siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai 973   1497   2015   2052  
Biltr, Ernai, Rnaxs, Sidirect 1843   1844  
Biltr, Ernai, Sidirect 2543  
Biltr, Ernai, Rnaxs 820   1590   1730  
Biltr, Sidirect 314   904   1340   1637   1808   1809   1819   2021   2071   2310   2313   2545  
Biltr, Rnaxs, Sidirect 1383   1599   1600   1627   1657   1740   1743   1817   2022   2065   2066   2122   2123   2125   2131   2138   2516   2540  
Biltr, Rnaxs 12   17   18   56   57   61   107   108   109   110   111   113   144   145   146   191   192   217   249   250  
251   255   261   262   263   271   273   274   277   278   280   281   288   298   321   322   333   334   335   336  
337   338   339   340   341   342   343   344   345   371   373   378   379   380   381   382   412   427   428   452  
453   454   455   456   465   466   467   468   469   470   472   473   474   475   476   477   478   479   480   489  
491   493   494   524   525   528   529   530   531   532   533   535   536   537   564   568   574   575   576   577  
585   586   587   588   669   670   671   672   673   674   675   676   677   678   681   682   683   684   690   760  
765   766   767   786   787   791   792   793   796   797   798   800   801   804   805   806   807   809   810   811  
812   813   814   818   819   825   826   827   828   878   879   880   884   885   888   890   891   892   893   894  
895   905   906   912   948   949   950   951   954   960   987   995   996   997   998   999   1000   1035   1036   1037  
1038   1039   1042   1043   1044   1045   1046   1047   1049   1050   1059   1121   1122   1140   1207   1300   1301   1302   1303   1312  
1313   1314   1323   1324   1325   1326   1328   1329   1330   1331   1332   1333   1334   1335   1370   1371   1372   1373   1375   1377  
1378   1379   1380   1381   1382   1384   1385   1389   1390   1391   1392   1393   1403   1404   1411   1412   1413   1414   1415   1418  
1419   1422   1423   1424   1425   1428   1429   1430   1431   1432   1459   1463   1464   1465   1469   1473   1476   1477   1500   1501  
1502   1503   1504   1550   1551   1555   1556   1562   1563   1568   1569   1570   1571   1573   1574   1575   1576   1577   1578   1580  
1581   1588   1589   1591   1592   1593   1596   1597   1598   1601   1603   1611   1612   1613   1616   1622   1623   1624   1625   1626  
1628   1630   1631   1632   1634   1635   1636   1645   1646   1652   1653   1655   1656   1658   1659   1660   1661   1664   1665   1670  
1671   1674   1675   1678   1679   1699   1700   1701   1702   1726   1728   1729   1731   1732   1733   1734   1735   1736   1737   1742  
1750   1751   1752   1758   1759   1760   1761   1762   1815   1816   1818   1831   1832   1833   1842   1845   1846   1847   1870   1871  
1915   1916   1917   1918   1919   1920   1922   1923   1924   1925   1948   1949   1950   1995   1996   1997   2016   2023   2025   2028  
2029   2044   2064   2069   2079   2091   2092   2093   2094   2096   2097   2098   2100   2108   2109   2110   2111   2112   2115   2116  
2117   2118   2119   2120   2121   2124   2126   2127   2128   2129   2130   2132   2133   2134   2135   2136   2137   2142   2143   2144  
2148   2196   2197   2198   2199   2200   2302   2303   2306   2307   2308   2309   2311   2331   2332   2356   2414   2415   2445   2446  
2447   2449   2450   2451   2452   2453   2465   2476   2483   2484   2485   2492   2493   2494   2495   2496   2498   2499   2500   2501  
2502   2503   2504   2505   2506   2507   2508   2512   2513   2514   2515   2517   2520   2524   2525   2526   2527   2530   2532   2533  
2534   2535   2538   2539   2547   2561   2565   2566   2567   2568  


Target Position: 1675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1675ACAAUCAGCCACAUUCUAG71.2523886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4371693ACAATCAGCCACATTCTAGCTAGAATGTGGCTGATTGT0.200300.051800.534500.500001.000001.00000


Target Position: 892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892CACCAUCCACUACAACUAC74.649665

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
466910CACCATCCACTACAACTACGTAGTTGTAGTGGATGGTG0.494200.324200.612100.500001.000001.00000


Target Position: 1377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377CAGACUGACAUUCUCCACU79.1805413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3481395CAGACTGACATTCTCCACTAGTGGAGAATGTCAGTCTG0.356000.038700.577600.500001.000001.00000


Target Position: 2109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109GUUUUAUGCUCAGGGUCAA86.6363130

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4402127GTTTTATGCTCAGGGTCAATTGACCCTGAGCATAAAAC0.085400.021000.500000.750001.000001.00000


Target Position: 18, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
18CCCCUCCCAUGUGCUCAAG57.04331909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
31336CCCCTCCCATGTGCTCAAGCTTGAGCACATGGGAGGGG0.175400.009200.853400.750001.000001.00000


Target Position: 1391, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1391CCACUUCUUGUUCCCCACU69.64851013

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2241409CCACTTCTTGTTCCCCACTAGTGGGGAACAAGAAGTGG0.368000.051200.637900.750001.000001.00000


Target Position: 1949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1949GCUGGUUAGGUAGAGGGAG65.14521354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861967GCTGGTTAGGTAGAGGGAGCTCCCTCTACCTAACCAGC0.019600.002300.543100.750001.000001.00000


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593AUACCAGCUUAGAUUUUAA93.358832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101611ATACCAGCTTAGATTTTAATTAAAATCTAAGCTGGTAT0.233800.003200.508600.500000.994600.75000


Target Position: 2200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200GUGGAGUGGCGUGAUCUUG66.96551212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3762218GTGGAGTGGCGTGATCTTGCAAGATCACGCCACTCCAC0.172100.004800.646600.500001.000001.00000


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430UCUCCCUCCCCUGCCAUUU52.21612176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1041448TCTCCCTCCCCTGCCATTTAAATGGCAGGGGAGGGAGA0.603200.191200.724100.750001.000001.00000


Target Position: 1636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1636GGAGAUGUAAGAAAUGUUC76.1517564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121654GGAGATGTAAGAAATGTTCGAACATTTCTTACATCTCC0.012300.001400.698300.750001.000001.00000


Target Position: 2064, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2064AGGAUUUCAUCUCUUGUAU81.3927301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2652082AGGATTTCATCTCTTGTATATACAAGAGATGAAATCCT0.664600.020200.801700.750001.000001.00000


Target Position: 2311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2311AACUUUUGCAUGUUUUGUA83.7016229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5092329AACTTTTGCATGTTTTGTATACAAAACATGCAAAAGTT0.013200.006700.465500.500001.000001.00000


Target Position: 891, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891CCACCAUCCACUACAACUA91.317266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
172909CCACCATCCACTACAACTATAGTTGTAGTGGATGGTGG0.525000.156200.672401.000001.000001.00000


Target Position: 904, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904CAACUACAUGUGUAACAGU87.824111

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
902-924TACAACTACATGTGTAACAGTTCACUGUUACACAUGUAGUUGUACAACUACAUGUGUAACAGUUCU19.019.012


Target Position: 2502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2502UCCCCUCCUUCUCCCUUUU59.0751779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1562520TCCCCTCCTTCTCCCTTTTAAAAGGGAGAAGGAGGGGA0.937700.934400.870700.750001.000001.00000


Target Position: 1923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1923GGGUUGGUAGUUUCUACAG75.7501590

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741941GGGTTGGTAGTTTCTACAGCTGTAGAAACTACCAACCC0.072300.007800.706900.750000.945700.75000


Target Position: 564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
564CUGUGACUUGCACGUACUC69.48931026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512582CTGTGACTTGCACGTACTCGAGTACGTGCAAGTCACAG0.085800.001100.474100.500000.967400.75000


Target Position: 813, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813AGUAUUUGGAUGACAGAAA86.7967126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433831AGTATTTGGATGACAGAAATTTCTGTCATCCAAATACT0.039200.008900.706900.750001.000001.00000


Target Position: 1600, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1600CUUAGAUUUUAAGGUUUUU76.4582554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2591618CTTAGATTTTAAGGTTTTTAAAAACCTTAAAATCTAAG0.174900.079900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1598-1620AGCTTAGATTTTAAGGTTTTTACAAAAACCUUAAAAUCUAAGCUCUUAGAUUUUAAGGUUUUUACU17.36.922


Target Position: 1392, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1392CACUUCUUGUUCCCCACUG65.60951324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891410CACTTCTTGTTCCCCACTGCAGTGGGGAACAAGAAGTG0.357600.047800.508600.500001.000001.00000


Target Position: 337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
337GUCCCCGGACGAUAUUGAA84.038221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414355GTCCCCGGACGATATTGAATTCAATATCGTCCGGGGAC0.122300.002900.646600.750000.983700.62500


Target Position: 1419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1419CCACCCCCAUCUCUCCCUC57.97961845

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3651437CCACCCCCATCTCTCCCTCGAGGGAGAGATGGGGGTGG0.545000.363200.534500.750001.000001.00000


Target Position: 1476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1476UGCAAUAGGUGUGCGUCAG60.76141667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591494TGCAATAGGTGTGCGTCAGCTGACGCACACCTATTGCA0.027800.004400.569000.500000.934800.62500


Target Position: 807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
807GUGUGGAGUAUUUGGAUGA85.079186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505825GTGTGGAGTATTTGGATGATCATCCAAATACTCCACAC0.072100.003400.569000.500001.000001.00000


Target Position: 335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
335CUGUCCCCGGACGAUAUUG58.29781825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455353CTGTCCCCGGACGATATTGCAATATCGTCCGGGGACAG0.041800.002200.637900.500000.918500.75000


Target Position: 277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
277ACUUCCUGAAAACAACGUU69.46611028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
318295ACTTCCTGAAAACAACGTTAACGTTGTTTTCAGGAAGT0.489800.074500.560300.750001.000001.00000


Target Position: 255, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
255CAUUUUCAGACCUAUGGAA92.08453

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512273CATTTTCAGACCTATGGAATTCCATAGGTCTGAAAATG0.045800.001000.482800.750001.000001.00000


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827AGAAACACUUUUCGACAUA84.4761203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413845AGAAACACTTTTCGACATATATGTCGAAAAGTGTTTCT0.052800.002900.681000.750000.983700.62500


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535GGGCUUCUUGCAUUCUGGG62.95191507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455553GGGCTTCTTGCATTCTGGGCCCAGAATGCAAGAAGCCC0.029900.003500.500000.500001.000001.00000


Target Position: 1995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1995ACCCUGUCUGACAACCUCU71.7797838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4012013ACCCTGTCTGACAACCTCTAGAGGTTGTCAGACAGGGT0.249800.120300.629300.500000.989101.00000


Target Position: 2453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2453UCAACAUCUUUUACAUUCU73.8755702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4282471TCAACATCTTTTACATTCTAGAATGTAAAAGATGTTGA0.295500.104800.500000.500001.000001.00000


Target Position: 1679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1679UCAGCCACAUUCUAGGUAG65.61231322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981697TCAGCCACATTCTAGGTAGCTACCTAGAATGTGGCTGA0.032200.001200.551700.500000.945700.87500


Target Position: 2138, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2138CUUUUUUUUUUUUUUUUUU70.1591978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2192156CTTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAAG0.775400.762900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2136-2158TTCTTTTTTTTTTTTTTTTTTCTAAAAAAAAAAAAAAAAAAGAACUUUUUUUUUUUUUUUUUUCUU-11.3-11.300


Target Position: 1050, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1050GCACAGAGGAAGAGAAUCU84.2715210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041068GCACAGAGGAAGAGAATCTAGATTCTCTTCCTCTGTGC0.014200.005000.629300.750001.000001.00000


Target Position: 322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322GGAUGAUUUGAUGCUGUCC71.1749897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431340GGATGATTTGATGCTGTCCGGACAGCATCAAATCATCC0.054600.007000.500000.500001.000001.00000


Target Position: 2494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494CCCACCCUUCCCCUCCUUC51.41342212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1422512CCCACCCTTCCCCTCCTTCGAAGGAGGGGAAGGGTGGG0.995300.992600.819000.750001.000001.00000


Target Position: 12, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12GGUUUUCCCCUCCCAUGUG67.97791136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
45930GGTTTTCCCCTCCCATGTGCACATGGGAGGGGAAAACC0.101800.001900.560300.750000.967400.75000


Target Position: 2110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2110UUUUAUGCUCAGGGUCAAU65.72681320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4642128TTTTATGCTCAGGGTCAATATTGACCCTGAGCATAAAA0.091700.024300.491400.500001.000001.00000


Target Position: 491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
491GUCCCUUCCCAGAAAACCU73.7805713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498509GTCCCTTCCCAGAAAACCTAGGTTTTCTGGGAAGGGAC0.045100.001600.474100.500000.918500.62500


Target Position: 465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
465CCCCCUCCUGGCCCCUGUC49.60962293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502483CCCCCTCCTGGCCCCTGTCGACAGGGGCCAGGAGGGGG0.062100.001200.672400.750000.962000.75000


Target Position: 1375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1375CUCAGACUGACAUUCUCCA84.9673188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011393CTCAGACTGACATTCTCCATGGAGAATGTCAGTCTGAG0.217500.019400.465500.500001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673CCGCGCCAUGGCCAUCUAC60.96691653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
343691CCGCGCCATGGCCATCTACGTAGATGGCCATGGCGCGG0.180900.006500.732800.750000.962000.75000


Target Position: 2124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2124UCAAUUUCUUUUUUCUUUU67.8061149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2732142TCAATTTCTTTTTTCTTTTAAAAGAAAAAAGAAATTGA0.890600.623400.724100.750001.000001.00000


Target Position: 1844, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1844CUUGAAACCACCUUUUAUU78.9955419

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3184419CTTGAAACCACCTTTTATT1/1/0/097.75TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANA17:7572449..7572467(-)00TP53(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2531862CTTGAAACCACCTTTTATTAATAAAAGGTGGTTTCAAG0.501700.174100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1842-1864GCCTTGAAACCACCTTTTATTACAAUAAAAGGUGGUUUCAAGGCCUUGAAACCACCUUUUAUUACU-4.314.912


Target Position: 1431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1431CUCCCUCCCCUGCCAUUUU66.86231222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1981449CTCCCTCCCCTGCCATTTTAAAATGGCAGGGGAGGGAG0.496400.061700.810300.750001.000001.00000


Target Position: 1817, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1817GGGUUAAUGAAAUAAUGUA99.85583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1861835GGGTTAATGAAATAATGTATACATTATTTCATTAACCC0.255800.057400.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1815-1837GAGGGTTAATGAAATAATGTACAUACAUUAUUUCAUUAACCCUCGGGUUAAUGAAAUAAUGUACAU6.713.922


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424CCCAUCUCUCCCUCCCCUG55.5032002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2291442CCCATCTCTCCCTCCCCTGCAGGGGAGGGAGAGATGGG0.254900.154100.706900.750001.000001.00000


Target Position: 456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
456CUGCACCAGCCCCCUCCUG52.472160

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
463474CTGCACCAGCCCCCTCCTGCAGGAGGGGGCTGGTGCAG0.026500.003400.500000.500000.907600.62500


Target Position: 894, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
894CCAUCCACUACAACUACAU82.3884274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
144912CCATCCACTACAACTACATATGTAGTTGTAGTGGATGG0.365800.284700.689701.000001.000001.00000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826CAGAAACACUUUUCGACAU86.2393139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
469844CAGAAACACTTTTCGACATATGTCGAAAAGTGTTTCTG0.499000.001700.629300.750000.983700.75000


