siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Rnaxs 8   9   291   292   297   298   307   313   319   339   340   341   343   344   348   349   350   351   352   380  
381   382   388   389   390   393   394   399   401   412   418   436   438   441   442   459   470   472   476   477  
490   496   497   500   501   502   508   509   514   515   535   538   539   540   541   542   543   544   548   554  
580   581   582   583   584   586   589   590   601   639   640   641   642   643   675   677   681   682   683   684  
685   688   690   691   695   715   718   719   720   723   724   726   727   742   743   747   748   750   754   755  
756   757   767   768   776   779   780   782   783   784   787   801   804   806   807   808   809   810   811   819  
820   822   832   833   834   837   838   844   847   856   857   878   885   886   899   925   926   949   951   952  
953   957   1031   1037   1039   1040   1041   1044   1045   1048   1049   1055   1059   1061   1062   1083   1089   1090   1094   1096  
1102   1107   1109   1113   1119   1133   1134   1136   1137   1138   1158   1159   1160   1161   1162   1167   1168   1202   1203   1204  
1206   1209   1210   1212   1213   1216   1217   1224   1225   1230   1233   1234   1235   1237   1239   1243   1293   1294   1295   1296  
1365   1366   1377   1383   1384   1387   1389   1390   1433   1439   1440   1441   1459   1506   1508   1509   1510   1513   1514   1519  
1526   1527   1534   1536   1563   1567   1590   1591   1592   1593   1594   1622   1623   1707   1708   1709   1710   1711   1718   1719  
1723   1724   1798   1799   1800   1801   1803   1804   1807   1808   1809   1845   1846   1847   1848   1850   1851   1876   1878   1881  
1885   1886   1887   1888   1893   1895   1896   1897   1900   1906   1939   1953   1960   1961   2016   2017   2019   2046   2086   2087  
2088   2089   2091   2102   2149   2150   2151   2152   2176   2177   2178   2181   2182   2184   2185   2200   2264   2268   2269   2270  
2274   2275   2277   2278   2281   2282   2292   2293   2295   2296   2303   2350   2353   2363   2364   2365   2366   2367   2368   2371  
2372   2373   2374   2397   2398   2399   2400   2401   2403   2464   2470   2472   2588   2589   2590   2593   2594   2643   2644   2645  
2653   2675   2680   2681   2723   2724   2725   2728   2729   2731   2733   2734   2747   2751   2757   2762   2859   2873   2902   2903  
2916   2917   2924   2925   2970   2977   2978   2979   2997   2999   3000   3006   3009   3065   3066   3068   3069   3071   3123   3124  
3125   3129   3130   3163   3164   3165   3166   3167   3168   3169   3170   3171   3176   3177   3188   3190   3198   3199   3201   3202  
3208   3217   3262   3263   3268   3269   3270   3271   3272   3273   3274   3277   3278   3284   3286   3288   3291   3292   3320   3324  
3325   3330   3331   3332   3349   3350   3351   3352   3355   3358   3362   3363   3365   3373   3374   3375   3376   3385   3413   3456  
3460   3461   3462   3473   3482   3493   3494   3495   3498   3503   3504   3518   3522   3527   3528   3529   3531   3538   3539   3584  
3585   3593   3594   3602   3631   3632   3634   3636   3641   3642   3643   3644   3646   3649   3652   3653   3654   3656   3658   3666  
3673   3674   3676   3679   3702   3724   3726   3727   3729   3731   3732  
Biltr, Ernai 279   1927  
Biltr, Ernai, Sidirect 633   967  
Biltr, Ernai, Rnaxs 676   845   1231   1507   3357  
Biltr, Sidirect 12   283   322   405   407   410   422   644   696   730   733   738   778   848   891   892   958   1012   1019   1023  
1064   1074   1098   1115   1135   1214   1238   1255   1259   1265   1266   1443   1515   1531   1813   1952   1959   2095   2116   2157  
2166   2188   2297   2466   2528   2655   2665   2668   2735   2759   2769   2770   2772   2776   2781   2854   2880   2930   2931   2932  
2937   2938   2944   2947   2993   3001   3070   3073   3144   3175   3230   3243   3287   3297   3395   3401   3407   3410   3463   3472  
3497   3507   3542   3550   3573   3578   3647   3660   3695   3700   3721   3722  
Biltr, Rnaxs, Sidirect 10   293   299   300   312   395   420   471   478   686   749   769   777   781   812   813   823   858   898   900  
901   956   1060   1063   1095   1108   1110   1139   1240   1244   1297   1388   1877   1880   1940   1954   2090   2465   2471   2595  
2682   2730   2732   2852   2864   2991   2992   2998   3178   3179   3189   3191   3203   3285   3289   3293   3371   3386   3474   3475  
3483   3484   3505   3519   3530   3586   3635   3645   3655   3657   3725   3728  
Biltr, Ernai, Rnaxs, Sidirect 954  


Target Position: 1366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1366GCUGAAGAGACGAAUCAUG76.87411413

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9051384GCTGAAGAGACGAATCATGCATGATTCGTCTCTTCAGC0.088300.017200.698300.750001.000001.00000


Target Position: 3584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3584UUGCUAUAAUCAUUAGUUU75.84311525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8093602TTGCTATAATCATTAGTTTAAACTAATGATTATAGCAA0.465800.028600.646600.500001.000001.00000


Target Position: 3000, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3000GGAAUUUAAAAUUAAGUAG77.84151319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3873018GGAATTTAAAATTAAGTAGCTACTTAATTTTAAATTCC0.707800.260500.698300.750001.000001.00000


Target Position: 1804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1804GGAUGGUCAGGAAUAUGUG82.7365858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261822GGATGGTCAGGAATATGTGCACATATTCCTGACCATCC0.142000.019200.577600.750001.000001.00000


Target Position: 299, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
299CGAUUGAAUGAUUCUCAUA99.558525

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836317CGATTGAATGATTCTCATATATGAGAATCATTCAATCG0.107000.053200.750001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
297-319TCCGATTGAATGATTCTCATAAAUAUGAGAAUCAUUCAAUCGGACGAUUGAAUGAUUCUCAUAAAU20.416.333


Target Position: 1383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1383UGCCCGAGGAUAUAAUCAU74.68851661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7501401TGCCCGAGGATATAATCATATGATTATATCCTCGGGCA0.366800.027000.698300.750001.000001.00000


Target Position: 856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
856GUGGAAAUGGUGGGAAGAA83.3925792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
888874GTGGAAATGGTGGGAAGAATTCTTCCCACCATTTCCAC0.092600.059500.620700.750001.000001.00000


Target Position: 640, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640AGAGGAUAUAAAGCCAUUA87.5521469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
867658AGAGGATATAAAGCCATTATAATGGCTTTATATCCTCT0.104800.016200.689700.750001.000001.00000


Target Position: 2374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2374AGAGGAAAAUAAACAGAUU88.4329422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6422392AGAGGAAAATAAACAGATTAATCTGTTTATTTTCCTCT0.400900.076900.715500.750001.000001.00000


Target Position: 3070, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3070GAUCAAUUUUCAUUAAACU90.0368308

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3068-3090GGGATCAATTTTCATTAAACTTGAGUUUAAUGAAAAUUGAUCCCGAUCAAUUUUCAUUAAACUUGU-0.37.202


Target Position: 535, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
535AGCCUCUGGGGAUGCAAAA75.03671620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
916553AGCCTCTGGGGATGCAAAATTTTGCATCCCCAGAGGCT0.701500.013000.853400.750000.934800.75000


Target Position: 393, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
393AGCAUAGCAACAGUGAACA77.42341362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
661411AGCATAGCAACAGTGAACATGTTCACTGTTGCTATGCT0.594900.392800.646600.500001.000001.00000


Target Position: 1090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090AGACUGGAGAAAGGAAAUG61.51842895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9151108AGACTGGAGAAAGGAAATGCATTTCCTTTCTCCAGTCT0.167200.048300.569000.500001.000001.00000


