGGAGAAGCACATGAGG0.103200.004400.663800.750000.951100.62500


Target Position: 987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
987UCCCCAAGGCCUUUCCUAC56.2426871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1261005TCCCCAAGGCCTTTCCTACGTAGGAAAGGCCTTGGGGA0.180900.016600.689700.500000.945700.75000


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844GCGAACCGGAUCAGUGCCU64.0135590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
179862GCGAACCGGATCAGTGCCTAGGCACTGATCCGGTTCGC0.021900.005700.577600.750000.962000.75000


Target Position: 1250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1250CAGCACUUUAUACACUUCU75.3222236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1651268CAGCACTTTATACACTTCTAGAAGTGTATAAAGTGCTG0.037300.012500.560300.500000.989100.75000


Target Position: 996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
996CCUUUCCUACAUGCCCCCU60.0118726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1821014CCTTTCCTACATGCCCCCTAGGGGGCATGTAGGAAAGG0.199000.016400.500000.750001.000001.00000


Target Position: 1105, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1105CCAGGACUGCAUUGUUUUC70.9684363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1161123CCAGGACTGCATTGTTTTCGAAAACAATGCAGTCCTGG0.415400.009200.672400.750001.000001.00000


Target Position: 1078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1078AGGCUCCCAUUUUCAGUUC59.026774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1771096AGGCTCCCATTTTCAGTTCGAACTGAAAATGGGAGCCT0.022600.004000.672400.500001.000001.00000


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459CUGCCUCCUCAUCGUCUUC64.0922588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185477CTGCCTCCTCATCGTCTTCGAAGACGATGAGGAGGCAG0.165400.017700.612100.500001.000001.00000


Target Position: 409, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
409GCAAUCCGAAAGAAGCUGG58.5871782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161427GCAATCCGAAAGAAGCTGGCCAGCTTCTTTCGGATTGC0.085600.020300.508600.500001.000001.00000


Target Position: 1082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1082UCCCAUUUUCAGUUCCCUC56.7882851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1811100TCCCATTTTCAGTTCCCTCGAGGGAACTGAAAATGGGA0.021300.015000.560300.500001.000001.00000


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655UCCAUCGACAGCCCUGACA62.6645639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176673TCCATCGACAGCCCTGACATGTCAGGGCTGTCGATGGA0.094400.041400.663800.500001.000001.00000


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472GUCUUCAGCAAGGAUCAGU69.7181403

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
189490GTCTTCAGCAAGGATCAGTACTGATCCTTGCTGAAGAC0.018000.011000.612100.500000.978300.75000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666CCCUGACAGCCUGGAAAAC62.8605631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191684CCCTGACAGCCTGGAAAACGTTTTCCAGGCTGTCAGGG0.017200.003000.844800.750001.000001.00000


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387GCUCCAACGUGAAAAAAAA95.58673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
161405GCTCCAACGTGAAAAAAAATTTTTTTTCACGTTGGAGC0.533600.246600.853401.000001.000001.00000


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630CACUGAUGUCAUCCUCAUG81.751112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196648CACTGATGTCATCCTCATGCATGAGGATGACATCAGTG0.057700.001200.637900.500000.972800.62500


Target Position: 1072, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1072UGCUGAAGGCUCCCAUUUU73.4446290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1631090TGCTGAAGGCTCCCATTTTAAAATGGGAGCCTTCAGCA0.106300.003000.853400.750000.989100.75000


Target Position: 265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
265GGCCCUGGGGUCAGUCUGA80.3696137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144283GGCCCTGGGGTCAGTCTGATCAGACTGACCCCAGGGCC0.111400.004600.775900.750000.907601.00000


Target Position: 1275, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1275CAGGAAAGUGUCUGCAGUA97.2712

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10127519CAGGAAAGTGTCTGCAGTA1/1/0/086.96RHOCNM_001042678.1+NM_175744.4+NM_001042679.11+1+1NANANA1:113243853..113243871(-)00RHOC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1171293CAGGAAAGTGTCTGCAGTATACTGCAGACACTTTCCTG0.209200.022600.603400.750000.978300.62500


Target Position: 1069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1069CCAUGCUGAAGGCUCCCAU76.1445213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781087CCATGCTGAAGGCTCCCATATGGGAGCCTTCAGCATGG0.377200.001900.689701.000000.989101.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792GCUGGCCAAGAUGAAGCAG62.8802630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
131810GCTGGCCAAGATGAAGCAGCTGCTTCATCTTGGCCAGC0.209700.007700.569000.750000.934800.75000