Target Position: 1580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1580UGGGGAGUAGGACAUACCA79.2016412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901598TGGGGAGTAGGACATACCATGGTATGTCCTACTCCCCA0.017900.002700.500000.500000.978300.75000


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847GAAACCACCUUUUAUUACA90.291179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111865GAAACCACCTTTTATTACATGTAATAAAAGGTGGTTTC0.613000.224800.465500.500001.000001.00000


Target Position: 2447, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2447GAAGGGUCAACAUCUUUUA92.543541

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2692465GAAGGGTCAACATCTTTTATAAAAGATGTTGACCCTTC0.389700.015800.637900.750001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425CCAUCUCUCCCUCCCCUGC56.0091975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671443CCATCTCTCCCTCCCCTGCGCAGGGGAGGGAGAGATGG0.511300.245800.491400.500001.000001.00000


Target Position: 1411, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1411ACAGCCUCCCACCCCCAUC51.3842214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071429ACAGCCTCCCACCCCCATCGATGGGGGTGGGAGGCTGT0.506200.415400.525900.500000.967400.62500


Target Position: 1653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1653UCUUGCAGUUAAGGGUUAG58.27611827

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4541671TCTTGCAGTTAAGGGTTAGCTAACCCTTAACTGCAAGA0.147900.002000.551700.500001.000001.00000


Target Position: 1664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1664AGGGUUAGUUUACAAUCAG73.7994711

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4391682AGGGTTAGTTTACAATCAGCTGATTGTAAACTAACCCT0.036400.019100.560300.500001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382AGAUGAAGCUCCCAGAAUG79.7974383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438400AGATGAAGCTCCCAGAATGCATTCTGGGAGCTTCATCT0.181500.027100.569000.500000.989100.62500


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622GUGAGGGAUGUUUGGGAGA76.0456577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4871640GTGAGGGATGTTTGGGAGATCTCCCAAACATCCCTCAC0.125800.043200.569000.500001.000001.00000


Target Position: 427, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
427UGCACCAGCAGCUCCUACA74.8894651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490445TGCACCAGCAGCTCCTACATGTAGGAGCTGCTGGTGCA0.179000.015100.646600.500000.913000.62500


Target Position: 1380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380ACUGACAUUCUCCACUUCU72.1375814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851398ACTGACATTCTCCACTTCTAGAAGTGGAGAATGTCAGT0.270600.037500.482800.500001.000001.00000


Target Position: 1043, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1043GACCGGCGCACAGAGGAAG63.41021469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5061061GACCGGCGCACAGAGGAAGCTTCCTCTGTGCGCCGGTC0.149500.001100.681000.500001.000001.00000


Target Position: 2356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2356GGCUGGUCUCAAACUCCUG75.5597604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4822374GGCTGGTCTCAAACTCCTGCAGGAGTTTGAGACCAGCC0.019900.002700.715500.750001.000001.00000


Target Position: 1815, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1815GAGGGUUAAUGAAAUAAUG82.187281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4671833GAGGGTTAATGAAATAATGCATTATTTCATTAACCCTC0.267700.001700.655200.500001.000001.00000


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037GGGAGAGACCGGCGCACAG73.0519759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3061055GGGAGAGACCGGCGCACAGCTGTGCGCCGGTCTCTCCC0.107700.015800.706900.750000.983700.75000


Target Position: 2118, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2118UCAGGGUCAAUUUCUUUUU65.46191335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1182136TCAGGGTCAATTTCTTTTTAAAAAGAAATTGACCCTGA0.696400.099500.724100.750001.000001.00000


Target Position: 1831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1831AUGUACAUCUGGCCUUGAA83.2692242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971849ATGTACATCTGGCCTTGAATTCAAGGCCAGATGTACAT0.236800.016300.482800.500001.000001.00000


Target Position: 2094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2094GAUCCACCAAGACUUGUUU83.3942238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3162112GATCCACCAAGACTTGTTTAAACAAGTCTTGGTGGATC0.102000.010600.681000.750000.923900.62500


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597CAGCUUAGAUUUUAAGGUU87.0243124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451615CAGCTTAGATTTTAAGGTTAACCTTAAAATCTAAGCTG0.160800.006200.637900.750001.000001.00000


Target Position: 2313, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2313CUUUUGCAUGUUUUGUAGA78.9003425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2311-2333AACTTTTGCATGTTTTGTAGAGAUCUACAAAACAUGCAAAAGUUCUUUUGCAUGUUUUGUAGAGAU11.820.020


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370CCUGACUCAGACUGACAUU81.5842295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501388CCTGACTCAGACTGACATTAATGTCAGTCTGAGTCAGG0.083000.018100.836201.000000.983700.62500


Target Position: 1631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1631GUUUGGGAGAUGUAAGAAA91.029971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4461649GTTTGGGAGATGTAAGAAATTTCTTACATCTCCCAAAC0.033600.005900.646600.750001.000001.00000


Target Position: 2111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2111UUUAUGCUCAGGGUCAAUU60.30191694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4712129TTTATGCTCAGGGTCAATTAATTGACCCTGAGCATAAA0.106100.027600.491400.500001.000001.00000


Target Position: 1674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1674UACAAUCAGCCACAUUCUA79.4183399

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111692TACAATCAGCCACATTCTATAGAATGTGGCTGATTGTA0.702100.056100.508600.500001.000001.00000


Target Position: 1656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1656UGCAGUUAAGGGUUAGUUU74.3046675

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831674TGCAGTTAAGGGTTAGTTTAAACTAACCCTTAACTGCA0.132300.014100.853400.750001.000001.00000


Target Position: 345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
345ACGAUAUUGAACAAUGGUU74.4902671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506363ACGATATTGAACAATGGTTAACCATTGTTCAATATCGT0.013500.002100.629300.750001.000001.00000


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798GAAAUUUGCGUGUGGAGUA91.410364

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
460816GAAATTTGCGTGTGGAGTATACTCCACACGCAAATTTC0.034000.003600.491400.750001.000001.00000


Target Position: 1646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1646GAAAUGUUCUUGCAGUUAA96.183213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3631664GAAATGTTCTTGCAGTTAATTAACTGCAAGAACATTTC0.076800.017800.637900.750001.000001.00000


Target Position: 1393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1393ACUUCUUGUUCCCCACUGA81.1448314

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4881411ACTTCTTGTTCCCCACTGATCAGTGGGGAACAAGAAGT0.340700.049900.482800.500001.000001.00000


Target Position: 1378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1378AGACUGACAUUCUCCACUU85.9711149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2941396AGACTGACATTCTCCACTTAAGTGGAGAATGTCAGTCT0.341900.042900.586200.750001.000001.00000


Target Position: 2306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2306CAGCCAACUUUUGCAUGUU81.0597322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3952324CAGCCAACTTTTGCATGTTAACATGCAAAAGTTGGCTG0.061300.004200.637900.750000.972800.75000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766GGCCCCUCCUCAGCAUCUU70.8381925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
424784GGCCCCTCCTCAGCATCTTAAGATGCTGAGGAGGGGCC0.044000.003300.862101.000000.923900.62500


Target Position: 2308, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2308GCCAACUUUUGCAUGUUUU76.0964570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4682326GCCAACTTTTGCATGTTTTAAAACATGCAAAAGTTGGC0.025400.020501.000001.000001.000001.00000


Target Position: 1501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1501CCAGGACUUCCAUUUGCUU81.0561323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3111519CCAGGACTTCCATTTGCTTAAGCAAATGGAAGTCCTGG0.749200.010000.706901.000000.978300.87500


Target Position: 2504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2504CCCUCCUUCUCCCUUUUUA81.5605297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332522CCCTCCTTCTCCCTTTTTATAAAAAGGGAGAAGGAGGG0.840300.837700.956901.000001.000001.00000


Target Position: 1726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1726AGCUGUCCCUCACUGUUGA82.4659268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891744AGCTGTCCCTCACTGTTGATCAACAGTGAGGGACAGCT0.179100.001400.629300.500001.000001.00000


Target Position: 338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
338UCCCCGGACGAUAUUGAAC54.16722077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503356TCCCCGGACGATATTGAACGTTCAATATCGTCCGGGGA0.129800.003400.724100.500001.000001.00000


Target Position: 1750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1750CUCUAACUUCAAGGCCCAU73.7039718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2691768CTCTAACTTCAAGGCCCATATGGGCCTTGAAGTTAGAG0.138400.032600.655200.750001.000001.00000


Target Position: 2130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2130UCUUUUUUCUUUUUUUUUU65.83351311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1062148TCTTTTTTCTTTTTTTTTTAAAAAAAAAAGAAAAAAGA0.971100.765400.724100.750001.000001.00000


Target Position: 2445, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2445UGGAAGGGUCAACAUCUUU72.5124785

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4342463TGGAAGGGTCAACATCTTTAAAGATGTTGACCCTTCCA0.306100.002500.844800.750001.000001.00000


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472CUGGCCCCUGUCAUCUUCU67.79861151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
499490CTGGCCCCTGTCATCTTCTAGAAGATGACAGGGGCCAG0.145900.001200.560300.500001.000001.00000


Target Position: 343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
343GGACGAUAUUGAACAAUGG80.0084375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
485361GGACGATATTGAACAATGGCCATTGTTCAATATCGTCC0.019600.001500.525900.500001.000001.00000


Target Position: 263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
263GACCUAUGGAAACUACUUC74.3774673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454281GACCTATGGAAACTACTTCGAAGTAGTTTCCATAGGTC0.083400.029600.646600.500001.000001.00000


Target Position: 2098, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2098CACCAAGACUUGUUUUAUG79.7641387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3212116CACCAAGACTTGTTTTATGCATAAAACAAGTCTTGGTG0.238100.041800.637900.500001.000001.00000


Target Position: 1303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1303CCACCUGAAGUCCAAAAAG71.3746871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401321CCACCTGAAGTCCAAAAAGCTTTTTGGACTTCAGGTGG0.036300.017300.706900.750001.000001.00000


Target Position: 2476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2476GCACAUCUGCAUUUUCACC70.326957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4392494GCACATCTGCATTTTCACCGGTGAAAATGCAGATGTGC0.975600.059900.500000.500000.945700.62500


Target Position: 998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
998GGACGGAACAGCUUUGAGG70.8244926

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611016GGACGGAACAGCTTTGAGGCCTCAAAGCTGTTCCGTCC0.032900.001800.525900.500001.000001.00000


Target Position: 1737, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1737ACUGUUGAAUUUUCUCUAA87.1326121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2341755ACTGTTGAATTTTCTCTAATTAGAGAAAATTCAACAGT0.315800.072500.672400.750001.000001.00000


Target Position: 2532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2532UUUAUAUCGAUCUCUUAUU69.69991005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4632550TTTATATCGATCTCTTATTAATAAGAGATCGATATAAA0.650100.408600.491400.500001.000001.00000


Target Position: 1700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1700GCCCACUUCACCGUACUAA81.149312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431718GCCCACTTCACCGTACTAATTAGTACGGTGAAGTGGGC0.085800.014700.965501.000000.978300.87500


Target Position: 2096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2096UCCACCAAGACUUGUUUUA69.08341056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2712114TCCACCAAGACTTGTTTTATAAAACAAGTCTTGGTGGA0.136600.048400.836200.750001.000001.00000


Target Position: 2120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2120AGGGUCAAUUUCUUUUUUC64.55111400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4302138AGGGTCAATTTCTTTTTTCGAAAAAAGAAATTGACCCT0.677500.167400.672400.500001.000001.00000


Target Position: 2122, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2122GGUCAAUUUCUUUUUUCUU85.5177168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1142140GGTCAATTTCTTTTTTCTTAAGAAAAAAGAAATTGACC0.781400.228700.715501.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2120-2142AGGGTCAATTTCTTTTTTCTTTTAAGAAAAAAGAAAUUGACCCUGGUCAAUUUCUUUUUUCUUUUU5.514.821


Target Position: 1379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1379GACUGACAUUCUCCACUUC80.6457337

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811397GACTGACATTCTCCACTTCGAAGTGGAGAATGTCAGTC0.340000.051100.646600.500001.000001.00000


Target Position: 575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
575ACGUACUCCCCUGCCCUCA65.48741332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
501593ACGTACTCCCCTGCCCTCATGAGGGCAGGGGAGTACGT0.210400.085500.551700.500001.000001.00000


Target Position: 336, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
336UGUCCCCGGACGAUAUUGA70.1192981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
484354TGTCCCCGGACGATATTGATCAATATCGTCCGGGGACA0.075700.002600.482800.500000.918500.62500


Target Position: 1659, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1659AGUUAAGGGUUAGUUUACA85.2702178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481677AGTTAAGGGTTAGTTTACATGTAAACTAACCCTTAACT0.293700.069500.500000.500001.000001.00000


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635GGGAGAUGUAAGAAAUGUU92.511443

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841653GGGAGATGTAAGAAATGTTAACATTTCTTACATCTCCC0.019600.005200.844801.000001.000001.00000


Target Position: 1329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1329CUACCUCCCGCCAUAAAAA85.9036154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2271347CTACCTCCCGCCATAAAAATTTTTATGGCGGGAGGTAG0.623500.277900.672400.750001.000001.00000


Target Position: 2524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2524AUCCCAUUUUUAUAUCGAU79.5584394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5092542ATCCCATTTTTATATCGATATCGATATAAAAATGGGAT0.570800.563500.500000.500001.000001.00000


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389CUCCACUUCUUGUUCCCCA78.1123468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071407CTCCACTTCTTGTTCCCCATGGGGAACAAGAAGTGGAG0.141200.055600.465500.500001.000001.00000


Target Position: 1464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1464UGAACCCUUGCUUGCAAUA74.2681

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831482TGAACCCTTGCTTGCAATATATTGCAAGCAAGGGTTCA0.127200.016100.681000.750001.000001.00000


Target Position: 298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
298GUCCCCCUUGCCGUCCCAA67.98481135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
280316GTCCCCCTTGCCGTCCCAATTGGGACGGCAAGGGGGAC0.579300.014600.672400.750000.994600.62500


Target Position: 999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
999GACGGAACAGCUUUGAGGU78.9482422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5041017GACGGAACAGCTTTGAGGTACCTCAAAGCTGTTCCGTC0.598200.001500.465500.500001.000001.00000


Target Position: 793, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
793GGAAGGAAAUUUGCGUGUG70.3123959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
404811GGAAGGAAATTTGCGTGTGCACACGCAAATTTCCTTCC0.055200.051600.577600.750001.000001.00000


Target Position: 2507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2507UCCUUCUCCCUUUUUAUAU66.63761237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1972525TCCTTCTCCCTTTTTATATATATAAAAAGGGAGAAGGA0.804900.801400.827600.750001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412UCCCCCCGUGGCCCCUGCA50.09762271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508430TCCCCCCGTGGCCCCTGCATGCAGGGGCCACGGGGGGA0.013300.001400.517200.500000.967400.75000


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592CAUACCAGCUUAGAUUUUA90.135285

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4031610CATACCAGCTTAGATTTTATAAAATCTAAGCTGGTATG0.285600.003400.620700.750000.994600.87500


Target Position: 476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476CCCCUGUCAUCUUCUGUCC62.17131561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
405494CCCCTGTCATCTTCTGTCCGGACAGAAGATGACAGGGG0.112900.011300.620700.500001.000001.00000


Target Position: 568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
568GACUUGCACGUACUCCCCU75.5231608

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496586GACTTGCACGTACTCCCCTAGGGGAGTACGTGCAAGTC0.122900.007100.474100.500001.000001.00000