Target Position: 1108, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1108GACUAAUGAAGAGAAGAAU87.7088459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3811126GACTAATGAAGAGAAGAATATTCTTCTCTTCATTAGTC0.367300.168700.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1106-1128ATGACTAATGAAGAGAAGAATATAUUCUUCUCUUCAUUAGUCAUGACUAAUGAAGAGAAGAAUAUU19.111.622


Target Position: 3006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3006UAAAAUUAAGUAGAACAAA79.77661140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8733024TAAAATTAAGTAGAACAAATTTGTTCTACTTAATTTTA0.869900.659800.534500.500001.000001.00000


Target Position: 2281, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2281UGCAAAGACGAAGAAGGUA76.44181463

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3752299TGCAAAGACGAAGAAGGTATACCTTCTTCGTCTTTGCA0.580200.169100.672400.750001.000001.00000


Target Position: 1848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1848ACUCCAUCAGAUACUAUAA93.5319141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4741866ACTCCATCAGATACTATAATTATAGTATCTGATGGAGT0.436700.092600.672400.750001.000001.00000


Target Position: 3320, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3320GAAACCAUUUUCCCAUCAU83.5619774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9663338GAAACCATTTTCCCATCATATGATGGGAAAATGGTTTC0.191100.106300.517200.750001.000001.00000


Target Position: 3658, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3658AAGUAUCUUCUAUUUUUAU85.5472626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9393676AAGTATCTTCTATTTTTATATAAAAATAGAAGATACTT0.684400.459900.594800.500001.000001.00000


Target Position: 1216, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1216AGAGAAACUGAAAAUCAAA94.4161101

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3031234AGAGAAACTGAAAATCAAATTTGATTTTCAGTTTCTCT0.450100.309800.724100.750001.000001.00000


Target Position: 544, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
544GGAUGCAAAAAUAAAGAAG76.4771458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
482562GGATGCAAAAATAAAGAAGCTTCTTTATTTTTGCATCC0.277500.238100.732800.750001.000001.00000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782AAUAAAGAUAAAGAUAAAA85.758606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981800AATAAAGATAAAGATAAAATTTTATCTTTATCTTTATT0.891100.857600.508600.500001.000001.00000


Target Position: 2303, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2303GAGUCAAAGAAGAAGGCUG78.45161263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9962321GAGTCAAAGAAGAAGGCTGCAGCCTTCTTCTTTGACTC0.129500.016300.525900.500001.000001.00000


Target Position: 3365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3365CUUUAAGAUAUCCAUCUUU82.3882893

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6063383CTTTAAGATATCCATCTTTAAAGATGGATATCTTAAAG0.272200.061400.637900.750000.907600.62500


Target Position: 2731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2731ACAACUUAUUUAAAAAUAU83.4953782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5142749ACAACTTATTTAAAAATATATATTTTTAAATAAGTTGT0.477800.156100.663800.750001.000001.00000


Target Position: 3728, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3728CUUAAUGGAAAAAAAAAAA82.4845882

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5173746CTTAATGGAAAAAAAAAAATTTTTTTTTTTCCATTAAG0.982900.804400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3726-3748AACTTAATGGAAAAAAAAAAAAAUUUUUUUUUUUCCAUUAAGUUCUUAAUGGAAAAAAAAAAAAAU-11.312.81


Target Position: 3324, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3324CCAUUUUCCCAUCAUCCUU77.54531353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3083342CCATTTTCCCATCATCCTTAAGGATGATGGGAAAATGG0.600200.138000.706901.000001.000001.00000


Target Position: 899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
899UGGAAAUUCCUAGAACAUA82.2212912

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
613917TGGAAATTCCTAGAACATATATGTTCTAGGAATTTCCA0.575200.042300.801700.750000.929300.62500


Target Position: 1162, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1162GAUGAGCCAGUAUUUCAAA95.191884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5511180GATGAGCCAGTATTTCAAATTTGAAATACTGGCTCATC0.549900.051900.681000.750001.000001.00000


Target Position: 344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
344GAACACCGGCACAAAGAAC72.71841869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922362GAACACCGGCACAAAGAACGTTCTTTGTGCCGGTGTTC0.505500.160000.525900.500001.000001.00000


Target Position: 926, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926GUAUUUGCCCCACCAUAUG67.86562354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
925944GTATTTGCCCCACCATATGCATATGGTGGGGCAAATAC0.212400.104000.525900.500001.000001.00000


Target Position: 3474, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3474CCAAAAAAAGGAAAAAUAA90.7082276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8763492CCAAAAAAAGGAAAAATAATTATTTTTCCTTTTTTTGG0.095300.041200.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3472-3494GTCCAAAAAAAGGAAAAATAATCUUAUUUUUCCUUUUUUUGGACCCAAAAAAAGGAAAAAUAAUCU-9.7-2.911


Target Position: 3462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462UGAGUAUUUGGUCCAAAAA82.4742883

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7933480TGAGTATTTGGTCCAAAAATTTTTGGACCAAATACTCA0.127700.022200.724100.750001.000001.00000


Target Position: 1224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1224UGAAAAUCAAAGAGGAGAA83.3442798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321242TGAAAATCAAAGAGGAGAATTCTCCTCTTTGATTTTCA0.485300.242700.551700.750001.000001.00000


Target Position: 2403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2403CCUCCAAACUCAAUUAUCU86.7054520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6182421CCTCCAAACTCAATTATCTAGATAATTGAGTTTGGAGG0.242000.201800.620700.750001.000001.00000


Target Position: 726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
726AGGAGAAGAAAAGAAAACU75.14851604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
952744AGGAGAAGAAAAGAAAACTAGTTTTCTTTTCTTCTCCT0.635400.617500.637900.500001.000001.00000


Target Position: 582, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
582CUAGUCCACCACAAAUUAA89.7312327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544600CTAGTCCACCACAAATTAATTAATTTGTGGTGGACTAG0.614300.351800.637900.750001.000001.00000


Target Position: 2979, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2979CCUUCCCUCUCUCCCAUUU72.09661924

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2832997CCTTCCCTCTCTCCCATTTAAATGGGAGAGAGGGAAGG0.473100.438200.844801.000001.000001.00000


Target Position: 3073, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3073CAAUUUUCAUUAAACUUGA89.051370

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3071-3093ATCAATTTTCATTAAACTTGAAGUCAAGUUUAAUGAAAAUUGAUCAAUUUUCAUUAAACUUGAAGU10.30.402


Target Position: 3262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3262GGGGUUGGGGAGGGAUGAA79.18971205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8913280GGGGTTGGGGAGGGATGAATTCATCCCTCCCCAACCCC0.430200.014400.819001.000001.000001.00000


Target Position: 1591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1591UCGGCGGCUGAAAAAAUGU58.68673103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9361609TCGGCGGCTGAAAAAATGTACATTTTTTCAGCCGCCGA0.386400.038900.586200.500001.000001.00000


Target Position: 892, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
892CAUCAAGUGGAAAUUCCUA93.7039130

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
890-912GGCATCAAGTGGAAATTCCTAGAUAGGAAUUUCCACUUGAUGCCCAUCAAGUGGAAAUUCCUAGAU18.719.223


Target Position: 3175, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3175GUUCCUUUUUAAAUGUGAA91.5402236

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3173-3195GTGTTCCTTTTTAAATGTGAATTUUCACAUUUAAAAAGGAACACGUUCCUUUUUAAAUGUGAAUUU20.518.712


Target Position: 3542, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3542GAAAAAAACAUAAAAAGCA86.6899523

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3540-3562TGGAAAAAAACATAAAAAGCAGAUGCUUUUUAUGUUUUUUUCCAGAAAAAAACAUAAAAAGCAGAU12.3-11.301


Target Position: 1440, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1440CAGGACAUAAGUGGAAAGA76.66241440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241458CAGGACATAAGTGGAAAGATCTTTCCACTTATGTCCTG0.162900.027500.560300.500001.000001.00000


Target Position: 677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
677GAUGAUGCUGAUUAUAAAC79.8851125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906695GATGATGCTGATTATAAACGTTTATAATCAGCATCATC0.345800.077400.534500.500001.000001.00000