Target Position: 468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
468CAUCGUCUUCAGCAAGGAU87.921434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
192486CATCGTCTTCAGCAAGGATATCCTTGCTGAAGACGATG0.032000.002300.474100.750000.978300.87500


Target Position: 743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743UGGUGGGGAAUAAGAAGGA71.6461338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191761TGGTGGGGAATAAGAAGGATCCTTCTTATTCCCCACCA0.457300.040100.474100.500001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755AGAAGGACCUGAGGCAAGA78.7399161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167773AGAAGGACCTGAGGCAAGATCTTGCCTCAGGTCCTTCT0.084200.027100.500000.500000.978301.00000


Target Position: 1393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1393ACGUGAAAAAAAAAAAAAA83.623682

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861411ACGTGAAAAAAAAAAAAAATTTTTTTTTTTTTTCACGT0.996300.586900.775900.750001.000001.00000


Target Position: 33, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
33GGUCGUGCUCCCCCCGCUC61.3292691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
15551GGTCGTGCTCCCCCCGCTCGAGCGGGGGGAGCACGACC0.134900.014600.543100.750000.929300.75000


Target Position: 1074, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074CUGAAGGCUCCCAUUUUCA80.5598135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921092CTGAAGGCTCCCATTTTCATGAAAATGGGAGCCTTCAG0.028800.001600.560300.500001.000001.00000


Target Position: 1073, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1073GCUGAAGGCUCCCAUUUUC71.6058340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1901091GCTGAAGGCTCCCATTTTCGAAAATGGGAGCCTTCAGC0.041200.001400.681000.750001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784AGGAGAGAGCUGGCCAAGA76.2417210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
150802AGGAGAGAGCTGGCCAAGATCTTGGCCAGCTCTCTCCT0.100900.016700.620700.500001.000001.00000


Target Position: 1083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1083CCCAUUUUCAGUUCCCUCC54.3109931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1671101CCCATTTTCAGTTCCCTCCGGAGGGAACTGAAAATGGG0.030900.015200.620700.500001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719UCUGCCCCAACGUGCCCAU56.6646857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
159737TCTGCCCCAACGTGCCCATATGGGCACGTTGGGGCAGA0.056800.003100.569000.750000.940200.87500


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043CCUACAACCCCAGCCUCCU66.9251500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781061CCTACAACCCCAGCCTCCTAGGAGGCTGGGGTTGTAGG0.100600.052700.500000.750000.989100.62500


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653UCUCCAUCGACAGCCCUGA65.0216552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
180671TCTCCATCGACAGCCCTGATCAGGGCTGTCGATGGAGA0.097400.030400.500000.500001.000001.00000


Target Position: 1383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1383ACAGGCUCCAACGUGAAAA74.3107264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1221401ACAGGCTCCAACGTGAAAATTTTCACGTTGGAGCCTGT0.346800.008000.706900.750001.000001.00000


Target Position: 470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470UCGUCUUCAGCAAGGAUCA74.3716262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
170488TCGTCTTCAGCAAGGATCATGATCCTTGCTGAAGACGA0.029100.011200.569000.500000.978301.00000


Target Position: 1245, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1245CACACCAGCACUUUAUACA86.861440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1361263CACACCAGCACTTTATACATGTATAAAGTGCTGGTGTG0.268500.145000.586200.500000.989100.62500


Target Position: 741, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
741CCUGGUGGGGAAUAAGAAG69.9698393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
70759CCTGGTGGGGAATAAGAAGCTTCTTATTCCCCACCAGG0.446800.019100.706900.750001.000001.00000


Target Position: 1386, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1386GGCUCCAACGUGAAAAAAA90.581715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491404GGCTCCAACGTGAAAAAAATTTTTTTCACGTTGGAGCC0.400800.034001.000001.000001.000001.00000


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107AGGACUGCAUUGUUUUCUA90.725214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
711125AGGACTGCATTGTTTTCTATAGAAAACAATGCAGTCCT0.368900.048900.672400.750001.000001.00000


Target Position: 63, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
63CCGCAGUCCAGGAAUCUCC61.799667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
17581CCGCAGTCCAGGAATCTCCGGAGATTCCTGGACTGCGG0.025000.002000.543100.500000.945700.62500