Target Position: 1919, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1919CGGUGGGUUGGUAGUUUCU77.3046501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3821937CGGTGGGTTGGTAGTTTCTAGAAACTACCAACCCACCG0.105200.004500.689700.750001.000001.00000


Target Position: 2125, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2125CAAUUUCUUUUUUCUUUUU80.7766333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2392143CAATTTCTTTTTTCTTTTTAAAAAGAAAAAAGAAATTG0.894300.632000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2123-2145GTCAATTTCTTTTTTCTTTTTTTAAAAAGAAAAAAGAAAUUGACCAAUUUCUUUUUUCUUUUUUUU5.55.310


Target Position: 1140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1140GCUCCUCUCCCCAGCCAAA85.8896156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2911158GCTCCTCTCCCCAGCCAAATTTGGCTGGGGAGAGGAGC0.235400.012600.853401.000000.967400.62500


Target Position: 577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
577GUACUCCCCUGCCCUCAAC63.46591466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
399595GTACTCCCCTGCCCTCAACGTTGAGGGCAGGGGAGTAC0.248200.101800.534500.500001.000001.00000


Target Position: 1403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403CCCCACUGACAGCCUCCCA73.6484722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2671421CCCCACTGACAGCCTCCCATGGGAGGCTGTCAGTGGGG0.704600.324700.646600.750001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046CGGCGCACAGAGGAAGAGA79.112416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931064CGGCGCACAGAGGAAGAGATCTCTTCCTCTGTGCGCCG0.128400.001400.689700.750001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381CAGAUGAAGCUCCCAGAAU82.8437253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
186399CAGATGAAGCTCCCAGAATATTCTGGGAGCTTCATCTG0.421600.072700.775900.750000.967400.62500


Target Position: 1504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1504GGACUUCCAUUUGCUUUGU73.6584720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5001522GGACTTCCATTTGCTTTGTACAAAGCAAATGGAAGTCC0.014800.003800.663800.750001.000001.00000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846UGAAACCACCUUUUAUUAC60.80341662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171864TGAAACCACCTTTTATTACGTAATAAAAGGTGGTTTCA0.587100.223900.543100.500001.000001.00000


Target Position: 1916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1916GGUCGGUGGGUUGGUAGUU74.58669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701934GGTCGGTGGGTTGGTAGTTAACTACCAACCCACCGACC0.303100.001700.706901.000001.000001.00000


Target Position: 530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
530CGUCUGGGCUUCUUGCAUU84.5169202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
296548CGTCTGGGCTTCTTGCATTAATGCAAGAAGCCCAGACG0.182800.011800.767201.000001.000001.00000


Target Position: 973, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
973GGAAGACUCCAGUGGUAAU93.530830

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_197319GGAAGACTCCAGTGGTAAT1/1/0/097.75TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANANA00TP53(0.002)


Target Position: 2568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2568UGCCACCUGUGUGUCUGAG58.77741794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4722586TGCCACCTGTGTGTCTGAGCTCAGACACACAGGTGGCA0.023000.010100.543100.500000.907600.87500


Target Position: 2508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508CCUUCUCCCUUUUUAUAUC73.0097761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1802526CCTTCTCCCTTTTTATATCGATATAAAAAGGGAGAAGG0.801200.797000.663800.750001.000001.00000


Target Position: 2539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2539CGAUCUCUUAUUUUACAAU90.191782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1272557CGATCTCTTATTTTACAATATTGTAAAATAAGAGATCG0.429700.394800.784501.000001.000001.00000


Target Position: 587, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
587GCCCUCAACAAGAUGUUUU75.5816603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
365605GCCCTCAACAAGATGTTTTAAAACATCTTGTTGAGGGC0.076400.012601.000001.000000.989100.62500


Target Position: 2483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2483UGCAUUUUCACCCCACCCU57.21661898

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4322501TGCATTTTCACCCCACCCTAGGGTGGGGTGAAAATGCA0.997700.474100.508600.500000.994600.75000


Target Position: 2121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2121GGGUCAAUUUCUUUUUUCU88.3146107

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1752139GGGTCAATTTCTTTTTTCTAGAAAAAAGAAATTGACCC0.695100.189400.767200.750001.000001.00000


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049CGCACAGAGGAAGAGAAUC68.45261106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3671067CGCACAGAGGAAGAGAATCGATTCTCTTCCTCTGTGCG0.115700.005200.741400.750001.000001.00000


Target Position: 2517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2517UUUUUAUAUCCCAUUUUUA80.2759355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082535TTTTTATATCCCATTTTTATAAAAATGGGATATAAAAA0.698300.670600.465500.500001.000001.00000


Target Position: 2484, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2484GCAUUUUCACCCCACCCUU76.4369556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1182502GCATTTTCACCCCACCCTTAAGGGTGGGGTGAAAATGC0.997100.973500.715501.000001.000001.00000


Target Position: 1652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1652UUCUUGCAGUUAAGGGUUA70.6882933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5051670TTCTTGCAGTTAAGGGTTATAACCCTTAACTGCAAGAA0.161600.001200.637900.500001.000001.00000


Target Position: 895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
895CAUCCACUACAACUACAUG82.6046262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
410913CATCCACTACAACTACATGCATGTAGTTGTAGTGGATG0.156400.048800.500000.500001.000001.00000


Target Position: 2144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2144UUUUUUUUUUUUUCUUUUU59.34981756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4302162TTTTTTTTTTTTTCTTTTTAAAAAGAAAAAAAAAAAAA0.639300.668600.500000.500001.000001.00000


Target Position: 191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
191CGGGUCACUGCCAUGGAGG57.59641868

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
435209CGGGTCACTGCCATGGAGGCCTCCATGGCAGTGACCCG0.045100.002500.569000.500000.983701.00000


Target Position: 2543, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2543CUCUUAUUUUACAAUAAAA96.6658

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8254319CTCTTATTTTACAATAAAA1/1/0/093.44TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANA17:7571750..7571768(-)00TP53(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2541-2563ATCTCTTATTTTACAATAAAACTUUUUAUUGUAAAAUAAGAGAUCUCUUAUUUUACAAUAAAACUU-1.46.922


Target Position: 1500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1500CCCAGGACUUCCAUUUGCU76.7351537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2931518CCCAGGACTTCCATTTGCTAGCAAATGGAAGTCCTGGG0.722700.012500.637900.750000.978301.00000


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533UUAUAUCGAUCUCUUAUUU76.1515565

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3562551TTATATCGATCTCTTATTTAAATAAGAGATCGATATAA0.620500.404700.534500.500001.000001.00000


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878GGCUCUGACUGUACCACCA93.973325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
462896GGCTCTGACTGTACCACCATGGTGGTACAGTCAGAGCC0.035500.001800.655200.750001.000001.00000


Target Position: 494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
494CCUUCCCAGAAAACCUACC54.64422048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
470512CCTTCCCAGAAAACCTACCGGTAGGTTTTCTGGGAAGG0.088300.025500.491400.500001.000001.00000


Target Position: 537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
537GCUUCUUGCAUUCUGGGAC66.05621292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497555GCTTCTTGCATTCTGGGACGTCCCAGAATGCAAGAAGC0.016100.006400.534500.750001.000001.00000


Target Position: 2465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465ACAUUCUGCAAGCACAUCU71.5089859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4772483ACATTCTGCAAGCACATCTAGATGTGCTTGCAGAATGT0.045800.012400.482800.500001.000001.00000


Target Position: 2123, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2123GUCAAUUUCUUUUUUCUUU77.9071475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1352141GTCAATTTCTTTTTTCTTTAAAGAAAAAAGAAATTGAC0.874500.564400.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2121-2143GGGTCAATTTCTTTTTTCTTTTTAAAGAAAAAAGAAAUUGACCCGUCAAUUUCUUUUUUCUUUUUU5.57.421


Target Position: 804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804UGCGUGUGGAGUAUUUGGA71.3241877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483822TGCGTGTGGAGTATTTGGATCCAAATACTCCACACGCA0.101700.002400.482800.500001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625AGGGAUGUUUGGGAGAUGU70.3624952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231643AGGGATGTTTGGGAGATGTACATCTCCCAAACATCCCT0.290800.010100.637900.500001.000001.00000


Target Position: 1818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1818GGUUAAUGAAAUAAUGUAC81.3476303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2911836GGTTAATGAAATAATGTACGTACATTATTTCATTAACC0.119700.057900.672400.750001.000001.00000


Target Position: 2197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2197GGAGUGGAGUGGCGUGAUC73.3157739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4082215GGAGTGGAGTGGCGTGATCGATCACGCCACTCCACTCC0.057100.003300.689700.750001.000001.00000


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906ACUACAUGUGUAACAGUUC68.96641065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354924ACTACATGTGTAACAGTTCGAACTGTTACACATGTAGT0.113200.012700.534500.500000.994600.62500


Target Position: 1657, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1657GCAGUUAAGGGUUAGUUUA91.445163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2701675GCAGTTAAGGGTTAGTTTATAAACTAACCCTTAACTGC0.137000.039400.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1655-1677TTGCAGTTAAGGGTTAGTTTACAUAAACUAACCCUUAACUGCAAGCAGUUAAGGGUUAGUUUACAU4.911.833


Target Position: 574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
574CACGUACUCCCCUGCCCUC65.94921304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510592CACGTACTCCCCTGCCCTCGAGGGCAGGGGAGTACGTG0.204900.073800.482800.500000.956500.62500


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390UCCACUUCUUGUUCCCCAC56.61451935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3501408TCCACTTCTTGTTCCCCACGTGGGGAACAAGAAGTGGA0.178600.055800.577600.500001.000001.00000


Target Position: 1039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1039GAGAGACCGGCGCACAGAG75.0348640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331057GAGAGACCGGCGCACAGAGCTCTGTGCGCCGGTCTCTC0.063900.007600.500000.500001.000001.00000


Target Position: 2029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2029CCUAAAAGGAAAUCUCACC65.30711345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4932047CCTAAAAGGAAATCTCACCGGTGAGATTTCCTTTTAGG0.352300.026300.491400.500000.967400.75000


Target Position: 1632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1632UUUGGGAGAUGUAAGAAAU75.5543605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681650TTTGGGAGATGTAAGAAATATTTCTTACATCTCCCAAA0.030400.004800.491400.500001.000001.00000


Target Position: 2525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2525UCCCAUUUUUAUAUCGAUC59.73821730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2802543TCCCATTTTTATATCGATCGATCGATATAAAAATGGGA0.575500.560500.689700.500001.000001.00000


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954UCCUCACCAUCAUCACACU75.6903597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
300972TCCTCACCATCATCACACTAGTGTGATGATGGTGAGGA0.127200.079200.663800.500001.000001.00000


Target Position: 344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344GACGAUAUUGAACAAUGGU80.2079361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
510362GACGATATTGAACAATGGTACCATTGTTCAATATCGTC0.017100.002000.465500.500001.000001.00000


Target Position: 453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
453CCCCUGCACCAGCCCCCUC51.6832199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
264471CCCCTGCACCAGCCCCCTCGAGGGGGCTGGTGCAGGGG0.142500.115700.681000.750000.929301.00000


Target Position: 1736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1736CACUGUUGAAUUUUCUCUA92.811639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2681754CACTGTTGAATTTTCTCTATAGAGAAAATTCAACAGTG0.322000.080100.620700.750001.000001.00000


Target Position: 1571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1571GGAGGAGGAUGGGGAGUAG77.28502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1341589GGAGGAGGATGGGGAGTAGCTACTCCCCATCCTCCTCC0.530100.087100.698300.750001.000001.00000


Target Position: 1630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1630UGUUUGGGAGAUGUAAGAA81.2225308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471648TGTTTGGGAGATGTAAGAATTCTTACATCTCCCAAACA0.033200.007500.534500.750001.000001.00000


Target Position: 1628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1628GAUGUUUGGGAGAUGUAAG78.8338427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4641646GATGTTTGGGAGATGTAAGCTTACATCTCCCAAACATC0.295700.008200.543100.500001.000001.00000


Target Position: 1819, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1819GUUAAUGAAAUAAUGUACA84.6291199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1817-1839GGGTTAATGAAATAATGTACATCUGUACAUUAUUUCAUUAACCCGUUAAUGAAAUAAUGUACAUCU14.68.921


Target Position: 576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
576CGUACUCCCCUGCCCUCAA84.8962190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
256594CGTACTCCCCTGCCCTCAATTGAGGGCAGGGGAGTACG0.229500.096100.629301.000001.000001.00000


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760UGGUCUGGCCCCUCCUCAG61.39461623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
500778TGGTCTGGCCCCTCCTCAGCTGAGGAGGGGCCAGACCA0.027700.001200.560300.500000.902200.75000


Target Position: 489, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
489CUGUCCCUUCCCAGAAAAC62.96791506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
508507CTGTCCCTTCCCAGAAAACGTTTTCTGGGAAGGGACAG0.030000.001100.637900.500000.918500.62500


Target Position: 1601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1601UUAGAUUUUAAGGUUUUUA71.6351850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341619TTAGATTTTAAGGTTTTTATAAAAACCTTAAAATCTAA0.178900.080800.500000.500001.000001.00000


Target Position: 2196, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2196UGGAGUGGAGUGGCGUGAU68.7141089

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5102214TGGAGTGGAGTGGCGTGATATCACGCCACTCCACTCCA0.104000.001000.663800.750001.000001.00000


Target Position: 480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
480UGUCAUCUUCUGUCCCUUC65.46671334

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
495498TGTCATCTTCTGTCCCTTCGAAGGGACAGAAGATGACA0.058500.053300.534500.500001.000001.00000


Target Position: 1325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1325CAGUCUACCUCCCGCCAUA92.852137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1161343CAGTCTACCTCCCGCCATATATGGCGGGAGGTAGACTG0.498000.288900.741400.750000.962000.62500


Target Position: 1751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1751UCUAACUUCAAGGCCCAUA66.78051230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2101769TCTAACTTCAAGGCCCATATATGGGCCTTGAAGTTAGA0.209000.033800.681000.750001.000001.00000


Target Position: 1372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372UGACUCAGACUGACAUUCU76.8935523

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4771390TGACTCAGACTGACATTCTAGAATGTCAGTCTGAGTCA0.105000.020400.500000.500001.000001.00000


Target Position: 531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
531GUCUGGGCUUCUUGCAUUC68.1191129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375549GTCTGGGCTTCTTGCATTCGAATGCAAGAAGCCCAGAC0.192400.013300.646600.500001.000001.00000


Target Position: 2526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2526CCCAUUUUUAUAUCGAUCU71.0188910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1012544CCCATTTTTATATCGATCTAGATCGATATAAAAATGGG0.611400.554900.767200.750001.000001.00000


Target Position: 1428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1428UCUCUCCCUCCCCUGCCAU57.82911856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3151446TCTCTCCCTCCCCTGCCATATGGCAGGGGAGGGAGAGA0.479500.209600.569000.750001.000001.00000


Target Position: 884, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
884GACUGUACCACCAUCCACU86.2064141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400902GACTGTACCACCATCCACTAGTGGATGGTGGTACAGTC0.474400.003400.612100.500000.983700.62500


Target Position: 249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
249AGGAAACAUUUUCAGACCU74.3446674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
503267AGGAAACATTTTCAGACCTAGGTCTGAAAATGTTTCCT0.014200.001700.500000.500001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885ACUGUACCACCAUCCACUA85.9217153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
384903ACTGTACCACCATCCACTATAGTGGATGGTGGTACAGT0.446300.004400.534500.750000.983700.62500


Target Position: 1589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1589GGACAUACCAGCUUAGAUU91.602761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4571607GGACATACCAGCTTAGATTAATCTAAGCTGGTATGTCC0.056700.002000.862101.000000.994600.62500