Target Position: 1089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1089AAGACUGGAGAAAGGAAAU76.721430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8871107AAGACTGGAGAAAGGAAATATTTCCTTTCTCCAGTCTT0.112000.047800.629300.500001.000001.00000


Target Position: 2151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2151GGGCACCACCAAAAACUUU78.69691246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922169GGGCACCACCAAAAACTTTAAAGTTTTTGGTGGTGCCC0.123100.008600.991401.000000.962000.62500


Target Position: 1534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1534GCUUAACCCUAGUUCACGA92.1435203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7921552GCTTAACCCTAGTTCACGATCGTGAACTAGGGTTAAGC0.199500.044100.560300.750001.000001.00000


Target Position: 2902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2902CGAUUAUAUUGGUGCGUUU89.5132338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9902920CGATTATATTGGTGCGTTTAAACGCACCAATATAATCG0.068200.022200.793101.000001.000001.00000


Target Position: 2464, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2464CCCAAUUGAGAAGAUUUAC65.05252598

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3372482CCCAATTGAGAAGATTTACGTAAATCTTCTCAATTGGG0.689500.226200.810300.750001.000001.00000


Target Position: 3358, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3358CUGUACCCUUUAAGAUAUC67.35982404

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8573376CTGTACCCTTTAAGATATCGATATCTTAAAGGGTACAG0.100200.085100.603400.500000.945700.62500


Target Position: 767, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
767UUGAAAAAACCCAAGAAUA77.86491315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
795785TTGAAAAAACCCAAGAATATATTCTTGGGTTTTTTCAA0.452200.246100.603400.500001.000001.00000


Target Position: 1062, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1062AGGAAAUAUUUAGGAAAAA85.1833656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7201080AGGAAATATTTAGGAAAAATTTTTCCTAAATATTTCCT0.147900.065800.844800.750001.000001.00000


Target Position: 898, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
898GUGGAAAUUCCUAGAACAU85.0262664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
753916GTGGAAATTCCTAGAACATATGTTCTAGGAATTTCCAC0.249800.026400.637900.750000.929300.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
896-918AAGTGGAAATTCCTAGAACATAAAUGUUCUAGGAAUUUCCACUUGUGGAAAUUCCUAGAACAUAAU20.320.122


Target Position: 2645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2645GGCAGCAAGUCUUAACAAA95.070586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1912663GGCAGCAAGTCTTAACAAATTTGTTAAGACTTGCTGCC0.593700.278301.000001.000001.000001.00000


Target Position: 418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
418UUCUGAAAAGAAACACAAA81.9052941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874436TTCTGAAAAGAAACACAAATTTGTGTTTCTTTTCAGAA0.325700.053600.672400.500001.000001.00000


Target Position: 1801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1801GUUGGAUGGUCAGGAAUAU83.514778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731819GTTGGATGGTCAGGAATATATATTCCTGACCATCCAAC0.221400.015800.603400.750001.000001.00000


Target Position: 1888, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1888AGUUUUUAAGAACCUACAA85.769605

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7861906AGTTTTTAAGAACCTACAATTGTAGGTTCTTAAAAACT0.271900.071300.560300.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181UGAUGAACUUGCAAACUAA98.996728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8042199TGATGAACTTGCAAACTAATTAGTTTGCAAGTTCATCA0.163800.021500.689700.750001.000001.00000


Target Position: 502, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
502AGACAAGGAAAAACGAAAA85.9817587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479520AGACAAGGAAAAACGAAAATTTTCGTTTTTCCTTGTCT0.278700.282700.724100.750001.000001.00000


Target Position: 1508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1508AUCCAAGGUUCCAUUAAAU78.84571237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111526ATCCAAGGTTCCATTAAATATTTAATGGAACCTTGGAT0.530800.081100.672400.500001.000001.00000


Target Position: 2925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2925AGUUAGGGUUUUGCAAUAA85.1694657

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6672943AGTTAGGGTTTTGCAATAATTATTGCAAAACCCTAACT0.166700.083100.672400.750001.000001.00000


Target Position: 2937, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2937GCAAUAACUUCUAUAUUUU91.5221237

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2935-2957TTGCAATAACTTCTATATTTTAAAAAAUAUAGAAGUUAUUGCAAGCAAUAACUUCUAUAUUUUAAU-8.06.902


Target Position: 2088, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2088CAGCGAAGAUCCUUUCUUA102.7866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9112106CAGCGAAGATCCTTTCTTATAAGAAAGGATCTTCGCTG0.186600.013100.750000.750001.000001.00000


Target Position: 2350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350GCUGGAAGUUCAAGCCACA92.7988176

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4942368GCTGGAAGTTCAAGCCACATGTGGCTTGAACTTCCAGC0.271500.070900.646600.750000.956500.62500


Target Position: 3530, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3530GUGUAAAAAAUGGAAAAAA86.7867517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5503548GTGTAAAAAATGGAAAAAATTTTTTCCATTTTTTACAC0.327500.052900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3528-3550TTGTGTAAAAAATGGAAAAAAACUUUUUUCCAUUUUUUACACAAGUGUAAAAAAUGGAAAAAAACU14.37.201


Target Position: 459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
459AAGAUGGAAGCUCAGAAAA81.6865962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
899477AAGATGGAAGCTCAGAAAATTTTCTGAGCTTCCATCTT0.097700.013800.637900.500001.000001.00000


Target Position: 3352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3352CAUUCGCUGUACCCUUUAA93.911122

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8963370CATTCGCTGTACCCTTTAATTAAAGGGTACAGCGAATG0.159800.014000.620700.750001.000001.00000


Target Position: 2728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2728UGGACAACUUAUUUAAAAA90.9984256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3542746TGGACAACTTATTTAAAAATTTTTAAATAAGTTGTCCA0.426200.111000.844800.750001.000001.00000


Target Position: 3679, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3679UGAAUUCCCUUUUAAUCAA83.2844805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7413697TGAATTCCCTTTTAATCAATTGATTAAAAGGGAATTCA0.542500.316000.577600.750001.000001.00000


Target Position: 1886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1886CGAGUUUUUAAGAACCUAC75.15611602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6461904CGAGTTTTTAAGAACCTACGTAGGTTCTTAAAAACTCG0.224400.054900.612100.750000.989100.62500


Target Position: 2854, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2854CUGUUUCACUGAAAUGUUU82.0728927

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2852-2874CACTGTTTCACTGAAATGTTTGGAAACAUUUCAGUGAAACAGUGCUGUUUCACUGAAAUGUUUGGU5.320.501


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801AAGUUCCUGAGCCAGAUAA80.39521079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
853819AAGTTCCTGAGCCAGATAATTATCTGGCTCAGGAACTT0.410600.111500.603400.500000.983701.00000


Target Position: 3165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3165UGACUUGAGUGUUCCUUUU76.30831473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9083183TGACTTGAGTGTTCCTTTTAAAAGGAACACTCAAGTCA0.087600.014700.724100.750001.000001.00000


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526UACAUCAUGCUUAACCCUA76.56711448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9791544TACATCATGCTTAACCCTATAGGGTTAAGCATGATGTA0.117300.122800.508600.500001.000001.00000


Target Position: 1212, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1212AGGAAGAGAAACUGAAAAU82.0141933

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3861230AGGAAGAGAAACTGAAAATATTTTCAGTTTCTCTTCCT0.359500.333600.836200.750001.000001.00000


Target Position: 1507, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1507CAUCCAAGGUUCCAUUAAA98.114540

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6150719CATCCAAGGTTCCATTAAA1/1/0/097.21TOP1NM_003286.21NANANA20:39729942..39729960(+)00TOP1(0.002)&KIAA0368(0.007)&DDX18(0.029)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4791525CATCCAAGGTTCCATTAAATTTAATGGAACCTTGGATG0.367700.068000.655200.750001.000001.00000


Target Position: 2176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2176GUCUAUGAUGAACUUGCAA89.6941328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622194GTCTATGATGAACTTGCAATTGCAAGTTCATCATAGAC0.073400.020200.672400.750001.000001.00000