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414CCGAAAGAAGCUGGUGAUC59.2015767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144432CCGAAAGAAGCTGGTGATCGATCACCAGCTTCTTTCGG0.053900.021600.732800.750001.000001.00000


Target Position: 1077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1077AAGGCUCCCAUUUUCAGUU70.2102381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861095AAGGCTCCCATTTTCAGTTAACTGAAAATGGGAGCCTT0.022200.002800.491400.500001.000001.00000


Target Position: 512, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
512CUGUCUUUGAGAACUAUAU84.09774

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_651219CTGTCTTTGAGAACTATAT1/1/0/088.67RHOCNM_175744.4+NM_001042678.1+NM_001042679.11+1+1NANANA1:113246294..113246312(-)00RHOC(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
61530CTGTCTTTGAGAACTATATATATAGTTCTCAAAGACAG0.269000.024200.741400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
510-532TACTGTCTTTGAGAACTATATTGAUAUAGUUCUCAAAGACAGUACUGUCUUUGAGAACUAUAUUGU6.319.222


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838GACAUGGCGAACCGGAUCA78.2242170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182856GACATGGCGAACCGGATCATGATCCGGTTCGCCATGTC0.115800.002200.594800.500000.983701.00000


Target Position: 1041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041CCCCUACAACCCCAGCCUC58.7059777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1141059CCCCTACAACCCCAGCCTCGAGGCTGGGGTTGTAGGGG0.091000.057600.681000.750000.989100.87500


Target Position: 620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
620CCUACCCGGACACUGAUGU64.3678579

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191638CCTACCCGGACACTGATGTACATCAGTGTCCGGGTAGG0.032200.001400.637900.750001.000001.00000


Target Position: 740, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
740UCCUGGUGGGGAAUAAGAA77.9749177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
97758TCCTGGTGGGGAATAAGAATTCTTATTCCCCACCAGGA0.351300.012400.698300.750000.945700.62500


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349GAGCCCGCCCUCUCUUCCU69.2625416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
194367GAGCCCGCCCTCTCTTCCTAGGAAGAGAGGGCGGGCTC0.126900.009900.465500.500000.918500.62500


Target Position: 937, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
937CUCCAGGUCCGCAAGAACA80.9242128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199955CTCCAGGTCCGCAAGAACATGTTCTTGCGGACCTGGAG0.087400.001000.603400.500000.913000.62500


Target Position: 317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
317GGAGCGGAAGCCUUGACUU82.5925100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
188335GGAGCGGAAGCCTTGACTTAAGTCAAGGCTTCCGCTCC0.136700.001600.732801.000000.918500.75000


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904CGGGAGGUGUUUGAGAUGG59.9781730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197922CGGGAGGTGTTTGAGATGGCCATCTCAAACACCTCCCG0.062600.001100.569000.500001.000001.00000


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902UGCGGGAGGUGUUUGAGAU76.4187203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
167920TGCGGGAGGTGTTTGAGATATCTCAAACACCTCCCGCA0.335800.002600.672400.750001.000001.00000


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771AGACGAGCACACCAGGAGA85.661457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
199789AGACGAGCACACCAGGAGATCTCCTGGTGTGCTCGTCT0.062100.005300.500000.500001.000001.00000


Target Position: 464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
464UCCUCAUCGUCUUCAGCAA82.5808101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
75482TCCTCATCGTCTTCAGCAATTGCTGAAGACGATGAGGA0.166600.033600.724100.750001.000001.00000


Target Position: 457, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
457ACCUGCCUCCUCAUCGUCU67.5627472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
155475ACCTGCCTCCTCATCGTCTAGACGATGAGGAGGCAGGT0.131000.014700.629300.500001.000001.00000


Target Position: 1106, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1106CAGGACUGCAUUGUUUUCU68.711438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1701124CAGGACTGCATTGTTTTCTAGAAAACAATGCAGTCCTG0.390400.013800.560300.500001.000001.00000


Target Position: 1103, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1103GCCCAGGACUGCAUUGUUU81.6257113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1291121GCCCAGGACTGCATTGTTTAAACAATGCAGTCCTGGGC0.327000.007201.000001.000001.000001.00000