Target Position: 2450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2450GGGUCAACAUCUUUUACAU96.61439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1272468GGGTCAACATCTTTTACATATGTAAAAGATGTTGACCC0.611800.084800.836201.000001.000001.00000


Target Position: 1616, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1616UUUACUGUGAGGGAUGUUU61.28331630

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4681634TTTACTGTGAGGGATGTTTAAACATCCCTCACAGTAAA0.108500.004900.500000.500001.000001.00000


Target Position: 1422, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1422CCCCCAUCUCUCCCUCCCC51.07312225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121440CCCCCATCTCTCCCTCCCCGGGGAGGGAGAGATGGGGG0.451900.271000.500000.500001.000001.00000


Target Position: 1598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1598AGCUUAGAUUUUAAGGUUU79.3159405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2841616AGCTTAGATTTTAAGGTTTAAACCTTAAAATCTAAGCT0.160400.014000.853400.750001.000001.00000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845UUGAAACCACCUUUUAUUA76.3053559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3411863TTGAAACCACCTTTTATTATAATAAAAGGTGGTTTCAA0.604700.204800.612100.500001.000001.00000


Target Position: 1313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1313UCCAAAAAGGGUCAGUCUA74.0567693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631331TCCAAAAAGGGTCAGTCTATAGACTGACCCTTTTTGGA0.279100.001800.698300.750000.934800.75000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414GGGAUUACAAUUGUGAGCC60.56111680

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652432GGGATTACAATTGTGAGCCGGCTCACAATTGTAATCCC0.026100.006600.491400.500001.000001.00000


Target Position: 1465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1465GAACCCUUGCUUGCAAUAG66.58811243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4731483GAACCCTTGCTTGCAATAGCTATTGCAAGCAAGGGTTC0.022600.004300.500000.500001.000001.00000


Target Position: 1843, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1843CCUUGAAACCACCUUUUAU87.5526116

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5184319CCTTGAAACCACCTTTTAT1/1/0/094.96TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANA17:7572450..7572468(-)00TP53(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1011861CCTTGAAACCACCTTTTATATAAAAGGTGGTTTCAAGG0.529000.122300.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1841-1863GGCCTTGAAACCACCTTTTATTAAUAAAAGGUGGUUUCAAGGCCCCUUGAAACCACCUUUUAUUAU11.012.223


Target Position: 1660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660GUUAAGGGUUAGUUUACAA95.197818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4111678GTTAAGGGTTAGTTTACAATTGTAAACTAACCCTTAAC0.322300.070900.500000.750001.000001.00000


Target Position: 2520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2520UUAUAUCCCAUUUUUAUAU72.4984787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4692538TTATATCCCATTTTTATATATATAAAAATGGGATATAA0.669800.640700.491400.500001.000001.00000


Target Position: 61, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
61CUCAAAAGUCUAGAGCCAC66.23011274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
38279CTCAAAAGTCTAGAGCCACGTGGCTCTAGACTTTTGAG0.098300.059400.517200.500000.978300.62500


Target Position: 1335, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1335CCCGCCAUAAAAAACUCAU71.7307842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1791353CCCGCCATAAAAAACTCATATGAGTTTTTTATGGCGGG0.272700.239700.836201.000001.000001.00000


Target Position: 533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
533CUGGGCUUCUUGCAUUCUG64.22761414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437551CTGGGCTTCTTGCATTCTGCAGAATGCAAGAAGCCCAG0.038500.002600.500000.500001.000001.00000


Target Position: 791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
791GUGGAAGGAAAUUUGCGUG66.921217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
432809GTGGAAGGAAATTTGCGTGCACGCAAATTTCCTTCCAC0.074200.051300.500000.500001.000001.00000


Target Position: 1038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1038GGAGAGACCGGCGCACAGA83.4585236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2621056GGAGAGACCGGCGCACAGATCTGTGCGCCGGTCTCTCC0.143500.023100.646600.750001.000001.00000


Target Position: 1569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1569GGGGAGGAGGAUGGGGAGU59.70151734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2901587GGGGAGGAGGATGGGGAGTACTCCCCATCCTCCTCCCC0.120600.115200.784500.750001.000001.00000


Target Position: 1924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1924GGUUGGUAGUUUCUACAGU85.4111172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3781942GGTTGGTAGTTTCTACAGTACTGTAGAAACTACCAACC0.070600.006900.646600.750000.945700.87500


Target Position: 2199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2199AGUGGAGUGGCGUGAUCUU80.4291346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3522217AGTGGAGTGGCGTGATCTTAAGATCACGCCACTCCACT0.209900.005700.569000.750001.000001.00000


Target Position: 532, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
532UCUGGGCUUCUUGCAUUCU60.05021706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
407550TCTGGGCTTCTTGCATTCTAGAATGCAAGAAGCCCAGA0.252300.014900.500000.500001.000001.00000


Target Position: 1645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1645AGAAAUGUUCUUGCAGUUA81.9251290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3891663AGAAATGTTCTTGCAGTTATAACTGCAAGAACATTTCT0.062900.012800.689700.750001.000001.00000


Target Position: 805, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
805GCGUGUGGAGUAUUUGGAU85.4604171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
431823GCGTGTGGAGTATTTGGATATCCAAATACTCCACACGC0.091300.002600.741401.000001.000001.00000


Target Position: 1473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1473GCUUGCAAUAGGUGUGCGU72.4974788

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5101491GCTTGCAATAGGTGTGCGTACGCACACCTATTGCAAGC0.013000.001600.577600.750000.934800.75000


Target Position: 1497, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1497GCACCCAGGACUUCCAUUU74.9059649

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10149719GCACCCAGGACTTCCATTT1/1/0/091.46TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANA17:7572796..7572814(-)00TP53(0.002)


Target Position: 1743, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1743GAAUUUUCUCUAACUUCAA95.62614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3721761GAATTTTCTCTAACTTCAATTGAAGTTAGAGAAAATTC0.073100.045900.525900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1741-1763TTGAATTTTCTCTAACTTCAAGGUUGAAGUUAGAGAAAAUUCAAGAAUUUUCUCUAACUUCAAGGU19.20.412


Target Position: 1948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1948AGCUGGUUAGGUAGAGGGA77.6191490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5011966AGCTGGTTAGGTAGAGGGATCCCTCTACCTAACCAGCT0.014700.003900.482800.500001.000001.00000


Target Position: 1413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1413AGCCUCCCACCCCCAUCUC49.52872299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3431431AGCCTCCCACCCCCATCTCGAGATGGGGGTGGGAGGCT0.483600.463200.543100.500001.000001.00000


Target Position: 145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
145CCACGACGGUGACACGCUU82.4952267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
455163CCACGACGGTGACACGCTTAAGCGTGTCACCGTCGTGG0.101600.002000.706901.000000.929300.62500


Target Position: 912, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
912UGUGUAACAGUUCCUGCAU73.655721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502930TGTGTAACAGTTCCTGCATATGCAGGAACTGTTACACA0.014300.001300.551700.750000.929300.75000


Target Position: 669, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
669GCGUCCGCGCCAUGGCCAU67.29171185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473687GCGTCCGCGCCATGGCCATATGGCCATGGCGCGGACGC0.062600.001600.767201.000000.929300.62500


Target Position: 1996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1996CCCUGUCUGACAACCUCUU75.7028596

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1752014CCCTGTCTGACAACCTCTTAAGAGGTTGTCAGACAGGG0.282600.119400.853401.000000.989101.00000


Target Position: 2148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148UUUUUUUUUCUUUUUCUUU61.7461594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4202166TTTTTTTTTCTTTTTCTTTAAAGAAAAAGAAAAAAAAA0.388100.289700.500000.500001.000001.00000


Target Position: 1637, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1637GAGAUGUAAGAAAUGUUCU84.0258222

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1635-1657GGGAGATGTAAGAAATGTTCTTGAGAACAUUUCUUACAUCUCCCGAGAUGUAAGAAAUGUUCUUGU14.820.321


Target Position: 1334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1334UCCCGCCAUAAAAAACUCA66.22111277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251352TCCCGCCATAAAAAACTCATGAGTTTTTTATGGCGGGA0.331800.205200.646600.500001.000001.00000


Target Position: 1302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1302GCCACCUGAAGUCCAAAAA79.5737393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001320GCCACCTGAAGTCCAAAAATTTTTGGACTTCAGGTGGC0.235400.068501.000001.000001.000001.00000


Target Position: 880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
880CUCUGACUGUACCACCAUC76.1632563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
416898CTCTGACTGTACCACCATCGATGGTGGTACAGTCAGAG0.091400.002900.629300.500000.967400.62500


Target Position: 2538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2538UCGAUCUCUUAUUUUACAA79.2489408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1892556TCGATCTCTTATTTTACAATTGTAAAATAAGAGATCGA0.451400.371000.646600.750001.000001.00000


Target Position: 1809, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1809CAUUGUGAGGGUUAAUGAA96.537210

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1807-1829TGCATTGTGAGGGTTAATGAAATUUCAUUAACCCUCACAAUGCACAUUGUGAGGGUUAAUGAAAUU8.920.522


Target Position: 1658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1658CAGUUAAGGGUUAGUUUAC74.9797647

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3581676CAGTTAAGGGTTAGTTTACGTAAACTAACCCTTAACTG0.176500.074500.603400.500001.000001.00000


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373CCCAGGUCCAGAUGAAGCU70.7552932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
300391CCCAGGTCCAGATGAAGCTAGCTTCATCTGGACCTGGG0.165500.011100.637900.750001.000001.00000


Target Position: 2132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2132UUUUUUCUUUUUUUUUUUU60.43721689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4132150TTTTTTCTTTTTTTTTTTTAAAAAAAAAAAAGAAAAAA0.988300.879600.500000.500001.000001.00000


Target Position: 1702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1702CCACUUCACCGUACUAACC65.91141307

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591720CCACTTCACCGTACTAACCGGTTAGTACGGTGAAGTGG0.738500.026200.491400.500000.978300.62500


Target Position: 2198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2198GAGUGGAGUGGCGUGAUCU84.1556215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3632216GAGTGGAGTGGCGTGATCTAGATCACGCCACTCCACTC0.245300.007600.586200.500001.000001.00000


Target Position: 1581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1581GGGGAGUAGGACAUACCAG78.678432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4891599GGGGAGTAGGACATACCAGCTGGTATGTCCTACTCCCC0.018200.003300.706900.750000.978300.75000


Target Position: 797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
797GGAAAUUUGCGUGUGGAGU71.2571883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
454815GGAAATTTGCGTGTGGAGTACTCCACACGCAAATTTCC0.029900.005600.663800.750001.000001.00000


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380CCAGAUGAAGCUCCCAGAA85.3648173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
165398CCAGATGAAGCTCCCAGAATTCTGGGAGCTTCATCTGG0.598800.119700.672401.000000.967400.75000


Target Position: 2071, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2071CAUCUCUUGUAUAUGAUGA90.369977

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2069-2091TTCATCTCTTGTATATGATGATCUCAUCAUAUACAAGAGAUGAACAUCUCUUGUAUAUGAUGAUCU14.919.122


Target Position: 2503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2503CCCCUCCUUCUCCCUUUUU63.33841478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322521CCCCTCCTTCTCCCTTTTTAAAAAGGGAGAAGGAGGGG0.860800.859200.991401.000001.000001.00000


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767GCCCCUCCUCAGCAUCUUA88.2098108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
444785GCCCCTCCTCAGCATCTTATAAGATGCTGAGGAGGGGC0.042700.002300.965501.000000.967400.62500


Target Position: 1328, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1328UCUACCUCCCGCCAUAAAA72.4094795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1211346TCTACCTCCCGCCATAAAATTTTATGGCGGGAGGTAGA0.746700.332800.724100.750001.000001.00000


Target Position: 2119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2119CAGGGUCAAUUUCUUUUUU80.5564343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2432137CAGGGTCAATTTCTTTTTTAAAAAAGAAATTGACCCTG0.682200.113300.784500.750001.000001.00000


Target Position: 473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
473UGGCCCCUGUCAUCUUCUG57.79551859

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451491TGGCCCCTGTCATCTTCTGCAGAAGATGACAGGGGCCA0.138900.009900.560300.500001.000001.00000


Target Position: 1732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1732CCCUCACUGUUGAAUUUUC73.7549715

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2551750CCCTCACTGTTGAATTTTCGAAAATTCAACAGTGAGGG0.147400.023600.819000.750001.000001.00000


Target Position: 2310, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2310CAACUUUUGCAUGUUUUGU71.8913829

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2308-2330GCCAACTTTTGCATGTTTTGTAGACAAAACAUGCAAAAGUUGGCCAACUUUUGCAUGUUUUGUAGU12.23.221


Target Position: 1432, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1432UCCCUCCCCUGCCAUUUUG47.16932368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911450TCCCTCCCCTGCCATTTTGCAAAATGGCAGGGGAGGGA0.017600.014500.724100.500001.000001.00000


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634UGGGAGAUGUAAGAAAUGU70.4096950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581652TGGGAGATGTAAGAAATGTACATTTCTTACATCTCCCA0.028100.004200.637900.500001.000001.00000


Target Position: 1429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1429CUCUCCCUCCCCUGCCAUU67.08351203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1781447CTCTCCCTCCCCTGCCATTAATGGCAGGGGAGGGAGAG0.478800.205000.801700.750001.000001.00000


Target Position: 2496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2496CACCCUUCCCCUCCUUCUC59.54651743

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4792514CACCCTTCCCCTCCTTCTCGAGAAGGAGGGGAAGGGTG0.991900.990100.482800.500001.000001.00000


Target Position: 278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
278CUUCCUGAAAACAACGUUC64.92821376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505296CTTCCTGAAAACAACGTTCGAACGTTGTTTTCAGGAAG0.500600.079800.465500.500001.000001.00000


Target Position: 1323, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1323GUCAGUCUACCUCCCGCCA76.0545575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4941341GTCAGTCTACCTCCCGCCATGGCGGGAGGTAGACTGAC0.403900.052700.474100.500000.902200.62500


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371CUGACUCAGACUGACAUUC63.9841431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4341389CTGACTCAGACTGACATTCGAATGTCAGTCTGAGTCAG0.094700.019000.612100.500001.000001.00000


Target Position: 792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
792UGGAAGGAAAUUUGCGUGU57.43511880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
391810TGGAAGGAAATTTGCGTGTACACGCAAATTTCCTTCCA0.062400.051600.637900.500001.000001.00000


Target Position: 321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
321UGGAUGAUUUGAUGCUGUC66.27151271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413339TGGATGATTTGATGCTGTCGACAGCATCAAATCATCCA0.047100.007900.525900.500001.000001.00000


Target Position: 2332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2332GAUGGGGUCUCACAGUGUU86.6875128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3712350GATGGGGTCTCACAGTGTTAACACTGTGAGACCCCATC0.203300.019800.534500.750001.000001.00000


Target Position: 2307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2307AGCCAACUUUUGCAUGUUU77.1104512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4182325AGCCAACTTTTGCATGTTTAAACATGCAAAAGTTGGCT0.045500.007600.853400.750000.972800.75000


Target Position: 997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997GGGACGGAACAGCUUUGAG75.1098638

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3361015GGGACGGAACAGCTTTGAGCTCAAAGCTGTTCCGTCCC0.088900.029200.681000.750001.000001.00000


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339CCCCGGACGAUAUUGAACA78.951421

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
392357CCCCGGACGATATTGAACATGTTCAATATCGTCCGGGG0.147700.003900.784500.750001.000001.00000