Target Position: 471, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
471CAGAAAAGCAUAAAGACAA93.684131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
538489CAGAAAAGCATAAAGACAATTGTCTTTATGCTTTTCTG0.955500.450200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
469-491CTCAGAAAAGCATAAAGACAAACUUGUCUUUAUGCUUUUCUGAGCAGAAAAGCAUAAAGACAAACU19.210.312


Target Position: 395, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
395CAUAGCAACAGUGAACAUA89.1901360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644413CATAGCAACAGTGAACATATATGTTCACTGTTGCTATG0.634900.402300.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
393-415AGCATAGCAACAGTGAACATAAAUAUGUUCACUGUUGCUAUGCUCAUAGCAACAGUGAACAUAAAU20.519.722


Target Position: 3676, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3676UCAUGAAUUCCCUUUUAAU81.7105957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4473694TCATGAATTCCCTTTTAATATTAAAAGGGAATTCATGA0.417900.264300.715500.750001.000001.00000


Target Position: 1441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1441AGGACAUAAGUGGAAAGAA88.3454429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6581459AGGACATAAGTGGAAAGAATTCTTTCCACTTATGTCCT0.175100.037000.672400.750001.000001.00000


Target Position: 1433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1433CCUCCUCCAGGACAUAAGU73.06951834

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8831451CCTCCTCCAGGACATAAGTACTTATGTCCTGGAGGAGG0.186600.014800.637900.750000.913000.62500


Target Position: 681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
681AUGCUGAUUAUAAACCUAA83.9878733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
754699ATGCTGATTATAAACCTAATTAGGTTTATAATCAGCAT0.700300.100300.620700.500001.000001.00000


Target Position: 2471, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2471GAGAAGAUUUACAACAAAA102.2738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3412489GAGAAGATTTACAACAAAATTTTGTTGTAAATCTTCTC0.665100.550300.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2469-2491TTGAGAAGATTTACAACAAAACCUUUUGUUGUAAAUCUUCUCAAGAGAAGAUUUACAACAAAACCU12.219.102


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900CCUACAACUAUUUAUGGAG75.31651586

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8681918CCTACAACTATTTATGGAGCTCCATAAATAGTTGTAGG0.215900.149000.534500.750001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040CUCGACCAUGAAUAUACUA86.4781539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5601058CTCGACCATGAATATACTATAGTATATTCATGGTCGAG0.223600.084500.637900.750001.000001.00000


Target Position: 2295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2295AGGUAGUAGAGUCAAAGAA89.8793317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642313AGGTAGTAGAGTCAAAGAATTCTTTGACTCTACTACCT0.098200.041200.672400.750001.000001.00000


Target Position: 682, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
682UGCUGAUUAUAAACCUAAG74.01511730

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
744700TGCTGATTATAAACCTAAGCTTAGGTTTATAATCAGCA0.700100.120800.715500.500001.000001.00000


Target Position: 3357, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3357GCUGUACCCUUUAAGAUAU88.5093412

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7335719GCTGTACCCTTTAAGATAT1/1/0/097.21TOP1NM_003286.21NANANA20:39752746..39752764(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8453375GCTGTACCCTTTAAGATATATATCTTAAAGGGTACAGC0.104500.086900.810301.000000.945700.62500


Target Position: 322, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
322CAAAGAUAAACACAAAGAU87.925450

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
320-342CACAAAGATAAACACAAAGATCGAUCUUUGUGUUUAUCUUUGUGCAAAGAUAAACACAAAGAUCGU19.26.922


Target Position: 2589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2589GGUUUGGGAAAGAUGGAUA91.7543227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6802607GGTTTGGGAAAGATGGATATATCCATCTTTCCCAAACC0.718400.034600.810301.000001.000001.00000


Target Position: 2399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2399GGAACCUCCAAACUCAAUU77.56311350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6612417GGAACCTCCAAACTCAATTAATTGAGTTTGGAGGTTCC0.659600.036700.862101.000001.000001.00000


Target Position: 644, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
644GAUAUAAAGCCAUUAAAGA94.0877113

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
642-664AGGATATAAAGCCATTAAAGAGAUCUUUAAUGGCUUUAUAUCCUGAUAUAAAGCCAUUAAAGAGAU-4.3-8.033


Target Position: 3729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3729UUAAUGGAAAAAAAAAAAA70.25432129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673747TTAATGGAAAAAAAAAAAATTTTTTTTTTTTCCATTAA0.985600.809400.534500.500001.000001.00000


Target Position: 351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
351GGCACAAAGAACACAAGAA97.192850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
125369GGCACAAAGAACACAAGAATTCTTGTGTTCTTTGTGCC0.776600.377500.827601.000001.000001.00000


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540CUGGGGAUGCAAAAAUAAA88.3432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
191558CTGGGGATGCAAAAATAAATTTATTTTTGCATCCCCAG0.909100.480200.784500.750001.000001.00000


Target Position: 3230, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3230CCUUUUUCUUGAUCUUAAA91.9626216

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3228-3250AACCTTTTTCTTGATCTTAAAGAUUUAAGAUCAAGAAAAAGGUUCCUUUUUCUUGAUCUUAAAGAU6.95.502


Target Position: 1388, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1388GAGGAUAUAAUCAUCAACU88.3177430

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8891406GAGGATATAATCATCAACTAGTTGATGATTATATCCTC0.092500.043800.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1386-1408CCGAGGATATAATCATCAACTGTAGUUGAUGAUUAUAUCCUCGGGAGGAUAUAAUCAUCAACUGUU20.519.932


Target Position: 2185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2185GAACUUGCAAACUAAGAUU86.5902532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462203GAACTTGCAAACTAAGATTAATCTTAGTTTGCAAGTTC0.399200.027500.663800.750001.000001.00000


Target Position: 2184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184UGAACUUGCAAACUAAGAU76.60781444

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442202TGAACTTGCAAACTAAGATATCTTAGTTTGCAAGTTCA0.387300.031400.543100.750001.000001.00000


Target Position: 956, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956GAGAAUGUCAAGUUUUAUU87.1741495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
912974GAGAATGTCAAGTTTTATTAATAAAACTTGACATTCTC0.085800.032400.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
954-976CAGAGAATGTCAAGTTTTATTATAAUAAAACUUGACAUUCUCUGGAGAAUGUCAAGUUUUAUUAUU-0.319.222


Target Position: 1102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1102GGAAAUGACUAAUGAAGAG84.3374709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7811120GGAAATGACTAATGAAGAGCTCTTCATTAGTCATTTCC0.415700.211400.560300.750001.000001.00000


Target Position: 2931, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2931GGUUUUGCAAUAACUUCUA89.4542342

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2929-2951AGGGTTTTGCAATAACTTCTATAUAGAAGUUAUUGCAAAACCCUGGUUUUGCAAUAACUUCUAUAU17.721.102


Target Position: 1019, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1019GCUACGUUCUUUGCAAAAA85.3799640

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1017-1039TAGCTACGTTCTTTGCAAAAATGUUUUUGCAAAGAACGUAGCUAGCUACGUUCUUUGCAAAAAUGU20.019.622


Target Position: 2590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2590GUUUGGGAAAGAUGGAUAA87.6558462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6312608GTTTGGGAAAGATGGATAATTATCCATCTTTCCCAAAC0.720200.046300.612100.750001.000001.00000


Target Position: 2177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177UCUAUGAUGAACUUGCAAA81.7769950

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9792195TCTATGATGAACTTGCAAATTTGCAAGTTCATCATAGA0.070900.032200.724100.750001.000001.00000


Target Position: 1255, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1255GAAAGAAUAUGGAUUCUGU93.6137134

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1253-1275CTGAAAGAATATGGATTCTGTATACAGAAUCCAUAUUCUUUCAGGAAAGAAUAUGGAUUCUGUAUU20.45.322


Target Position: 3297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3297GGAUAAUGAAAUAAUCAGU89.1171364

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3295-3317AAGGATAATGAAATAATCAGTGAACUGAUUAUUUCAUUAUCCUUGGAUAAUGAAAUAAUCAGUGAU13.48.702