Target Position: 1391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391CAACGUGAAAAAAAAAAAA89.171925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
901409CAACGTGAAAAAAAAAAAATTTTTTTTTTTTCACGTTG0.995100.445600.646600.750001.000001.00000


Target Position: 903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903GCGGGAGGUGUUUGAGAUG70.7736368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153921GCGGGAGGTGTTTGAGATGCATCTCAAACACCTCCCGC0.311200.003400.767200.750001.000001.00000


Target Position: 1102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102UGCCCAGGACUGCAUUGUU73.3088291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1391120TGCCCAGGACTGCATTGTTAACAATGCAGTCCTGGGCA0.216800.005000.706900.750000.934800.62500


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722GCCCCAACGUGCCCAUCAU80.1845142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169740GCCCCAACGTGCCCATCATATGATGGGCACGTTGGGGC0.030300.010100.844801.000000.929300.75000


Target Position: 988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
988CCCCAAGGCCUUUCCUACA77.5761181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801006CCCCAAGGCCTTTCCTACATGTAGGAAAGGCCTTGGGG0.195700.018400.784500.750000.945700.87500


Target Position: 1002, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1002CUACAUGCCCCCUCCCUUC62.2274654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1881020CTACATGCCCCCTCCCTTCGAAGGGAGGGGGCATGTAG0.547700.109100.500000.500001.000001.00000


Target Position: 785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
785GGAGAGAGCUGGCCAAGAU91.802311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
94803GGAGAGAGCTGGCCAAGATATCTTGGCCAGCTCTCTCC0.120300.013900.689701.000001.000001.00000


Target Position: 1388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388CUCCAACGUGAAAAAAAAA86.207548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1061406CTCCAACGTGAAAAAAAAATTTTTTTTTCACGTTGGAG0.993000.263200.810300.750001.000001.00000


Target Position: 789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
789AGAGCUGGCCAAGAUGAAG67.6024471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
138807AGAGCTGGCCAAGATGAAGCTTCATCTTGGCCAGCTCT0.401100.005200.586200.500001.000001.00000


Target Position: 747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747GGGGAAUAAGAAGGACCUG68.6034441

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
126765GGGGAATAAGAAGGACCTGCAGGTCCTTCTTATTCCCC0.080600.032700.706900.750001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240GGUCACACACCAGCACUUU80.0688143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1261258GGTCACACACCAGCACTTTAAAGTGCTGGTGTGTGACC0.256700.007500.853401.000000.929300.62500


Target Position: 585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585AGGGCAGGAAGACUAUGAU81.2925117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183603AGGGCAGGAAGACTATGATATCATAGTCTTCCTGCCCT0.125300.001700.663800.750001.000001.00000


Target Position: 1384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1384CAGGCUCCAACGUGAAAAA87.950933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1201402CAGGCTCCAACGTGAAAAATTTTTCACGTTGGAGCCTG0.366700.008200.784500.750001.000001.00000


Target Position: 605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
605GACUGCGGCCUCUCUCCUA89.492921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
140623GACTGCGGCCTCTCTCCTATAGGAGAGAGGCCGCAGTC0.103900.004800.646600.750001.000001.00000


Target Position: 794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794UGGCCAAGAUGAAGCAGGA80.341139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197812TGGCCAAGATGAAGCAGGATCCTGCTTCATCTTGGCCA0.153000.064300.474100.500000.934800.75000


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587GGCAGGAAGACUAUGAUCG70.9744362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125605GGCAGGAAGACTATGATCGCGATCATAGTCTTCCTGCC0.086900.012100.706900.500001.000001.00000


Target Position: 1242, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1242UCACACACCAGCACUUUAU71.597341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
631260TCACACACCAGCACTTTATATAAAGTGCTGGTGTGTGA0.317400.225800.681000.750001.000001.00000


Target Position: 723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
723CCCCAACGUGCCCAUCAUC63.9408591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
183741CCCCAACGTGCCCATCATCGATGATGGGCACGTTGGGG0.020000.006200.810300.750000.929300.87500


Target Position: 513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
513UGUCUUUGAGAACUAUAUU78.0817176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
108531TGTCTTTGAGAACTATATTAATATAGTTCTCAAAGACA0.222900.016800.698300.750001.000001.00000


Target Position: 264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
264GGGCCCUGGGGUCAGUCUG59.8602737

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
156282GGGCCCTGGGGTCAGTCTGCAGACTGACCCCAGGGCCC0.053800.003200.706900.750000.907601.00000