Target Position: 1603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1603AGAUUUUAAGGUUUUUACU77.2059508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4851621AGATTTTAAGGTTTTTACTAGTAAAAACCTTAAAATCT0.027500.018300.517200.500001.000001.00000


Target Position: 478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478CCUGUCAUCUUCUGUCCCU76.1005569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
406496CCTGTCATCTTCTGTCCCTAGGGACAGAAGATGACAGG0.097100.025900.500000.750001.000001.00000


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870GUCUAGAACUUGACCCCCU78.663434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5071888GTCTAGAACTTGACCCCCTAGGGGGTCAAGTTCTAGAC0.013400.001500.474100.500000.967400.62500


Target Position: 1551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1551GCACUGGUGUUUUGUUGUG72.2485810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861569GCACTGGTGTTTTGTTGTGCACAACAAAACACCAGTGC0.025800.001500.560300.750001.000001.00000


Target Position: 2129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2129UUCUUUUUUCUUUUUUUUU59.91081718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4842147TTCTTTTTTCTTTTTTTTTAAAAAAAAAGAAAAAAGAA0.936300.670400.672400.500001.000001.00000


Target Position: 1385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1385CAUUCUCCACUUCUUGUUC71.2561884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4871403CATTCTCCACTTCTTGTTCGAACAAGAAGTGGAGAATG0.065400.045100.482800.500001.000001.00000


Target Position: 1761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1761AGGCCCAUAUCUGUGAAAU74.9988643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4121779AGGCCCATATCTGTGAAATATTTCACAGATATGGGCCT0.047300.020100.836200.750001.000001.00000


Target Position: 1627, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1627GGAUGUUUGGGAGAUGUAA93.941426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3251645GGATGTTTGGGAGATGTAATTACATCTCCCAAACATCC0.299700.007700.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1625-1647AGGGATGTTTGGGAGATGTAAGAUUACAUCUCCCAAACAUCCCUGGAUGUUUGGGAGAUGUAAGAU20.314.823


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949GCCCAUCCUCACCAUCAUC69.817997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
207967GCCCATCCTCACCATCATCGATGATGGTGAGGATGGGC0.470600.031900.819000.750001.000001.00000


Target Position: 1502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1502CAGGACUUCCAUUUGCUUU77.7444483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3311520CAGGACTTCCATTTGCTTTAAAGCAAATGGAAGTCCTG0.739600.007500.784500.750000.978300.75000


Target Position: 1556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556GGUGUUUUGUUGUGGGGAG72.2723807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221574GGTGTTTTGTTGTGGGGAGCTCCCCACAACAAAACACC0.045000.003100.543100.750001.000001.00000


Target Position: 469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
469CUCCUGGCCCCUGUCAUCU62.93731508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480487CTCCTGGCCCCTGTCATCTAGATGACAGGGGCCAGGAG0.093600.001500.586200.500001.000001.00000


Target Position: 525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
525GUUUCCGUCUGGGCUUCUU70.5544939

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479543GTTTCCGTCTGGGCTTCTTAAGAAGCCCAGACGGAAAC0.027300.001600.508600.750000.962001.00000


Target Position: 1332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1332CCUCCCGCCAUAAAAAACU64.95051371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2131350CCTCCCGCCATAAAAAACTAGTTTTTTATGGCGGGAGG0.395900.226300.637900.750001.000001.00000


Target Position: 1731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1731UCCCUCACUGUUGAAUUUU58.65361803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901749TCCCTCACTGTTGAATTTTAAAATTCAACAGTGAGGGA0.142700.004100.870700.750001.000001.00000


Target Position: 1918, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1918UCGGUGGGUUGGUAGUUUC59.29561761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961936TCGGTGGGTTGGTAGTTTCGAAACTACCAACCCACCGA0.078400.004300.620700.500001.000001.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044ACCGGCGCACAGAGGAAGA67.73271155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4841062ACCGGCGCACAGAGGAAGATCTTCCTCTGTGCGCCGGT0.144400.001500.629300.500001.000001.00000


Target Position: 280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
280UCCUGAAAACAACGUUCUG61.45611617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
387298TCCTGAAAACAACGTTCTGCAGAACGTTGTTTTCAGGA0.344400.078800.586200.500001.000001.00000


Target Position: 1678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1678AUCAGCCACAUUCUAGGUA72.5749781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4201696ATCAGCCACATTCTAGGTATACCTAGAATGTGGCTGAT0.074700.002700.500000.500000.945700.75000


Target Position: 1373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1373GACUCAGACUGACAUUCUC82.9506249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3901391GACTCAGACTGACATTCTCGAGAATGTCAGTCTGAGTC0.224700.016500.508600.500001.000001.00000


Target Position: 1671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1671GUUUACAAUCAGCCACAUU81.1248315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4001689GTTTACAATCAGCCACATTAATGTGGCTGATTGTAAAC0.058200.008200.637900.750001.000001.00000


Target Position: 818, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
818UUGGAUGACAGAAACACUU67.14731197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504836TTGGATGACAGAAACACTTAAGTGTTTCTGTCATCCAA0.023600.004300.508600.500001.000001.00000


Target Position: 1752, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1752CUAACUUCAAGGCCCAUAU76.9646520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2541770CTAACTTCAAGGCCCATATATATGGGCCTTGAAGTTAG0.167300.032900.629300.750001.000001.00000


Target Position: 144, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
144UCCACGACGGUGACACGCU64.02831427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494162TCCACGACGGTGACACGCTAGCGTGTCACCGTCGTGGA0.039200.001400.517200.500000.913000.62500


Target Position: 1612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612GGUUUUUACUGUGAGGGAU83.4772235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811630GGTTTTTACTGTGAGGGATATCCCTCACAGTAAAAACC0.067700.005600.672401.000001.000001.00000


Target Position: 2016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016GUGAACCUUAGUACCUAAA83.3084241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2732034GTGAACCTTAGTACCTAAATTTAGGTACTAAGGTTCAC0.132500.024100.793100.750001.000001.00000


Target Position: 1333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1333CUCCCGCCAUAAAAAACUC64.09171424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4261351CTCCCGCCATAAAAAACTCGAGTTTTTTATGGCGGGAG0.352700.207600.500000.500001.000001.00000


Target Position: 1760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1760AAGGCCCAUAUCUGUGAAA78.5019444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111778AAGGCCCATATCTGTGAAATTTCACAGATATGGGCCTT0.053500.008900.637900.500001.000001.00000


Target Position: 217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
217GUCAGAUCCUAGCGUCGAG75.7091595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
456235GTCAGATCCTAGCGTCGAGCTCGACGCTAGGATCTGAC0.029900.006800.508600.500001.000001.00000


Target Position: 2492, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2492ACCCCACCCUUCCCCUCCU57.45251879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4262510ACCCCACCCTTCCCCTCCTAGGAGGGGAAGGGTGGGGT0.997100.994900.508600.500001.000001.00000


Target Position: 341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
341CCGGACGAUAUUGAACAAU70.0855983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
267359CCGGACGATATTGAACAATATTGTTCAATATCGTCCGG0.147900.016000.905201.000001.000001.00000


Target Position: 2127, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2127AUUUCUUUUUUCUUUUUUU72.9466768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3922145ATTTCTTTTTTCTTTTTTTAAAAAAAGAAAAAAGAAAT0.898500.637700.508600.500001.000001.00000


Target Position: 948, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
948GGCCCAUCCUCACCAUCAU85.2701179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
242966GGCCCATCCTCACCATCATATGATGGTGAGGATGGGCC0.481800.021400.844801.000000.923900.62500


Target Position: 2134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2134UUUUCUUUUUUUUUUUUUU62.29731550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4362152TTTTCTTTTTTTTTTTTTTAAAAAAAAAAAAAAGAAAA0.983700.884600.500000.500001.000001.00000


Target Position: 2499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2499CCUUCCCCUCCUUCUCCCU63.38251474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4552517CCTTCCCCTCCTTCTCCCTAGGGAGAAGGAGGGGAAGG0.956600.955500.500000.750001.000001.00000


Target Position: 1740, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1740GUUGAAUUUUCUCUAACUU83.7459228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4021758GTTGAATTTTCTCTAACTTAAGTTAGAGAAAATTCAAC0.169800.062100.508600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1738-1760CTGTTGAATTTTCTCTAACTTCAAAGUUAGAGAAAAUUCAACAGGUUGAAUUUUCUCUAACUUCAU18.97.412


Target Position: 1590, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590GACAUACCAGCUUAGAUUU85.6754163

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2159019GACATACCAGCTTAGATTT1/1/0/097.75TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANA17:7572703..7572721(-)00TP53(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4171608GACATACCAGCTTAGATTTAAATCTAAGCTGGTATGTC0.064100.002900.819000.750000.994600.75000


Target Position: 56, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
56AGCUUCUCAAAAGUCUAGA71.6964847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
40474AGCTTCTCAAAAGTCTAGATCTAGACTTTTGAGAAGCT0.178600.117200.629300.500001.000001.00000


Target Position: 893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
893ACCAUCCACUACAACUACA81.493299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
381911ACCATCCACTACAACTACATGTAGTTGTAGTGGATGGT0.389500.320300.646600.500001.000001.00000


Target Position: 588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
588CCCUCAACAAGAUGUUUUG70.8146927

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425606CCCTCAACAAGATGTTTTGCAAAACATCTTGTTGAGGG0.043700.041900.844800.750000.994600.62500


Target Position: 1742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1742UGAAUUUUCUCUAACUUCA82.8651252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231760TGAATTTTCTCTAACTTCATGAAGTTAGAGAAAATTCA0.097200.054500.500000.500001.000001.00000


Target Position: 1816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1816AGGGUUAAUGAAAUAAUGU76.4385555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4701834AGGGTTAATGAAATAATGTACATTATTTCATTAACCCT0.264900.057000.637900.500001.000001.00000


Target Position: 1383, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1383GACAUUCUCCACUUCUUGU82.2869277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3871401GACATTCTCCACTTCTTGTACAAGAAGTGGAGAATGTC0.063700.036200.612100.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1381-1403CTGACATTCTCCACTTCTTGTTCACAAGAAGUGGAGAAUGUCAGGACAUUCUCCACUUCUUGUUCU16.619.222


Target Position: 995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
995CUGGGACGGAACAGCUUUG65.3791339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4591013CTGGGACGGAACAGCTTTGCAAAGCTGTTCCGTCCCAG0.081800.005800.637900.500001.000001.00000


Target Position: 2044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2044CACCCCAUCCCACACCCUG61.21751632

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882062CACCCCATCCCACACCCTGCAGGGTGTGGGATGGGGTG0.040000.014900.508600.500001.000001.00000


Target Position: 1381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1381CUGACAUUCUCCACUUCUU84.741195

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3451399CTGACATTCTCCACTTCTTAAGAAGTGGAGAATGTCAG0.085400.031100.646600.750001.000001.00000


Target Position: 2512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2512CUCCCUUUUUAUAUCCCAU80.6353338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1862530CTCCCTTTTTATATCCCATATGGGATATAAAAAGGGAG0.766500.758900.655200.750001.000001.00000


Target Position: 1312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1312GUCCAAAAAGGGUCAGUCU78.452448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4901330GTCCAAAAAGGGTCAGTCTAGACTGACCCTTTTTGGAC0.049400.001400.594800.500000.934800.75000


Target Position: 1300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1300CAGCCACCUGAAGUCCAAA88.565103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2551318CAGCCACCTGAAGTCCAAATTTGGACTTCAGGTGGCTG0.276400.018400.784500.750000.951100.62500


Target Position: 996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
996UGGGACGGAACAGCUUUGA60.43911687

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3351014TGGGACGGAACAGCTTTGATCAAAGCTGTTCCGTCCCA0.090000.015500.620700.500001.000001.00000


Target Position: 274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
274ACUACUUCCUGAAAACAAC70.1833973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
347292ACTACTTCCTGAAAACAACGTTGTTTTCAGGAAGTAGT0.316900.068500.560300.500001.000001.00000


Target Position: 470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470UCCUGGCCCCUGUCAUCUU66.35921260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
497488TCCTGGCCCCTGTCATCTTAAGATGACAGGGGCCAGGA0.077400.001300.732800.750001.000001.00000


Target Position: 1331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1331ACCUCCCGCCAUAAAAAAC57.38191889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3391349ACCTCCCGCCATAAAAAACGTTTTTTATGGCGGGAGGT0.595400.247600.706900.500000.989100.62500


Target Position: 107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
107UCCGGGGACACUUUGCGUU59.12611777

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
507125TCCGGGGACACTTTGCGTTAACGCAAAGTGTCCCCGGA0.049400.001100.724100.750000.951100.62500


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684CCAUCUACAAGCAGUCACA92.029557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
377702CCATCTACAAGCAGTCACATGTGACTGCTTGTAGATGG0.071100.069200.637900.750001.000001.00000


Target Position: 1917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1917GUCGGUGGGUUGGUAGUUU74.7247661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3951935GTCGGTGGGTTGGTAGTTTAAACTACCAACCCACCGAC0.111400.003700.819000.750001.000001.00000


Target Position: 1808, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1808GCAUUGUGAGGGUUAAUGA91.571762

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1806-1828GTGCATTGTGAGGGTTAATGAAAUCAUUAACCCUCACAAUGCACGCAUUGUGAGGGUUAAUGAAAU6.918.122


Target Position: 1555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1555UGGUGUUUUGUUGUGGGGA66.16691280

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4951573TGGTGTTTTGTTGTGGGGATCCCCACAACAAAACACCA0.046700.002300.474100.500001.000001.00000


Target Position: 524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
524GGUUUCCGUCUGGGCUUCU68.80831080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
505542GGTTTCCGTCTGGGCTTCTAGAAGCCCAGACGGAAACC0.014000.001300.629300.750000.962001.00000


Target Position: 2451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2451GGUCAACAUCUUUUACAUU91.932459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942469GGTCAACATCTTTTACATTAATGTAAAAGATGTTGACC0.636400.184200.844801.000001.000001.00000


Target Position: 2331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2331AGAUGGGGUCUCACAGUGU79.2331409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3832349AGATGGGGTCTCACAGTGTACACTGTGAGACCCCATCT0.189000.010700.517200.500001.000001.00000


Target Position: 261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
261CAGACCUAUGGAAACUACU79.3689401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
372279CAGACCTATGGAAACTACTAGTAGTTTCCATAGGTCTG0.072900.026300.577600.500001.000001.00000


Target Position: 1599, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1599GCUUAGAUUUUAAGGUUUU82.9162250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2321617GCTTAGATTTTAAGGTTTTAAAACCTTAAAATCTAAGC0.172600.025600.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1597-1619CAGCTTAGATTTTAAGGTTTTTAAAAACCUUAAAAUCUAAGCUGGCUUAGAUUUUAAGGUUUUUAU17.311.622


Target Position: 1661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1661UUAAGGGUUAGUUUACAAU70.9752912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911679TTAAGGGTTAGTTTACAATATTGTAAACTAACCCTTAA0.423100.062400.525900.500001.000001.00000


Target Position: 879, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
879GCUCUGACUGUACCACCAU83.4297237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
441897GCTCTGACTGTACCACCATATGGTGGTACAGTCAGAGC0.078600.002400.698301.000001.000001.00000


Target Position: 1036, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1036UGGGAGAGACCGGCGCACA70.3478953

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3741054TGGGAGAGACCGGCGCACATGTGCGCCGGTCTCTCCCA0.112200.010200.637900.500000.978300.75000


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563UGUUGUGGGGAGGAGGAUG58.17231835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4331581TGTTGTGGGGAGGAGGATGCATCCTCCTCCCCACAACA0.254900.005700.551700.500001.000001.00000