Target Position: 1592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1592CGGCGGCUGAAAAAAUGUG66.98662435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5981610CGGCGGCTGAAAAAATGTGCACATTTTTTCAGCCGCCG0.348300.058300.620700.750001.000001.00000


Target Position: 695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
695CCUAAGAAAAUUAAAACAG70.35962116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
797713CCTAAGAAAATTAAAACAGCTGTTTTAATTTTCTTAGG0.797100.747900.560300.750001.000001.00000


Target Position: 2665, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2665CAACAUCUUUGCGAAAAGA86.4383546

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2663-2685ACCAACATCTTTGCGAAAAGATAUCUUUUCGCAAAGAUGUUGGUCAACAUCUUUGCGAAAAGAUAU12.419.213


Target Position: 3198, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3198UAUUUCUUUUUAAUUAUUU71.84281958

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8903216TATTTCTTTTTAATTATTTAAATAATTAAAAAGAAATA0.136800.053200.543100.500001.000001.00000


Target Position: 3632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3632AGAGUCCAUUUCCCACAUC64.93062607

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823650AGAGTCCATTTCCCACATCGATGTGGGAAATGGACTCT0.218300.075500.543100.500001.000001.00000


Target Position: 1266, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266GAUUCUGUAUUAUGGAUAA102.6567

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1264-1286TGGATTCTGTATTATGGATAACCUUAUCCAUAAUACAGAAUCCAGAUUCUGUAUUAUGGAUAACCU21.219.222


Target Position: 2724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2724CCUAUGGACAACUUAUUUA91.652235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5402742CCTATGGACAACTTATTTATAAATAAGTTGTCCATAGG0.236100.105800.810301.000001.000001.00000


Target Position: 3066, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3066UGGGGAUCAAUUUUCAUUA81.6468968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4633084TGGGGATCAATTTTCATTATAATGAAAATTGATCCCCA0.331100.071700.810300.750001.000001.00000


Target Position: 3656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3656UCAAGUAUCUUCUAUUUUU81.19341016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3383674TCAAGTATCTTCTATTTTTAAAAATAGAAGATACTTGA0.539800.428300.724100.750001.000001.00000


Target Position: 3293, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3293CUAAGGAUAAUGAAAUAAU87.4871474

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8293311CTAAGGATAATGAAATAATATTATTTCATTATCCTTAG0.109100.084200.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3291-3313ATCTAAGGATAATGAAATAATCAAUUAUUUCAUUAUCCUUAGAUCUAAGGAUAAUGAAAUAAUCAU2.119.902


Target Position: 639, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
639AAGAGGAUAUAAAGCCAUU82.4212887

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
901657AAGAGGATATAAAGCCATTAATGGCTTTATATCCTCTT0.093300.013700.629300.500001.000001.00000


Target Position: 442, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
442GGAGAAGACCAAACACAAA100.47319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
397460GGAGAAGACCAAACACAAATTTGTGTTTGGTCTTCTCC0.829200.086400.870701.000001.000001.00000


Target Position: 2770, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2770CUGUAUGAUUUGUUUUGAA94.823992

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2768-2790AGCTGTATGATTTGTTTTGAATTUUCAAAACAAAUCAUACAGCUCUGUAUGAUUUGUUUUGAAUUU14.921.502


Target Position: 1096, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1096GAGAAAGGAAAUGACUAAU84.4437703

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5891114GAGAAAGGAAATGACTAATATTAGTCATTTCCTTTCTC0.299900.045400.801700.750001.000001.00000


Target Position: 1063, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1063GGAAAUAUUUAGGAAAAAU90.5322284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011081GGAAATATTTAGGAAAAATATTTTTCCTAAATATTTCC0.089500.041700.862101.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1061-1083AAGGAAATATTTAGGAAAAATTTAUUUUUCCUAAAUAUUUCCUUGGAAAUAUUUAGGAAAAAUUUU14.31.812


Target Position: 1390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1390GGAUAUAAUCAUCAACUGU91.1831252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511408GGATATAATCATCAACTGTACAGTTGATGATTATATCC0.103100.079300.663800.750001.000001.00000


Target Position: 1160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1160CAGAUGAGCCAGUAUUUCA96.265361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871178CAGATGAGCCAGTATTTCATGAAATACTGGCTCATCTG0.487000.039500.560300.500001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420CUGAAAAGAAACACAAAGA84.6061689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773438CTGAAAAGAAACACAAAGATCTTTGTGTTTCTTTTCAG0.562000.112100.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
418-440TTCTGAAAAGAAACACAAAGAGAUCUUUGUGUUUCUUUUCAGAACUGAAAAGAAACACAAAGAGAU16.712.212


Target Position: 1880, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1880GAGAAACGAGUUUUUAAGA88.4893415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9251898GAGAAACGAGTTTTTAAGATCTTAAAAACTCGTTTCTC0.141900.068000.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1878-1900TTGAGAAACGAGTTTTTAAGAACUCUUAAAAACUCGUUUCUCAAGAGAAACGAGUUUUUAAGAACU-3.819.722


Target Position: 690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
690AUAAACCUAAGAAAAUUAA78.69591247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972708ATAAACCTAAGAAAATTAATTAATTTTCTTAGGTTTAT0.829600.599300.508600.500001.000001.00000


Target Position: 2016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2016UCCGUACAUACAAUGCCUC55.93813261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7752034TCCGTACATACAATGCCTCGAGGCATTGTATGTACGGA0.173100.061700.560300.500000.978300.87500


Target Position: 352, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
352GCACAAAGAACACAAGAAG77.12171394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
214370GCACAAAGAACACAAGAAGCTTCTTGTGTTCTTTGTGC0.739100.320100.715500.750001.000001.00000


Target Position: 1893, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1893UUAAGAACCUACAACUAUU80.89211036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9261911TTAAGAACCTACAACTATTAATAGTTGTAGGTTCTTAA0.519800.153900.525900.500001.000001.00000


Target Position: 1723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1723UGAAAAGGAGGAAGGAGAA81.5337979

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171741TGAAAAGGAGGAAGGAGAATTCTCCTTCCTCCTTTTCA0.319700.168600.551700.750001.000001.00000


Target Position: 3505, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3505GGCUUUUAUUUUUUCUUUU82.2473911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803523GGCTTTTATTTTTTCTTTTAAAAGAAAAAATAAAAGCC0.125700.034401.000001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3503-3525AGGGCTTTTATTTTTTCTTTTGTAAAAGAAAAAAUAAAAGCCCUGGCUUUUAUUUUUUCUUUUGUU5.513.702


Target Position: 1135, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1135CAACCUAAGCAAAUGUGAU89.2955354

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1133-1155ACCAACCTAAGCAAATGTGATTTAUCACAUUUGCUUAGGUUGGUCAACCUAAGCAAAUGUGAUUUU20.518.622


Target Position: 1136, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1136AACCUAAGCAAAUGUGAUU76.33231471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531154AACCTAAGCAAATGTGATTAATCACATTTGCTTAGGTT0.075700.022000.637900.500001.000001.00000


Target Position: 3401, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3401CUUUCACUUGAAAGAUUUU80.58161061

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3399-3421ATCTTTCACTTGAAAGATTTTATAAAAUCUUUCAAGUGAAAGAUCUUUCACUUGAAAGAUUUUAUU5.319.202


Target Position: 339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
339AUCGAGAACACCGGCACAA71.66091975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
883357ATCGAGAACACCGGCACAATTGTGCCGGTGTTCTCGAT0.263100.062600.534500.500001.000001.00000


Target Position: 3285, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3285GAGUGAAUCUAAGGAUAAU95.639375

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8143303GAGTGAATCTAAGGATAATATTATCCTTAGATTCACTC0.243500.020400.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3283-3305GCGAGTGAATCTAAGGATAATGAAUUAUCCUUAGAUUCACUCGCGAGUGAAUCUAAGGAUAAUGAU19.919.212