Target Position: 524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524ACUAUAUUGCGGACAUUGA81.9599110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190542ACTATATTGCGGACATTGATCAATGTCCGCAATATAGT0.087700.036400.482800.500001.000001.00000


Target Position: 413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
413UCCGAAAGAAGCUGGUGAU70.0198388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
116431TCCGAAAGAAGCTGGTGATATCACCAGCTTCTTTCGGA0.088900.039000.689700.750001.000001.00000


Target Position: 1028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1028UACAGAAAUUAUCCCCCUA83.641280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1941046TACAGAAATTATCCCCCTATAGGGGGATAATTTCTGTA0.583900.388000.508600.500000.907600.62500


Target Position: 1174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1174CGCCUAUGCCCUGCCCUUC58.6569779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981192CGCCTATGCCCTGCCCTTCGAAGGGCAGGGCATAGGCG0.066300.001000.750000.750000.956500.75000


Target Position: 746, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
746UGGGGAAUAAGAAGGACCU66.7329505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
169764TGGGGAATAAGAAGGACCTAGGTCCTTCTTATTCCCCA0.085300.003900.500000.500001.000001.00000


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758AGGACCUGAGGCAAGACGA75.8688218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
187776AGGACCTGAGGCAAGACGATCGTCTTGCCTCAGGTCCT0.189500.044200.551700.500000.940200.75000


Target Position: 462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
462CCUCCUCAUCGUCUUCAGC63.2625617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185480CCTCCTCATCGTCTTCAGCGCTGAAGACGATGAGGAGG0.175200.002100.491400.500001.000001.00000


Target Position: 1366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1366GGGCAUGAAUAAAGGCUAC75.7929222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1811384GGGCATGAATAAAGGCTACGTAGCCTTTATTCATGCCC0.172500.001800.810300.750001.000001.00000


Target Position: 846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
846GAACCGGAUCAGUGCCUUU85.819455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197864GAACCGGATCAGTGCCTTTAAAGGCACTGATCCGGTTC0.013600.001700.672400.750000.978300.75000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791AGCUGGCCAAGAUGAAGCA79.2975154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
175809AGCTGGCCAAGATGAAGCATGCTTCATCTTGGCCAGCT0.406400.010500.500000.500000.934800.62500


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589CAGGAAGACUAUGAUCGAC77.4245184

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
197607CAGGAAGACTATGATCGACGTCGATCATAGTCTTCCTG0.105000.011600.465500.500001.000001.00000


Target Position: 1380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380GCUACAGGCUCCAACGUGA90.484216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1301398GCTACAGGCTCCAACGTGATCACGTTGGAGCCTGTAGC0.236000.007100.629300.750001.000001.00000


Target Position: 629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
629ACACUGAUGUCAUCCUCAU84.091775

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
182647ACACTGATGTCATCCTCATATGAGGATGACATCAGTGT0.076200.001800.551700.750000.972800.62500


Target Position: 1175, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1175GCCUAUGCCCUGCCCUUCC55.2172901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1471193GCCTATGCCCTGCCCTTCCGGAAGGGCAGGGCATAGGC0.057500.004300.629300.500001.000001.00000


Target Position: 668, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668CUGACAGCCUGGAAAACAU86.249947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
164686CTGACAGCCTGGAAAACATATGTTTTCCAGGCTGTCAG0.035300.004700.629300.750001.000001.00000


Target Position: 1247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1247CACCAGCACUUUAUACACU84.572868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1641265CACCAGCACTTTATACACTAGTGTATAAAGTGCTGGTG0.184100.062300.586200.500000.989100.87500


Target Position: 939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
939CCAGGUCCGCAAGAACAAG67.0978490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
109957CCAGGTCCGCAAGAACAAGCTTGTTCTTGCGGACCTGG0.142200.010700.706900.750000.913000.87500


Target Position: 641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
641UCCUCAUGUGCUUCUCCAU74.5231257

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
146659TCCTCATGTGCTTCTCCATATGGAGAAGCACATGAGGA0.066500.004300.715500.750000.978300.62500


Target Position: 986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
986AUCCCCAAGGCCUUUCCUA69.5682405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1641004ATCCCCAAGGCCTTTCCTATAGGAAAGGCCTTGGGGAT0.164600.015500.508600.500000.945700.62500