Target Position: 1340, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1340CAUAAAAAACUCAUGUUCA94.181923

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1338-1360GCCATAAAAAACTCATGTTCAAGUGAACAUGAGUUUUUUAUGGCCAUAAAAAACUCAUGUUCAAGU20.5-9.722


Target Position: 2527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2527CCAUUUUUAUAUCGAUCUC72.0329819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3582545CCATTTTTATATCGATCTCGAGATCGATATAAAAATGG0.700300.552300.534500.750001.000001.00000


Target Position: 1758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1758UCAAGGCCCAUAUCUGUGA69.37571033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4221776TCAAGGCCCATATCTGTGATCACAGATATGGGCCTTGA0.091200.005500.500000.500001.000001.00000


Target Position: 108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
108CCGGGGACACUUUGCGUUC60.921656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
504126CCGGGGACACTTTGCGTTCGAACGCAAAGTGTCCCCGG0.037800.001200.741400.750000.951100.75000


Target Position: 905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905AACUACAUGUGUAACAGUU81.1169317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
483923AACTACATGTGTAACAGTTAACTGTTACACATGTAGTT0.104700.011600.500000.500000.994600.75000


Target Position: 1596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596CCAGCUUAGAUUUUAAGGU73.4368733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611614CCAGCTTAGATTTTAAGGTACCTTAAAATCTAAGCTGG0.166300.006000.491400.750001.000001.00000


Target Position: 536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
536GGCUUCUUGCAUUCUGGGA77.8532478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479554GGCTTCTTGCATTCTGGGATCCCAGAATGCAAGAAGCC0.020800.003500.629300.750001.000001.00000


Target Position: 1762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1762GGCCCAUAUCUGUGAAAUG79.9691376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4421780GGCCCATATCTGTGAAATGCATTTCACAGATATGGGCC0.035200.015600.844800.750001.000001.00000


Target Position: 1577, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1577GGAUGGGGAGUAGGACAUA92.043656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2461595GGATGGGGAGTAGGACATATATGTCCTACTCCCCATCC0.152900.026200.827601.000001.000001.00000


Target Position: 1734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1734CUCACUGUUGAAUUUUCUC66.81061227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4241752CTCACTGTTGAATTTTCTCGAGAAAATTCAACAGTGAG0.264700.097300.500000.500001.000001.00000


Target Position: 682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682GGCCAUCUACAAGCAGUCA85.8897155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
342700GGCCATCTACAAGCAGTCATGACTGCTTGTAGATGGCC0.086900.067400.775900.750000.934800.62500


Target Position: 2097, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2097CCACCAAGACUUGUUUUAU83.8526226

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2502115CCACCAAGACTTGTTTTATATAAAACAAGTCTTGGTGG0.149000.046800.801701.000001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586UGCCCUCAACAAGAUGUUU68.00761133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
338604TGCCCTCAACAAGATGTTTAAACATCTTGTTGAGGGCA0.088300.014600.853400.750000.989100.75000


Target Position: 2023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2023UUAGUACCUAAAAGGAAAU67.84031146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4312041TTAGTACCTAAAAGGAAATATTTCCTTTTAGGTACTAA0.040100.016400.525900.500000.989101.00000


Target Position: 676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676CGCCAUGGCCAUCUACAAG73.096753

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
274694CGCCATGGCCATCTACAAGCTTGTAGATGGCCATGGCG0.328600.028700.784500.750000.978300.75000


Target Position: 2028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2028ACCUAAAAGGAAAUCUCAC67.10061202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4412046ACCTAAAAGGAAATCTCACGTGAGATTTCCTTTTAGGT0.367900.023800.560300.500000.989100.62500


Target Position: 1122, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1122CACUGCCCAACAACACCAG66.52681247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4161140CACTGCCCAACAACACCAGCTGGTGTTGTTGGGCAGTG0.189100.056600.508600.500000.913000.62500


Target Position: 814, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
814GUAUUUGGAUGACAGAAAC75.7396593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
473832GTATTTGGATGACAGAAACGTTTCTGTCATCCAAATAC0.033100.005000.534500.500001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787CCGAGUGGAAGGAAAUUUG69.131050

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327805CCGAGTGGAAGGAAATTTGCAAATTTCCTTCCACTCGG0.110600.007600.767200.750001.000001.00000


Target Position: 371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
371GACCCAGGUCCAGAUGAAG73.1931746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
400389GACCCAGGTCCAGATGAAGCTTCATCTGGACCTGGGTC0.122400.005900.681000.500001.000001.00000


Target Position: 2303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2303GGCCAGCCAACUUUUGCAU75.5154609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3662321GGCCAGCCAACTTTTGCATATGCAAAAGTTGGCTGGCC0.114800.005200.844801.000000.972800.75000


Target Position: 1920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1920GGUGGGUUGGUAGUUUCUA86.7267127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3801938GGTGGGTTGGTAGTTTCTATAGAAACTACCAACCCACC0.110800.004600.681001.000001.000001.00000


Target Position: 1550, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1550UGCACUGGUGUUUUGUUGU65.51911330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031568TGCACTGGTGTTTTGTTGTACAACAAAACACCAGTGCA0.020600.001200.646600.500001.000001.00000


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806CGUGUGGAGUAUUUGGAUG75.3587621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
412824CGTGTGGAGTATTTGGATGCATCCAAATACTCCACACG0.081900.003000.620700.750001.000001.00000


Target Position: 1562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1562UUGUUGUGGGGAGGAGGAU57.64361865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5031580TTGTTGTGGGGAGGAGGATATCCTCCTCCCCACAACAA0.270900.005200.465500.500001.000001.00000


Target Position: 1575, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1575GAGGAUGGGGAGUAGGACA88.7107100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3291593GAGGATGGGGAGTAGGACATGTCCTACTCCCCATCCTC0.149400.034600.603400.500001.000001.00000


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810UGGAGUAUUUGGAUGACAG74.0925689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
408828TGGAGTATTTGGATGACAGCTGTCATCCAAATACTCCA0.084700.021700.560300.500001.000001.00000


Target Position: 2025, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2025AGUACCUAAAAGGAAAUCU69.47891027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4822043AGTACCTAAAAGGAAATCTAGATTTCCTTTTAGGTACT0.038900.015200.482800.500000.989101.00000


Target Position: 1574, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1574GGAGGAUGGGGAGUAGGAC71.744840

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3351592GGAGGATGGGGAGTAGGACGTCCTACTCCCCATCCTCC0.145600.045200.551700.750001.000001.00000


Target Position: 1626, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1626GGGAUGUUUGGGAGAUGUA92.444945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3141644GGGATGTTTGGGAGATGTATACATCTCCCAAACATCCC0.294700.009100.810301.000001.000001.00000


Target Position: 428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
428GCACCAGCAGCUCCUACAC71.5092858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
331446GCACCAGCAGCTCCTACACGTGTAGGAGCTGCTGGTGC0.162300.033200.560300.750000.923900.75000


Target Position: 57, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
57GCUUCUCAAAAGUCUAGAG78.4391450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
34775GCTTCTCAAAAGTCTAGAGCTCTAGACTTTTGAGAAGC0.105300.045300.543100.750000.929300.62500


Target Position: 671, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
671GUCCGCGCCAUGGCCAUCU57.18461901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
480689GTCCGCGCCATGGCCATCTAGATGGCCATGGCGCGGAC0.073100.002900.594800.500000.962001.00000


Target Position: 192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
192GGGUCACUGCCAUGGAGGA86.3179138

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
409210GGGTCACTGCCATGGAGGATCCTCCATGGCAGTGACCC0.049500.005900.620700.750000.983701.00000


Target Position: 1611, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1611AGGUUUUUACUGUGAGGGA79.8919378

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4971629AGGTTTTTACTGTGAGGGATCCCTCACAGTAAAAACCT0.061600.004900.474100.500001.000001.00000


Target Position: 2514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514CCCUUUUUAUAUCCCAUUU76.7302538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
312532CCCTTTTTATATCCCATTTAAATGGGATATAAAAAGGG0.869300.699700.991401.000001.000001.00000


Target Position: 2142, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2142UUUUUUUUUUUUUUUCUUU61.11211639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4442160TTTTTTTTTTTTTTTCTTTAAAGAAAAAAAAAAAAAAA0.682200.699600.500000.500001.000001.00000


Target Position: 17, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
17UCCCCUCCCAUGUGCUCAA70.2602965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
43335TCCCCTCCCATGTGCTCAATTGAGCACATGGGAGGGGA0.182000.002500.724100.750001.000001.00000


Target Position: 251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251GAAACAUUUUCAGACCUAU90.173783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402269GAAACATTTTCAGACCTATATAGGTCTGAAAATGTTTC0.066200.003400.629300.750001.000001.00000


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871UCUAGAACUUGACCCCCUU71.2532885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4921889TCTAGAACTTGACCCCCTTAAGGGGGTCAAGTTCTAGA0.017600.001600.586200.750000.983700.62500


Target Position: 2143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2143UUUUUUUUUUUUUUCUUUU60.60111676

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4272161TTTTTTTTTTTTTTCTTTTAAAAGAAAAAAAAAAAAAA0.665600.689600.500000.500001.000001.00000


Target Position: 1404, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1404CCCACUGACAGCCUCCCAC62.28771552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1611422CCCACTGACAGCCTCCCACGTGGGAGGCTGTCAGTGGG0.883200.387700.698300.750001.000001.00000


Target Position: 960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
960CCAUCAUCACACUGGAAGA92.154951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
426978CCATCATCACACTGGAAGATCTTCCAGTGTGATGATGG0.043600.027900.620700.750000.983700.62500


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382UGACAUUCUCCACUUCUUG66.87071221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5021400TGACATTCTCCACTTCTTGCAAGAAGTGGAGAATGTCA0.062000.034200.577600.500001.000001.00000


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469CCUUGCUUGCAAUAGGUGU71.3777870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4691487CCTTGCTTGCAATAGGTGTACACCTATTGCAAGCAAGG0.024700.002200.637900.750001.000001.00000


Target Position: 800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
800AAUUUGCGUGUGGAGUAUU72.4466792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
494818AATTTGCGTGTGGAGTATTAATACTCCACACGCAAATT0.040700.001900.500000.500001.000001.00000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825ACAGAAACACUUUUCGACA84.0127223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474843ACAGAAACACTTTTCGACATGTCGAAAAGTGTTTCTGT0.496900.001600.500000.500000.983700.87500


Target Position: 466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
466CCCCUCCUGGCCCCUGUCA61.80821587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
464484CCCCTCCTGGCCCCTGTCATGACAGGGGCCAGGAGGGG0.075700.001800.767200.750000.967400.75000


Target Position: 475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
475GCCCCUGUCAUCUUCUGUC68.73161085

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
299493GCCCCTGTCATCTTCTGTCGACAGAAGATGACAGGGGC0.125000.011300.681000.750001.000001.00000


Target Position: 1503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1503AGGACUUCCAUUUGCUUUG61.15631636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4811521AGGACTTCCATTTGCTTTGCAAAGCAAATGGAAGTCCT0.020400.005200.698300.500000.978300.75000


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828GAAACACUUUUCGACAUAG80.5844340

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
447846GAAACACTTTTCGACATAGCTATGTCGAAAAGTGTTTC0.039200.002600.500000.500001.000001.00000


Target Position: 678, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
678CCAUGGCCAUCUACAAGCA89.030297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476696CCATGGCCATCTACAAGCATGCTTGTAGATGGCCATGG0.294500.030300.491400.750000.934800.62500


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811GGAGUAUUUGGAUGACAGA94.021624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
341829GGAGTATTTGGATGACAGATCTGTCATCCAAATACTCC0.086900.019100.646600.750001.000001.00000


Target Position: 2302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2302UGGCCAGCCAACUUUUGCA75.3477624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4662320TGGCCAGCCAACTTTTGCATGCAAAAGTTGGCTGGCCA0.079100.003700.491400.500000.967400.62500


Target Position: 529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
529CCGUCUGGGCUUCUUGCAU75.1194637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
332547CCGTCTGGGCTTCTTGCATATGCAAGAAGCCCAGACGG0.176300.007300.758601.000001.000001.00000


Target Position: 1701, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1701CCCACUUCACCGUACUAAC71.2437888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2431719CCCACTTCACCGTACTAACGTTAGTACGGTGAAGTGGG0.728800.021100.844800.750000.978300.75000


Target Position: 1733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1733CCUCACUGUUGAAUUUUCU78.613438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2731751CCTCACTGTTGAATTTTCTAGAAAATTCAACAGTGAGG0.242900.107300.620700.750001.000001.00000


Target Position: 2530, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2530UUUUUAUAUCGAUCUCUUA83.5076234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5062548TTTTTATATCGATCTCTTATAAGAGATCGATATAAAAA0.597800.444800.465500.500001.000001.00000


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506CUCCUUCUCCCUUUUUAUA84.2467213

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1632524CTCCTTCTCCCTTTTTATATATAAAAAGGGAGAAGGAG0.811400.808400.767200.750001.000001.00000


Target Position: 2021, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2021CCUUAGUACCUAAAAGGAA91.67460

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2019-2041AACCTTAGTACCTAAAAGGAAATUUCCUUUUAGGUACUAAGGUUCCUUAGUACCUAAAAGGAAAUU18.711.333


Target Position: 1925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1925GUUGGUAGUUUCUACAGUU90.652674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4191943GTTGGTAGTTTCTACAGTTAACTGTAGAAACTACCAAC0.071400.006200.500000.750000.945701.00000


Target Position: 2137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2137UCUUUUUUUUUUUUUUUUU63.34461476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1772155TCTTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAAGA0.925500.872700.724100.750001.000001.00000


Target Position: 1997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1997CCUGUCUGACAACCUCUUG66.92411216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4992015CCTGTCTGACAACCTCTTGCAAGAGGTTGTCAGACAGG0.015200.005600.698300.750000.989100.87500


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681UGGCCAUCUACAAGCAGUC61.25451631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443699TGGCCATCTACAAGCAGTCGACTGCTTGTAGATGGCCA0.094600.041400.525900.500000.934800.75000


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378GUCCAGAUGAAGCUCCCAG68.211123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
373396GTCCAGATGAAGCTCCCAGCTGGGAGCTTCATCTGGAC0.242500.083100.534500.500000.918500.62500


Target Position: 146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
146CACGACGGUGACACGCUUC66.07561290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
427164CACGACGGTGACACGCTTCGAAGCGTGTCACCGTCGTG0.106000.002600.620700.500000.962000.87500


Target Position: 271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
271GAAACUACUUCCUGAAAAC81.6262293

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
375289GAAACTACTTCCTGAAAACGTTTTCAGGAAGTAGTTTC0.116700.036600.525900.500001.000001.00000


Target Position: 2092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2092UGGAUCCACCAAGACUUGU59.23731771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3612110TGGATCCACCAAGACTTGTACAAGTCTTGGTGGATCCA0.111500.005500.637900.500000.923900.87500


Target Position: 2547, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2547UAUUUUACAAUAAAACUUU73.5306728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4142565TATTTTACAATAAAACTTTAAAGTTTTATTGTAAAATA0.328500.304100.543100.500001.000001.00000


Target Position: 672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
672UCCGCGCCAUGGCCAUCUA70.8791918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
397690TCCGCGCCATGGCCATCTATAGATGGCCATGGCGCGGA0.138500.003600.698300.750000.962000.87500


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477CCCUGUCAUCUUCUGUCCC61.54711607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
443495CCCTGTCATCTTCTGTCCCGGGACAGAAGATGACAGGG0.103400.029000.500000.500001.000001.00000