Target Position: 808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
808UGAGCCAGAUAACAAGAAA86.6297528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
578826TGAGCCAGATAACAAGAAATTTCTTGTTATCTGGCTCA0.706600.311000.724100.750001.000001.00000


Target Position: 3199, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3199AUUUCUUUUUAAUUAUUUU77.76681331

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9733217ATTTCTTTTTAATTATTTTAAAATAATTAAAAAGAAAT0.137600.043700.508600.500001.000001.00000


Target Position: 2465, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465CCAAUUGAGAAGAUUUACA86.4213550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5152483CCAATTGAGAAGATTTACATGTAAATCTTCTCAATTGG0.679100.411400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2463-2485TCCCAATTGAGAAGATTTACAACUGUAAAUCUUCUCAAUUGGGACCAAUUGAGAAGAUUUACAACU10.013.802


Target Position: 949, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
949UCUUCCAGAGAAUGUCAAG63.98712689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862967TCTTCCAGAGAATGTCAAGCTTGACATTCTCTGGAAGA0.153200.016400.586200.500001.000001.00000


Target Position: 500, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
500AGAGACAAGGAAAAACGAA86.0618577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828518AGAGACAAGGAAAAACGAATTCGTTTTTCCTTGTCTCT0.657700.613000.551700.750001.000001.00000


Target Position: 750, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
750AAGAAGAGGAUGGUAAAUU73.67691773

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
900768AAGAAGAGGATGGTAAATTAATTTACCATCCTCTTCTT0.272300.198500.629300.500001.000001.00000


Target Position: 1137, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1137ACCUAAGCAAAUGUGAUUU69.05642241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9391155ACCTAAGCAAATGTGATTTAAATCACATTTGCTTAGGT0.079900.022700.853400.750001.000001.00000


Target Position: 1061, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1061AAGGAAAUAUUUAGGAAAA88.5733411

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111079AAGGAAATATTTAGGAAAATTTTCCTAAATATTTCCTT0.160900.057000.637900.500001.000001.00000


Target Position: 2932, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2932GUUUUGCAAUAACUUCUAU85.4721634

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2930-2952GGGTTTTGCAATAACTTCTATATAUAGAAGUUAUUGCAAAACCCGUUUUGCAAUAACUUCUAUAUU18.920.002


Target Position: 2924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2924CAGUUAGGGUUUUGCAAUA93.2947153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7692942CAGTTAGGGTTTTGCAATATATTGCAAAACCCTAACTG0.175200.025000.741400.750001.000001.00000


Target Position: 2588, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2588UGGUUUGGGAAAGAUGGAU64.79482619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7622606TGGTTTGGGAAAGATGGATATCCATCTTTCCCAAACCA0.722200.025600.663800.750001.000001.00000


Target Position: 2759, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2759CAAAAUUCUAGCUGUAUGA87.8759454

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2757-2779ATCAAAATTCTAGCTGTATGATTUCAUACAGCUAGAAUUUUGAUCAAAAUUCUAGCUGUAUGAUUU17.90.402


Target Position: 688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
688UUAUAAACCUAAGAAAAUU74.06711721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
931706TTATAAACCTAAGAAAATTAATTTTCTTAGGTTTATAA0.820300.400900.525900.500001.000001.00000


Target Position: 2725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2725CUAUGGACAACUUAUUUAA94.176109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5412743CTATGGACAACTTATTTAATTAAATAAGTTGTCCATAG0.293500.111400.637900.750001.000001.00000


Target Position: 1799, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1799GAGUUGGAUGGUCAGGAAU83.3281801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7761817GAGTTGGATGGTCAGGAATATTCCTGACCATCCAACTC0.300600.024700.801700.750001.000001.00000


Target Position: 901, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901GAAAUUCCUAGAACAUAAA93.7444128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
669919GAAATTCCTAGAACATAAATTTATGTTCTAGGAATTTC0.165700.037900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
899-921TGGAAATTCCTAGAACATAAAGGUUUAUGUUCUAGGAAUUUCCAGAAAUUCCUAGAACAUAAAGGU6.914.223


Target Position: 3385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3385UCUUUUUAACCCUAAUCUU73.00321839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7303403TCTTTTTAACCCTAATCTTAAGATTAGGGTTAAAAAGA0.144800.130300.586200.750001.000001.00000


Target Position: 410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
410CAUAAAGAUUCUGAAAAGA88.0711444

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
408-430AACATAAAGATTCTGAAAAGAAAUCUUUUCAGAAUCUUUAUGUUCAUAAAGAUUCUGAAAAGAAAU12.26.921


Target Position: 3673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3673UUAUCAUGAAUUCCCUUUU66.79462450

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9043691TTATCATGAATTCCCTTTTAAAAGGGAATTCATGATAA0.479500.274600.534500.500001.000001.00000


Target Position: 3641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3641UUCCCACAUCUUUCCUCAA75.441566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9193659TTCCCACATCTTTCCTCAATTGAGGAAAGATGTGGGAA0.613100.158200.525900.500001.000001.00000


Target Position: 2992, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2992CCAUUUCAGGAAUUUAAAA89.6166332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6753010CCATTTCAGGAATTTAAAATTTTAAATTCCTGAAATGG0.267000.035200.844801.000000.994600.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2990-3012TCCCATTTCAGGAATTTAAAATTUUUUAAAUUCCUGAAAUGGGACCAUUUCAGGAAUUUAAAAUUU-9.713.802


Target Position: 1098, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1098GAAAGGAAAUGACUAAUGA95.815469

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1096-1118GAGAAAGGAAATGACTAATGAAGUCAUUAGUCAUUUCCUUUCUCGAAAGGAAAUGACUAAUGAAGU11.618.722


Target Position: 2852, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2852CACUGUUUCACUGAAAUGU75.1381606

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9472870CACTGTTTCACTGAAATGTACATTTCAGTGAAACAGTG0.077100.011600.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2850-2872TTCACTGTTTCACTGAAATGTTTACAUUUCAGUGAAACAGUGAACACUGUUUCACUGAAAUGUUUU13.817.802


Target Position: 298, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
298CCGAUUGAAUGAUUCUCAU85.5587624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831316CCGATTGAATGATTCTCATATGAGAATCATTCAATCGG0.108700.054100.758601.000001.000001.00000


Target Position: 1939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1939UCUUUUUGAUAGACUCAAU80.50581067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8171957TCTTTTTGATAGACTCAATATTGAGTCTATCAAAAAGA0.113100.021000.715500.750000.934800.62500


Target Position: 3585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3585UGCUAUAAUCAUUAGUUUU80.04041108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5173603TGCTATAATCATTAGTTTTAAAACTAATGATTATAGCA0.389900.058800.853400.750001.000001.00000


Target Position: 307, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
307UGAUUCUCAUAAACACAAA87.1083499

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
388325TGATTCTCATAAACACAAATTTGTGTTTATGAGAATCA0.927800.089100.724100.750001.000001.00000


Target Position: 3069, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3069GGAUCAAUUUUCAUUAAAC87.3731483

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6323087GGATCAATTTTCATTAAACGTTTAATGAAAATTGATCC0.295000.209600.724100.750000.972800.62500


Target Position: 2087, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2087CCAGCGAAGAUCCUUUCUU76.31475

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9462105CCAGCGAAGATCCTTTCTTAAGAAAGGATCTTCGCTGG0.141900.011600.706901.000001.000001.00000


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519CAUUAAAUACAUCAUGCUU89.2681355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9621537CATTAAATACATCATGCTTAAGCATGATGTATTTAATG0.293800.294500.517200.750001.000001.00000


Target Position: 2772, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2772GUAUGAUUUGUUUUGAAUU85.3442642

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2770-2792CTGTATGATTTGTTTTGAATTTTAAUUCAAAACAAAUCAUACAGGUAUGAUUUGUUUUGAAUUUUU7.48.702


Target Position: 3634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3634AGUCCAUUUCCCACAUCUU82.198915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443652AGTCCATTTCCCACATCTTAAGATGTGGGAAATGGACT0.249900.146400.569000.750001.000001.00000