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000UCCUACAUGCCCCCUCCCU52.8473972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1591018TCCTACATGCCCCCTCCCTAGGGAGGGGGCATGTAGGA0.245400.127700.525900.500001.000001.00000


Target Position: 1367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1367GGCAUGAAUAAAGGCUACA81.4649115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
821385GGCATGAATAAAGGCTACATGTAGCCTTTATTCATGCC0.147600.060600.793100.750001.000001.00000


Target Position: 1100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1100CCUGCCCAGGACUGCAUUG62.3376648

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1521118CCTGCCCAGGACTGCATTGCAATGCAGTCCTGGGCAGG0.203600.003600.698300.750000.907600.62500


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667CCUGACAGCCUGGAAAACA79.5536150

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
190685CCTGACAGCCTGGAAAACATGTTTTCCAGGCTGTCAGG0.017400.003100.637900.750001.000001.00000


Target Position: 1068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1068UCCAUGCUGAAGGCUCCCA59.8627736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1841086TCCATGCTGAAGGCTCCCATGGGAGCCTTCAGCATGGA0.053200.002200.525900.500000.934800.75000


Target Position: 1176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1176CCUAUGCCCUGCCCUUCCU66.7506503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1711194CCTATGCCCTGCCCTTCCTAGGAAGGGCAGGGCATAGG0.797900.025400.500000.750001.000001.00000


Target Position: 1066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1066GCUCCAUGCUGAAGGCUCC69.1219421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1891084GCTCCATGCTGAAGGCTCCGGAGCCTTCAGCATGGAGC0.019300.002900.482800.500000.902200.62500


Target Position: 351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351GCCCGCCCUCUCUUCCUGC52.8064975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
142369GCCCGCCCTCTCTTCCTGCGCAGGAAGAGAGGGCGGGC0.070200.014800.646600.500001.000001.00000


Target Position: 1173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1173ACGCCUAUGCCCUGCCCUU67.164484

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1921191ACGCCTATGCCCTGCCCTTAAGGGCAGGGCATAGGCGT0.048100.001400.637900.750000.956500.75000


Target Position: 845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845CGAACCGGAUCAGUGCCUU73.8381283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185863CGAACCGGATCAGTGCCTTAAGGCACTGATCCGGTTCG0.019400.003000.655201.000000.962000.62500


Target Position: 355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
355GCCCUCUCUUCCUGCAGCC57.193832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
173373GCCCTCTCTTCCTGCAGCCGGCTGCAGGAAGAGAGGGC0.037000.003800.500000.500001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040CCCCCUACAACCCCAGCCU60.4135710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1131058CCCCCTACAACCCCAGCCTAGGCTGGGGTTGTAGGGGG0.094400.060700.646600.750000.989100.87500


Target Position: 356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
356CCCUCUCUUCCUGCAGCCU65.094549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
154374CCCTCTCTTCCTGCAGCCTAGGCTGCAGGAAGAGAGGG0.057700.003400.646600.750001.000001.00000


Target Position: 724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
724CCCAACGUGCCCAUCAUCC54.6888918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
196742CCCAACGTGCCCATCATCCGGATGATGGGCACGTTGGG0.014800.004700.620700.500000.929300.87500


Target Position: 714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
714GCACUUCUGCCCCAACGUG69.1161422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
185732GCACTTCTGCCCCAACGTGCACGTTGGGGCAGAAGTGC0.117100.001700.560300.750000.945700.62500


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772GACGAGCACACCAGGAGAG72.1636325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
176790GACGAGCACACCAGGAGAGCTCTCCTGGTGTGCTCGTC0.023200.012300.508600.500001.000001.00000


Target Position: 405, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GGCUGCAAUCCGAAAGAAG75.0093244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
158423GGCTGCAATCCGAAAGAAGCTTCTTTCGGATTGCAGCC0.176500.003100.862100.750001.000001.00000


Target Position: 471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471CGUCUUCAGCAAGGAUCAG70.0502386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
184489CGTCTTCAGCAAGGATCAGCTGATCCTTGCTGAAGACG0.020700.010100.491400.750000.978300.87500


Target Position: 762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
762CCUGAGGCAAGACGAGCAC61.3952688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
153780CCTGAGGCAAGACGAGCACGTGCTCGTCTTGCCTCAGG0.169400.033700.551700.750000.983700.75000