Target Position: 812, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812GAGUAUUUGGAUGACAGAA93.715828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
320830GAGTATTTGGATGACAGAATTCTGTCATCCAAATACTC0.100200.022100.637900.750001.000001.00000


Target Position: 2128, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2128UUUCUUUUUUCUUUUUUUU62.71351517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4182146TTTCTTTTTTCTTTTTTTTAAAAAAAAGAAAAAAGAAA0.910200.646800.500000.500001.000001.00000


Target Position: 379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
379UCCAGAUGAAGCUCCCAGA73.7323717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
336397TCCAGATGAAGCTCCCAGATCTGGGAGCTTCATCTGGA0.254600.107600.646600.500000.918500.62500


Target Position: 2100, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2100CCAAGACUUGUUUUAUGCU80.3579349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4722118CCAAGACTTGTTTTATGCTAGCATAAAACAAGTCTTGG0.466700.039600.491400.750001.000001.00000


Target Position: 314, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
314CAAGCAAUGGAUGAUUUGA86.1775144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
312-334CCCAAGCAATGGATGATTTGATGUCAAAUCAUCCAUUGCUUGGGCAAGCAAUGGAUGAUUUGAUGU13.818.522


Target Position: 342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
342CGGACGAUAUUGAACAAUG80.7846332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482360CGGACGATATTGAACAATGCATTGTTCAATATCGTCCG0.021400.001500.758600.750001.000001.00000


Target Position: 1613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1613GUUUUUACUGUGAGGGAUG68.65041095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4621631GTTTTTACTGTGAGGGATGCATCCCTCACAGTAAAAAC0.077700.005200.491400.500001.000001.00000


Target Position: 455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
455CCUGCACCAGCCCCCUCCU63.95681435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457473CCTGCACCAGCCCCCTCCTAGGAGGGGGCTGGTGCAGG0.312000.115700.500000.750000.929300.87500


Target Position: 111, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
111GGGACACUUUGCGUUCGGG64.97481370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
467129GGGACACTTTGCGTTCGGGCCCGAACGCAAAGTGTCCC0.025700.006700.500000.500000.951100.87500


Target Position: 1588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1588AGGACAUACCAGCUUAGAU87.0745123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4401606AGGACATACCAGCTTAGATATCTAAGCTGGTATGTCCT0.057800.002500.663800.750000.978300.75000


Target Position: 2565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2565UGCUGCCACCUGUGUGUCU68.12011128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4692583TGCTGCCACCTGTGTGTCTAGACACACAGGTGGCAGCA0.348600.046600.629300.500000.907600.87500


Target Position: 1665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1665GGGUUAGUUUACAAUCAGC77.1794509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931683GGGTTAGTTTACAATCAGCGCTGATTGTAAACTAACCC0.017500.008800.637900.500001.000001.00000


Target Position: 2566, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2566GCUGCCACCUGUGUGUCUG67.63291161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3092584GCTGCCACCTGTGTGTCTGCAGACACACAGGTGGCAGC0.364500.035300.569000.750000.907601.00000


Target Position: 2567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2567CUGCCACCUGUGUGUCUGA84.6875197

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4052585CTGCCACCTGTGTGTCTGATCAGACACACAGGTGGCAG0.054800.026000.560300.500000.907601.00000


Target Position: 1035, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1035CUGGGAGAGACCGGCGCAC54.15492078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981053CTGGGAGAGACCGGCGCACGTGCGCCGGTCTCTCCCAG0.069000.001500.491400.500000.978300.75000


Target Position: 2022, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2022CUUAGUACCUAAAAGGAAA92.140552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4432040CTTAGTACCTAAAAGGAAATTTCCTTTTAGGTACTAAG0.035000.014800.637900.750000.989100.87500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2020-2042ACCTTAGTACCTAAAAGGAAATCUUUCCUUUUAGGUACUAAGGUCUUAGUACCUAAAAGGAAAUCU18.714.332


Target Position: 2069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2069UUCAUCUCUUGUAUAUGAU71.7908836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4952087TTCATCTCTTGTATATGATATCATATACAAGAGATGAA0.017100.006800.491400.500001.000001.00000


Target Position: 1655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1655UUGCAGUUAAGGGUUAGUU61.51441612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211673TTGCAGTTAAGGGTTAGTTAACTAACCCTTAACTGCAA0.128700.004500.500000.500001.000001.00000


Target Position: 796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
796AGGAAAUUUGCGUGUGGAG66.64231236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
499814AGGAAATTTGCGTGTGGAGCTCCACACGCAAATTTCCT0.077400.052000.534500.500001.000001.00000


Target Position: 1330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1330UACCUCCCGCCAUAAAAAA70.9874911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2831348TACCTCCCGCCATAAAAAATTTTTTATGGCGGGAGGTA0.778400.262000.681000.500001.000001.00000


Target Position: 1568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1568UGGGGAGGAGGAUGGGGAG55.06582025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3531586TGGGGAGGAGGATGGGGAGCTCCCCATCCTCCTCCCCA0.144400.061500.534500.500001.000001.00000


Target Position: 786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
786UCCGAGUGGAAGGAAAUUU61.05191645

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
378804TCCGAGTGGAAGGAAATTTAAATTTCCTTCCACTCGGA0.096200.004700.870700.750000.929300.62500


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819UGGAUGACAGAAACACUUU75.2939628

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457837TGGATGACAGAAACACTTTAAAGTGTTTCTGTCATCCA0.028800.002600.844800.750001.000001.00000


Target Position: 820, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820GGAUGACAGAAACACUUUU89.424392

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_482019GGATGACAGAAACACTTTT1/1/0/094.96TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANA17:7578213..7578231(-)00TP53(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
475838GGATGACAGAAACACTTTTAAAAGTGTTTCTGTCATCC0.021400.002500.870701.000001.000001.00000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951CCAUCCUCACCAUCAUCAC71.4867862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
333969CCATCCTCACCATCATCACGTGATGATGGTGAGGATGG0.214000.028200.551700.750001.000001.00000


Target Position: 109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
109CGGGGACACUUUGCGUUCG62.02351570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487127CGGGGACACTTTGCGTTCGCGAACGCAAAGTGTCCCCG0.021000.001500.620700.500000.951100.87500


Target Position: 2545, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2545CUUAUUUUACAAUAAAACU78.5335442

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2543-2565CTCTTATTTTACAATAAAACTTTAGUUUUAUUGUAAAAUAAGAGCUUAUUUUACAAUAAAACUUUU-0.3-9.721


Target Position: 113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
113GACACUUUGCGUUCGGGCU72.3589802

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
502131GACACTTTGCGTTCGGGCTAGCCCGAACGCAAAGTGTC0.046100.005100.465500.500000.951100.62500


Target Position: 1207, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1207UGAGCGCUUCGAGAUGUUC59.47671747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4581225TGAGCGCTTCGAGATGTTCGAACATCTCGAAGCGCTCA0.068800.001900.551700.500001.000001.00000


Target Position: 2500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2500CUUCCCCUCCUUCUCCCUU63.76191449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4412518CTTCCCCTCCTTCTCCCTTAAGGGAGAAGGAGGGGAAG0.945900.944900.500000.750001.000001.00000


Target Position: 2136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2136UUCUUUUUUUUUUUUUUUU59.27691765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5002154TTCTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAGAA0.939900.864300.672400.500001.000001.00000


Target Position: 1699, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1699GGCCCACUUCACCGUACUA92.219748

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3621717GGCCCACTTCACCGTACTATAGTACGGTGAAGTGGGCC0.076800.011000.827601.000000.934800.62500


Target Position: 888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
888GUACCACCAUCCACUACAA98.21555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364906GTACCACCATCCACTACAATTGTAGTGGATGGTGGTAC0.506800.010600.534500.750001.000001.00000


Target Position: 2112, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2112UUAUGCUCAGGGUCAAUUU68.40431109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4792130TTATGCTCAGGGTCAATTTAAATTGACCCTGAGCATAA0.180300.030700.534500.500001.000001.00000


Target Position: 262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
262AGACCUAUGGAAACUACUU82.5536264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
355280AGACCTATGGAAACTACTTAAGTAGTTTCCATAGGTCT0.080200.029500.586200.750001.000001.00000


Target Position: 585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
585CUGCCCUCAACAAGAUGUU70.0756985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
329603CTGCCCTCAACAAGATGTTAACATCTTGTTGAGGGCAG0.094400.013900.637900.750000.989100.87500


Target Position: 1314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1314CCAAAAAGGGUCAGUCUAC72.4144794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4661332CCAAAAAGGGTCAGTCTACGTAGACTGACCCTTTTTGG0.252700.001800.663800.750001.000001.00000


Target Position: 2515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2515CCUUUUUAUAUCCCAUUUU75.6108600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482533CCTTTTTATATCCCATTTTAAAATGGGATATAAAAAGG0.871000.689600.844801.000001.000001.00000


Target Position: 1915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1915UGGUCGGUGGGUUGGUAGU61.79161592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711933TGGTCGGTGGGTTGGTAGTACTACCAACCCACCGACCA0.342500.001800.637900.500001.000001.00000


Target Position: 1463, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1463UUGAACCCUUGCUUGCAAU64.25611412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4491481TTGAACCCTTGCTTGCAATATTGCAAGCAAGGGTTCAA0.166100.014900.637900.500001.000001.00000


Target Position: 468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
468CCUCCUGGCCCCUGUCAUC64.9461372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425486CCTCCTGGCCCCTGTCATCGATGACAGGGGCCAGGAGG0.095200.002700.663800.750001.000001.00000


Target Position: 2079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079GUAUAUGAUGAUCUGGAUC74.2572678

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5012097GTATATGATGATCTGGATCGATCCAGATCATCATATAC0.020900.001200.500000.500001.000001.00000


Target Position: 1301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1301AGCCACCUGAAGUCCAAAA78.2602460

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2311319AGCCACCTGAAGTCCAAAATTTTGGACTTCAGGTGGCT0.276300.024800.853400.750001.000001.00000


Target Position: 1759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1759CAAGGCCCAUAUCUGUGAA89.874489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4931777CAAGGCCCATATCTGTGAATTCACAGATATGGGCCTTG0.088500.008700.474100.750001.000001.00000


Target Position: 2052, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2052CCCACACCCUGGAGGAUUU76.4847552

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7205219CCCACACCCTGGAGGATTT1/1/0/093.44TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANA17:7572241..7572259(-)00TP53(0.002)


Target Position: 1670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1670AGUUUACAAUCAGCCACAU80.5059344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3981688AGTTTACAATCAGCCACATATGTGGCTGATTGTAAACT0.058500.007900.551700.750001.000001.00000


Target Position: 2309, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2309CCAACUUUUGCAUGUUUUG66.83841225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4832327CCAACTTTTGCATGTTTTGCAAAACATGCAAAAGTTGG0.019800.014400.698300.750001.000001.00000


Target Position: 1121, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1121GCACUGCCCAACAACACCA84.9262189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3911139GCACTGCCCAACAACACCATGGTGTTGTTGGGCAGTGC0.686900.414800.508600.750000.913000.62500


Target Position: 2505, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505CCUCCUUCUCCCUUUUUAU82.2707278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
702523CCTCCTTCTCCCTTTTTATATAAAAAGGGAGAAGGAGG0.835200.831800.801701.000001.000001.00000


Target Position: 1728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1728CUGUCCCUCACUGUUGAAU70.0676986

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211746CTGTCCCTCACTGTTGAATATTCAACAGTGAGGGACAG0.160300.002700.775900.750001.000001.00000


Target Position: 340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
340CCCGGACGAUAUUGAACAA92.071154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
358358CCCGGACGATATTGAACAATTGTTCAATATCGTCCGGG0.154200.005600.844801.000001.000001.00000


Target Position: 1326, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1326AGUCUACCUCCCGCCAUAA82.9884247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1611344AGTCTACCTCCCGCCATAATTATGGCGGGAGGTAGACT0.500300.297000.672400.750001.000001.00000


Target Position: 2135, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2135UUUCUUUUUUUUUUUUUUU59.73421732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4152153TTTCTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAGAAA0.981700.887300.500000.500001.000001.00000


Target Position: 2446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2446GGAAGGGUCAACAUCUUUU85.8893157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3222464GGAAGGGTCAACATCTTTTAAAAGATGTTGACCCTTCC0.317000.007900.870701.000001.000001.00000


Target Position: 2540, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2540GAUCUCUUAUUUUACAAUA96.470812

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2152558GATCTCTTATTTTACAATATATTGTAAAATAAGAGATC0.413900.393200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2538-2560TCGATCTCTTATTTTACAATAAAUAUUGUAAAAUAAGAGAUCGAGAUCUCUUAUUUUACAAUAAAU6.919.122


Target Position: 281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
281CCUGAAAACAACGUUCUGU73.4472732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
230299CCTGAAAACAACGTTCTGTACAGAACGTTGTTTTCAGG0.327100.077000.637900.750001.000001.00000


Target Position: 479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
479CUGUCAUCUUCUGUCCCUU80.1047368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
322497CTGTCATCTTCTGTCCCTTAAGGGACAGAAGATGACAG0.097300.039100.646600.750001.000001.00000


Target Position: 1922, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1922UGGGUUGGUAGUUUCUACA77.4065497

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4471940TGGGTTGGTAGTTTCTACATGTAGAAACTACCAACCCA0.060300.002900.637900.500000.945700.62500


Target Position: 110, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
110GGGGACACUUUGCGUUCGG58.84351791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
498128GGGGACACTTTGCGTTCGGCCGAACGCAAAGTGTCCCC0.015400.005600.577600.500000.951101.00000


Target Position: 2493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2493CCCCACCCUUCCCCUCCUU59.50821746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
202511CCCCACCCTTCCCCTCCTTAAGGAGGGGAAGGGTGGGG0.995600.992800.853401.000001.000001.00000


Target Position: 670, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
670CGUCCGCGCCAUGGCCAUC59.28961762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
453688CGTCCGCGCCATGGCCATCGATGGCCATGGCGCGGACG0.066300.002100.594800.750000.962001.00000


Target Position: 2065, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2065GGAUUUCAUCUCUUGUAUA102.4012

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2572083GGATTTCATCTCTTGTATATATACAAGAGATGAAATCC0.649800.018100.827601.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2063-2085GAGGATTTCATCTCTTGTATATGUAUACAAGAGAUGAAAUCCUCGGAUUUCAUCUCUUGUAUAUGU11.616.322


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091CUGGAUCCACCAAGACUUG67.20311192

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4502109CTGGATCCACCAAGACTTGCAAGTCTTGGTGGATCCAG0.113700.002500.637900.500000.902200.62500


Target Position: 2485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2485CAUUUUCACCCCACCCUUC67.42331174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782503CATTTTCACCCCACCCTTCGAAGGGTGGGGTGAAAATG0.997100.978000.482800.500001.000001.00000


Target Position: 1059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1059AAGAGAAUCUCCGCAAGAA89.308893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5121077AAGAGAATCTCCGCAAGAATTCTTGCGGAGATTCTCTT0.080500.006800.465500.500000.929300.62500


Target Position: 1418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1418CCCACCCCCAUCUCUCCCU57.5911869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2761436CCCACCCCCATCTCTCCCTAGGGAGAGATGGGGGTGGG0.557600.372000.646600.750001.000001.00000


Target Position: 2015, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2015GGUGAACCUUAGUACCUAA105.3541

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_9201519GGTGAACCTTAGTACCTAA1/1/0/093.35TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANA17:7572278..7572296(-)00TP53(0.002)


Target Position: 1573, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1573AGGAGGAUGGGGAGUAGGA77.5949492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4991591AGGAGGATGGGGAGTAGGATCCTACTCCCCATCCTCCT0.610500.061700.474100.500001.000001.00000