Target Position: 1109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1109ACUAAUGAAGAGAAGAAUA89.0229372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4311127ACTAATGAAGAGAAGAATATATTCTTCTCTTCATTAGT0.391500.178300.663800.750001.000001.00000


Target Position: 580, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
580CUCUAGUCCACCACAAAUU77.86431316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
450598CTCTAGTCCACCACAAATTAATTTGTGGTGGACTAGAG0.550000.074800.801700.750001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539UCUGGGGAUGCAAAAAUAA78.85361236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
327557TCTGGGGATGCAAAAATAATTATTTTTGCATCCCCAGA0.892500.494800.689700.750001.000001.00000


Target Position: 477, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
477AGCAUAAAGACAAACAUAA89.3215349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
282495AGCATAAAGACAAACATAATTATGTTTGTCTTTATGCT0.962800.908100.819000.750001.000001.00000


Target Position: 476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476AAGCAUAAAGACAAACAUA93.2259157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
674494AAGCATAAAGACAAACATATATGTTTGTCTTTATGCTT0.947400.469900.594800.500001.000001.00000


Target Position: 2371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2371CCGAGAGGAAAAUAAACAG74.17731712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5912389CCGAGAGGAAAATAAACAGCTGTTTATTTTCCTCTCGG0.459100.060200.629300.750001.000001.00000


Target Position: 2466, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466CAAUUGAGAAGAUUUACAA97.872946

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2464-2486CCCAATTGAGAAGATTTACAACAUUGUAAAUCUUCUCAAUUGGGCAAUUGAGAAGAUUUACAACAU6.912.002


Target Position: 3657, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3657CAAGUAUCUUCUAUUUUUA99.834222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6523675CAAGTATCTTCTATTTTTATAAAAATAGAAGATACTTG0.626300.425500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3655-3677CTCAAGTATCTTCTATTTTTATCUAAAAAUAGAAGAUACUUGAGCAAGUAUCUUCUAUUUUUAUCU-9.714.501


Target Position: 341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
341CGAGAACACCGGCACAAAG77.4421360

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
570359CGAGAACACCGGCACAAAGCTTTGTGCCGGTGTTCTCG0.341200.060900.655200.750001.000001.00000


Target Position: 3177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3177UCCUUUUUAAAUGUGAAUU60.28392984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6573195TCCTTTTTAAATGTGAATTAATTCACATTTAAAAAGGA0.170600.110200.862100.750001.000001.00000


Target Position: 2293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2293GAAGGUAGUAGAGUCAAAG79.56481157

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9322311GAAGGTAGTAGAGTCAAAGCTTTGACTCTACTACCTTC0.081100.037100.534500.500001.000001.00000


Target Position: 1389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1389AGGAUAUAAUCAUCAACUG77.63621345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8511407AGGATATAATCATCAACTGCAGTTGATGATTATATCCT0.109900.083800.560300.500001.000001.00000


Target Position: 1798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1798AGAGUUGGAUGGUCAGGAA93.1247163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241816AGAGTTGGATGGTCAGGAATTCCTGACCATCCAACTCT0.247600.021500.551700.750001.000001.00000


Target Position: 3168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3168CUUGAGUGUUCCUUUUUAA92.7444178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8433186CTTGAGTGTTCCTTTTTAATTAAAAAGGAACACTCAAG0.301700.018100.603400.750001.000001.00000


Target Position: 3528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3528UUGUGUAAAAAAUGGAAAA75.53561555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7423546TTGTGTAAAAAATGGAAAATTTTCCATTTTTTACACAA0.304100.028000.646600.500001.000001.00000


Target Position: 845, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
845GAGGAACAGAAGUGGAAAU86.358554

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_384519GAGGAACAGAAGTGGAAAT1/1/0/097.75TOP1NM_003286.21NANANA20:39713189..39713207(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
684863GAGGAACAGAAGTGGAAATATTTCCACTTCTGTTCCTC0.159900.103400.801700.750001.000001.00000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845AGGACUCCAUCAGAUACUA88.7909388

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541863AGGACTCCATCAGATACTATAGTATCTGATGGAGTCCT0.230500.017400.672400.750001.000001.00000


Target Position: 886, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
886UGAAGGCAUCAAGUGGAAA78.93931227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
986904TGAAGGCATCAAGTGGAAATTTCCACTTGATGCCTTCA0.069000.030900.724100.750001.000001.00000


Target Position: 3407, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3407CUUGAAAGAUUUUAUUGUA94.853990

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3405-3427CACTTGAAAGATTTTATTGTATAUACAAUAAAAUCUUUCAAGUGCUUGAAAGAUUUUAUUGUAUAU6.912.202


Target Position: 3463, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3463GAGUAUUUGGUCCAAAAAA93.0774166

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3461-3483ATGAGTATTTGGTCCAAAAAAAGUUUUUUGGACCAAAUACUCAUGAGUAUUUGGUCCAAAAAAAGU11.54.602


Target Position: 900, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
900GGAAAUUCCUAGAACAUAA103.3125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
526918GGAAATTCCTAGAACATAATTATGTTCTAGGAATTTCC0.559700.057500.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
898-920GTGGAAATTCCTAGAACATAAAGUUAUGUUCUAGGAAUUUCCACGGAAAUUCCUAGAACAUAAAGU16.110.412


Target Position: 514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
514ACGAAAAGAGGAAAAGGUU74.11931716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
672532ACGAAAAGAGGAAAAGGTTAACCTTTTCCTCTTTTCGT0.626300.035300.629300.750001.000001.00000


Target Position: 1719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1719GCAAUGAAAAGGAGGAAGG61.60412888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9881737GCAATGAAAAGGAGGAAGGCCTTCCTCCTTTTCATTGC0.272000.176700.508600.500001.000001.00000


Target Position: 3473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3473UCCAAAAAAAGGAAAAAUA76.84921418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9213491TCCAAAAAAAGGAAAAATATATTTTTCCTTTTTTTGGA0.084400.050600.827600.750000.918500.62500


Target Position: 1113, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1113AUGAAGAGAAGAAUAUUAU81.04931025

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791131ATGAAGAGAAGAATATTATATAATATTCTTCTCTTCAT0.180300.132600.612100.500001.000001.00000


Target Position: 2472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2472AGAAGAUUUACAACAAAAC71.07412041

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7172490AGAAGATTTACAACAAAACGTTTTGTTGTAAATCTTCT0.226600.225000.577600.500001.000001.00000


Target Position: 684, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
684CUGAUUAUAAACCUAAGAA90.5363283

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
653702CTGATTATAAACCTAAGAATTCTTAGGTTTATAATCAG0.716400.316500.612100.750001.000001.00000


Target Position: 3272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3272AGGGAUGAAGGGCGAGUGA74.08751719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7863290AGGGATGAAGGGCGAGTGATCACTCGCCCTTCATCCCT0.389100.146400.620700.500001.000001.00000


Target Position: 1037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1037AUGCUCGACCAUGAAUAUA76.70081433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8991055ATGCTCGACCATGAATATATATATTCATGGTCGAGCAT0.143400.079500.612100.500001.000001.00000


Target Position: 1059, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1059CCAAGGAAAUAUUUAGGAA95.767971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7321077CCAAGGAAATATTTAGGAATTCCTAAATATTTCCTTGG0.143700.039200.672401.000001.000001.00000


Target Position: 3001, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3001GAAUUUAAAAUUAAGUAGA89.2226358

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2999-3021AGGAATTTAAAATTAAGTAGAACUCUACUUAAUUUUAAAUUCCUGAAUUUAAAAUUAAGUAGAACU11.3-9.701


Target Position: 3270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3270GGAGGGAUGAAGGGCGAGU69.11142235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5183288GGAGGGATGAAGGGCGAGTACTCGCCCTTCATCCCTCC0.387300.137500.663800.750001.000001.00000


Target Position: 1800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1800AGUUGGAUGGUCAGGAAUA88.9351377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7211818AGTTGGATGGTCAGGAATATATTCCTGACCATCCAACT0.338800.030500.663800.750001.000001.00000


Target Position: 405, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
405GUGAACAUAAAGAUUCUGA83.8805742