Target Position: 2133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2133UUUUUCUUUUUUUUUUUUU56.59591937

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4862151TTTTTCTTTTTTTTTTTTTAAAAAAAAAAAAAGAAAAA0.986200.883000.500000.500001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591ACAUACCAGCUUAGAUUUU72.8935771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151609ACATACCAGCTTAGATTTTAAAATCTAAGCTGGTATGT0.087900.002900.706900.750000.994600.87500


Target Position: 1412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1412CAGCCUCCCACCCCCAUCU66.60611242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191430CAGCCTCCCACCCCCATCTAGATGGGGGTGGGAGGCTG0.489300.471400.560300.500000.983700.62500


Target Position: 452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
452GCCCCUGCACCAGCCCCCU56.05111972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
255470GCCCCTGCACCAGCCCCCTAGGGGGCTGGTGCAGGGGC0.147700.115200.655200.750000.929301.00000


Target Position: 1842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1842GCCUUGAAACCACCUUUUA84.7469194

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1361860GCCTTGAAACCACCTTTTATAAAAGGTGGTTTCAAGGC0.373000.107100.965501.000001.000001.00000


Target Position: 1576, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1576AGGAUGGGGAGUAGGACAU71.5188857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2581594AGGATGGGGAGTAGGACATATGTCCTACTCCCCATCCT0.145600.028000.689700.750001.000001.00000


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683GCCAUCUACAAGCAGUCAC64.87311381

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
364701GCCATCTACAAGCAGTCACGTGACTGCTTGTAGATGGC0.076800.078600.706900.750000.978300.62500


Target Position: 2495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2495CCACCCUUCCCCUCCUUCU66.98441208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2702513CCACCCTTCCCCTCCTTCTAGAAGGAGGGGAAGGGTGG0.992300.990600.620700.750001.000001.00000


Target Position: 1730, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1730GUCCCUCACUGUUGAAUUU82.3342275

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6173019GTCCCTCACTGTTGAATTT1/1/0/093.71TP53NM_001126115.1+NM_001126117.1+NM_001126112.1+NM_000546.4+NM_001126113.1+NM_001126114.1+NM_001126116.11+1+1+1+1+1+1NANANA17:7572563..7572581(-)00TP53(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4231748GTCCCTCACTGTTGAATTTAAATTCAACAGTGAGGGAC0.145500.002700.819000.750001.000001.00000


Target Position: 474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
474GGCCCCUGUCAUCUUCUGU74.0758691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
306492GGCCCCTGTCATCTTCTGTACAGAAGATGACAGGGGCC0.138800.010500.793100.750001.000001.00000


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493CCCUUCCCAGAAAACCUAC60.38591693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
302511CCCTTCCCAGAAAACCTACGTAGGTTTTCTGGGAAGGG0.131000.011000.810300.750001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623UGAGGGAUGUUUGGGAGAU70.4914943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3961641TGAGGGATGTTTGGGAGATATCTCCCAAACATCCCTCA0.060400.022700.543100.750001.000001.00000


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801AUUUGCGUGUGGAGUAUUU72.526783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
448819ATTTGCGTGTGGAGTATTTAAATACTCCACACGCAAAT0.043400.002200.508600.500001.000001.00000


Target Position: 1729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1729UGUCCCUCACUGUUGAAUU73.052758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4321747TGTCCCTCACTGTTGAATTAATTCAACAGTGAGGGACA0.151000.002600.698300.750001.000001.00000


Target Position: 1384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1384ACAUUCUCCACUUCUUGUU69.49291025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881402ACATTCTCCACTTCTTGTTAACAAGAAGTGGAGAATGT0.063400.042800.560300.750001.000001.00000


Target Position: 950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
950CCCAUCCUCACCAUCAUCA78.1311466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
271968CCCATCCTCACCATCATCATGATGATGGTGAGGATGGG0.494600.065900.767200.750001.000001.00000


Target Position: 333, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
333UGCUGUCCCCGGACGAUAU73.2521744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
476351TGCTGTCCCCGGACGATATATATCGTCCGGGGACAGCA0.021300.002200.810300.750000.918501.00000


Target Position: 1423, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1423CCCCAUCUCUCCCUCCCCU66.11671288

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1901441CCCCATCTCTCCCTCCCCTAGGGGAGGGAGAGATGGGG0.314900.187700.646600.750001.000001.00000


Target Position: 1578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1578GAUGGGGAGUAGGACAUAC77.9858470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4961596GATGGGGAGTAGGACATACGTATGTCCTACTCCCCATC0.016600.005000.500000.500001.000001.00000


Target Position: 987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
987GUAAUCUACUGGGACGGAA84.3134208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3881005GTAATCTACTGGGACGGAATTCCGTCCCAGTAGATTAC0.134100.005300.508600.750001.000001.00000


Target Position: 2513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2513UCCCUUUUUAUAUCCCAUU62.67991518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1262531TCCCTTTTTATATCCCATTAATGGGATATAAAAAGGGA0.730400.719900.862100.750001.000001.00000


Target Position: 1000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1000ACGGAACAGCUUUGAGGUG61.52711610

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4861018ACGGAACAGCTTTGAGGTGCACCTCAAAGCTGTTCCGT0.025800.002200.482800.500001.000001.00000


Target Position: 1950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950CUGGUUAGGUAGAGGGAGU73.8549705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111968CTGGTTAGGTAGAGGGAGTACTCCCTCTACCTAACCAG0.012400.002500.577600.500001.000001.00000


Target Position: 334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
334GCUGUCCCCGGACGAUAUU68.88071074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451352GCTGTCCCCGGACGATATTAATATCGTCCGGGGACAGC0.032800.002200.844801.000000.918500.87500


Target Position: 1042, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1042AGACCGGCGCACAGAGGAA84.4497204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3371060AGACCGGCGCACAGAGGAATTCCTCTGTGCGCCGGTCT0.126500.012100.551700.750001.000001.00000


Target Position: 1477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1477GCAAUAGGUGUGCGUCAGA85.6792162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4711495GCAATAGGTGTGCGTCAGATCTGACGCACACCTATTGC0.045200.001700.629300.750001.000001.00000


Target Position: 1833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1833GUACAUCUGGCCUUGAAAC71.1972895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4911851GTACATCTGGCCTTGAAACGTTTCAAGGCCAGATGTAC0.215500.019100.534500.500001.000001.00000


Target Position: 528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
528UCCGUCUGGGCUUCUUGCA61.48231615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
452546TCCGTCTGGGCTTCTTGCATGCAAGAAGCCCAGACGGA0.110700.004700.517200.500000.962000.75000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045CCGGCGCACAGAGGAAGAG59.34521757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5111063CCGGCGCACAGAGGAAGAGCTCTTCCTCTGTGCGCCGG0.131600.001000.603400.750001.000001.00000


Target Position: 2516, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2516CUUUUUAUAUCCCAUUUUU81.0735320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2372534CTTTTTATATCCCATTTTTAAAAATGGGATATAAAAAG0.723600.681500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2514-2536CCCTTTTTATATCCCATTTTTATAAAAAUGGGAUAUAAAAAGGGCUUUUUAUAUCCCAUUUUUAUU11.3-9.722


Target Position: 2452, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2452GUCAACAUCUUUUACAUUC68.99781060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4782470GTCAACATCTTTTACATTCGAATGTAAAAGATGTTGAC0.658100.227000.646600.500001.000001.00000


Target Position: 2117, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2117CUCAGGGUCAAUUUCUUUU73.9919698

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2092135CTCAGGGTCAATTTCTTTTAAAAGAAATTGACCCTGAG0.708100.092000.810300.750001.000001.00000


Target Position: 809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
809GUGGAGUAUUUGGAUGACA85.66165

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
506827GTGGAGTATTTGGATGACATGTCATCCAAATACTCCAC0.072900.005600.586200.500001.000001.00000


Target Position: 1832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1832UGUACAUCUGGCCUUGAAA84.2714211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2621850TGTACATCTGGCCTTGAAATTTCAAGGCCAGATGTACA0.517700.016700.706900.750001.000001.00000


Target Position: 1047, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1047GGCGCACAGAGGAAGAGAA93.776127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781065GGCGCACAGAGGAAGAGAATTCTCTTCCTCTGTGCGCC0.128500.001600.827601.000001.000001.00000


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677GCCAUGGCCAUCUACAAGC58.47931811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
457695GCCATGGCCATCTACAAGCGCTTGTAGATGGCCATGGC0.301100.029500.646600.500000.934800.62500


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675GCGCCAUGGCCAUCUACAA91.11670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
216693GCGCCATGGCCATCTACAATTGTAGATGGCCATGGCGC0.706400.028700.775901.000000.978300.75000


Target Position: 674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674CGCGCCAUGGCCAUCUACA80.8077330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
287692CGCGCCATGGCCATCTACATGTAGATGGCCATGGCGCG0.511400.013000.715500.750000.962000.75000


Target Position: 2126, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2126AAUUUCUUUUUUCUUUUUU67.87761142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4442144AATTTCTTTTTTCTTTTTTAAAAAAGAAAAAAGAAATT0.896000.634000.508600.500001.000001.00000


Target Position: 2501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2501UUCCCCUCCUUCUCCCUUU57.04711908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3282519TTCCCCTCCTTCTCCCTTTAAAGGGAGAAGGAGGGGAA0.939000.938400.672400.500001.000001.00000


Target Position: 2093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2093GGAUCCACCAAGACUUGUU84.5526201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3152111GGATCCACCAAGACTTGTTAACAAGTCTTGGTGGATCC0.102600.010300.724101.000000.923900.75000


Target Position: 467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
467CCCUCCUGGCCCCUGUCAU67.35941180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
438485CCCTCCTGGCCCCTGTCATATGACAGGGGCCAGGAGGG0.082400.002500.836201.000000.967400.75000


Target Position: 2561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561ACUUUGCUGCCACCUGUGU63.38961472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4252579ACTTTGCTGCCACCTGTGTACACAGGTGGCAGCAAAGT0.130200.076500.500000.500001.000001.00000


Target Position: 1324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1324UCAGUCUACCUCCCGCCAU62.22031556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3141342TCAGTCTACCTCCCGCCATATGGCGGGAGGTAGACTGA0.493300.064400.569000.750000.902200.62500


Target Position: 2535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2535AUAUCGAUCUCUUAUUUUA93.226235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4072553ATATCGATCTCTTATTTTATAAAATAAGAGATCGATAT0.590100.479800.508600.500001.000001.00000


Target Position: 2498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2498CCCUUCCCCUCCUUCUCCC50.85872232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4612516CCCTTCCCCTCCTTCTCCCGGGAGAAGGAGGGGAAGGG0.988900.986300.500000.500001.000001.00000


Target Position: 1415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1415CCUCCCACCCCCAUCUCUC60.40651691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3571433CCTCCCACCCCCATCTCTCGAGAGATGGGGGTGGGAGG0.450700.406300.534500.750001.000001.00000


Target Position: 1570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1570GGGAGGAGGAUGGGGAGUA81.213309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2951588GGGAGGAGGATGGGGAGTATACTCCCCATCCTCCTCCC0.114200.102800.810301.000001.000001.00000


Target Position: 2534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2534UAUAUCGAUCUCUUAUUUU75.2333631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3442552TATATCGATCTCTTATTTTAAAATAAGAGATCGATATA0.597600.432700.543100.500001.000001.00000


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415GGAUUACAAUUGUGAGCCA96.92557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4882433GGATTACAATTGTGAGCCATGGCTCACAATTGTAATCC0.019100.012600.525900.750001.000001.00000


Target Position: 1414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1414GCCUCCCACCCCCAUCUCU67.28171187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2111432GCCTCCCACCCCCATCTCTAGAGATGGGGGTGGGAGGC0.498300.451500.775900.750001.000001.00000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765UGGCCCCUCCUCAGCAUCU61.00121650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482783TGGCCCCTCCTCAGCATCTAGATGCTGAGGAGGGGCCA0.044700.001700.620700.500000.923900.75000


Target Position: 250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
250GGAAACAUUUUCAGACCUA94.584622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
487268GGAAACATTTTCAGACCTATAGGTCTGAAAATGTTTCC0.019200.003400.698301.000001.000001.00000


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459GUCUUUGAACCCUUGCUUG69.0751057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4441477GTCTTTGAACCCTTGCTTGCAAGCAAGGGTTCAAAGAC0.034100.022300.672400.500001.000001.00000


Target Position: 2066, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2066GAUUUCAUCUCUUGUAUAU92.064455

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2392084GATTTCATCTCTTGTATATATATACAAGAGATGAAATC0.714000.022300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2064-2086AGGATTTCATCTCTTGTATATGAAUAUACAAGAGAUGAAAUCCUGAUUUCAUCUCUUGUAUAUGAU8.57.232


Target Position: 1624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624GAGGGAUGUUUGGGAGAUG74.6109666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3331642GAGGGATGTTTGGGAGATGCATCTCCCAAACATCCCTC0.291900.007200.655200.500001.000001.00000


Target Position: 288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
288ACAACGUUCUGUCCCCCUU70.2946963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
310306ACAACGTTCTGTCCCCCTTAAGGGGGACAGAACGTTGT0.257800.183600.569000.750001.000001.00000


Target Position: 2449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2449AGGGUCAACAUCUUUUACA80.4153347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892467AGGGTCAACATCTTTTACATGTAAAAGATGTTGACCCT0.608100.050200.637900.500001.000001.00000


Target Position: 2108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2108UGUUUUAUGCUCAGGGUCA77.9422474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4892126TGTTTTATGCTCAGGGTCATGACCCTGAGCATAAAACA0.083400.017600.482800.500001.000001.00000


Target Position: 2131, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2131CUUUUUUCUUUUUUUUUUU72.2701808

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2632149CTTTTTTCTTTTTTTTTTTAAAAAAAAAAAGAAAAAAG0.989300.863000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2129-2151TTCTTTTTTCTTTTTTTTTTTTTAAAAAAAAAAAGAAAAAAGAACUUUUUUCUUUUUUUUUUUUUU-11.30.700


Target Position: 890, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
890ACCACCAUCCACUACAACU73.0595757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
413908ACCACCATCCACTACAACTAGTTGTAGTGGATGGTGGT0.470300.150900.646600.500001.000001.00000


Target Position: 273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
273AACUACUUCCUGAAAACAA85.5455167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
474291AACTACTTCCTGAAAACAATTGTTTTCAGGAAGTAGTT0.233400.059700.500000.500001.000001.00000


Target Position: 454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
454CCCUGCACCAGCCCCCUCC46.42372385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
315472CCCTGCACCAGCCCCCTCCGGAGGGGGCTGGTGCAGGG0.203200.116100.620700.500000.929301.00000


Target Position: 2115, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2115UGCUCAGGGUCAAUUUCUU77.0176518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2372133TGCTCAGGGTCAATTTCTTAAGAAATTGACCCTGAGCA0.645200.085600.715500.750001.000001.00000


Target Position: 2116, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2116GCUCAGGGUCAAUUUCUUU84.155216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1222134GCTCAGGGTCAATTTCTTTAAAGAAATTGACCCTGAGC0.699700.088900.853401.000001.000001.00000


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690ACAAGCAGUCACAGCACAU80.8908329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471708ACAAGCAGTCACAGCACATATGTGCTGTGACTGCTTGT0.023200.005100.551700.750000.962001.00000


Target Position: 1735, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1735UCACUGUUGAAUUUUCUCU67.86961143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4141753TCACTGTTGAATTTTCTCTAGAGAAAATTCAACAGTGA0.318500.088400.500000.500001.000001.00000