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
403-425CAGTGAACATAAAGATTCTGAAAUCAGAAUCUUUAUGUUCACUGGUGAACAUAAAGAUUCUGAAAU20.420.512


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182GAUGAACUUGCAAACUAAG79.66871148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422200GATGAACTTGCAAACTAAGCTTAGTTTGCAAGTTCATC0.239800.030800.543100.500001.000001.00000


Target Position: 1384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1384GCCCGAGGAUAUAAUCAUC78.28631281

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7231402GCCCGAGGATATAATCATCGATGATTATATCCTCGGGC0.366900.029800.819000.750000.972800.62500


Target Position: 2372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2372CGAGAGGAAAAUAAACAGA87.7245458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7512390CGAGAGGAAAATAAACAGATCTGTTTATTTTCCTCTCG0.469100.067700.569000.750001.000001.00000


Target Position: 2017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2017CCGUACAUACAAUGCCUCC64.33252656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8402035CCGTACATACAATGCCTCCGGAGGCATTGTATGTACGG0.178800.073800.543100.500000.978301.00000


Target Position: 343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
343AGAACACCGGCACAAAGAA85.7195612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
826361AGAACACCGGCACAAAGAATTCTTTGTGCCGGTGTTCT0.541200.099700.551700.750001.000001.00000


Target Position: 3129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3129CUGUUCACAGAAAAAGCAU77.32021372

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7063147CTGTTCACAGAAAAAGCATATGCTTTTTCTGTGAACAG0.290800.031900.629300.750001.000001.00000


Target Position: 2089, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2089AGCGAAGAUCCUUUCUUAU81.8114946

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7472107AGCGAAGATCCTTTCTTATATAAGAAAGGATCTTCGCT0.206600.027300.810300.750001.000001.00000


Target Position: 3695, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3695CAACUGUAGGUUAUUUAAA93.1302162

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3693-3715ATCAACTGTAGGTTATTTAAAATUUUAAAUAACCUACAGUUGAUCAACUGUAGGUUAUUUAAAAUU-7.519.002


Target Position: 3727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3727ACUUAAUGGAAAAAAAAAA83.8685745

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2333745ACTTAATGGAAAAAAAAAATTTTTTTTTTCCATTAAGT0.978500.795700.706900.750001.000001.00000


Target Position: 389, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
389UCCAAGCAUAGCAACAGUG59.31833060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
993407TCCAAGCATAGCAACAGTGCACTGTTGCTATGCTTGGA0.427600.364200.577600.500001.000001.00000


Target Position: 2747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2747UAUUUCAGAUAUCAAAAUU77.39981363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8702765TATTTCAGATATCAAAATTAATTTTGATATCTGAAATA0.154700.062400.534500.500001.000001.00000


Target Position: 2944, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2944CUUCUAUAUUUUAAUAGAA97.428148

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2942-2964AACTTCTATATTTTAATAGAAATUUCUAUUAAAAUAUAGAAGUUCUUCUAUAUUUUAAUAGAAAUU8.48.402


Target Position: 804, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
804UUCCUGAGCCAGAUAACAA81.7248955

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
920822TTCCTGAGCCAGATAACAATTGTTATCTGGCTCAGGAA0.460400.150500.525900.500000.983700.87500


Target Position: 2178, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2178CUAUGAUGAACUUGCAAAC73.55431786

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922196CTATGATGAACTTGCAAACGTTTGCAAGTTCATCATAG0.067800.029500.525900.500001.000001.00000


Target Position: 3217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3217UAAAAUAUUUAAACCUUUU75.41471570

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823235TAAAATATTTAAACCTTTTAAAAGGTTTAAATATTTTA0.148800.041800.534500.500001.000001.00000


Target Position: 422, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
422GAAAAGAAACACAAAGAGA93.2593155

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
420-442CTGAAAAGAAACACAAAGAGAAGUCUCUUUGUGUUUCUUUUCAGGAAAAGAAACACAAAGAGAAGU16.65.511


Target Position: 589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
589ACCACAAAUUAAAGAUGAA89.8267319

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
362607ACCACAAATTAAAGATGAATTCATCTTTAATTTGTGGT0.387300.283700.681000.750001.000001.00000


Target Position: 3071, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3071AUCAAUUUUCAUUAAACUU72.55711880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8453089ATCAATTTTCATTAAACTTAAGTTTAATGAAAATTGAT0.191000.102400.543100.500000.972800.62500


Target Position: 738, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
738GAAAACUAGAAGAAGAAGA85.4178639

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
736-758AAGAAAACTAGAAGAAGAAGAGGUCUUCUUCUUCUAGUUUUCUUGAAAACUAGAAGAAGAAGAGGU19.14.912


Target Position: 2643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2643GAGGCAGCAAGUCUUAACA89.3494346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682661GAGGCAGCAAGTCTTAACATGTTAAGACTTGCTGCCTC0.511500.016100.603400.500001.000001.00000


Target Position: 1158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1158CCCAGAUGAGCCAGUAUUU81.7484951

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6951176CCCAGATGAGCCAGTATTTAAATACTGGCTCATCTGGG0.496900.033300.991401.000000.983700.62500


Target Position: 2086, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2086CCCAGCGAAGAUCCUUUCU64.84682615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9402104CCCAGCGAAGATCCTTTCTAGAAAGGATCTTCGCTGGG0.091900.011700.767200.750001.000001.00000


Target Position: 1244, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1244GAAAAAUUACUGAAAGAAU91.7439228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6191262GAAAAATTACTGAAAGAATATTCTTTCAGTAATTTTTC0.459200.336300.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1242-1264ATGAAAAATTACTGAAAGAATATAUUCUUUCAGUAAUUUUUCAUGAAAAAUUACUGAAAGAAUAUU14.8-12.011


Target Position: 2019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2019GUACAUACAAUGCCUCCAU82.3615897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9492037GTACATACAATGCCTCCATATGGAGGCATTGTATGTAC0.187000.113500.525900.750000.978300.75000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846GGACUCCAUCAGAUACUAU94.918188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191864GGACTCCATCAGATACTATATAGTATCTGATGGAGTCC0.311500.020000.827601.000001.000001.00000


Target Position: 676, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
676GGAUGAUGCUGAUUAUAAA111.71

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_167619GGATGATGCTGATTATAAA1/1/0/0100.00TOP1NM_003286.21NANANA20:39708815,39709805..39708820,39709817(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
437694GGATGATGCTGATTATAAATTTATAATCAGCATCATCC0.357400.077400.870701.000001.000001.00000


Target Position: 3331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3331CCCAUCAUCCUUUGUUCUG61.81682869

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4693349CCCATCATCCTTTGTTCTGCAGAACAAAGGATGATGGG0.426500.323400.706900.750001.000001.00000


Target Position: 3201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3201UUCUUUUUAAUUAUUUUAA72.09541925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8083219TTCTTTTTAATTATTTTAATTAAAATAATTAAAAAGAA0.156300.082000.637900.500001.000001.00000


Target Position: 2296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2296GGUAGUAGAGUCAAAGAAG85.5408627

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8142314GGTAGTAGAGTCAAAGAAGCTTCTTTGACTCTACTACC0.113700.053000.715500.750001.000001.00000


Target Position: 3395, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3395CCUAAUCUUUCACUUGAAA89.5319337

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3393-3415ACCCTAATCTTTCACTTGAAAGAUUUCAAGUGAAAGAUUAGGGUCCUAAUCUUUCACUUGAAAGAU19.211.602


Target Position: 1023, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1023CGUUCUUUGCAAAAAUGCU80.39071081

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1021-1043TACGTTCTTTGCAAAAATGCTCGAGCAUUUUUGCAAAGAACGUACGUUCUUUGCAAAAAUGCUCGU14.013.322


Target Position: 1295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1295AGGAUUGCUAACUUCAAGA80.95831032

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7301313AGGATTGCTAACTTCAAGATCTTGAAGTTAGCAATCCT0.268100.028900.620700.500001.000001.00000


Target Position: 436, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
436AGAGAAGGAGAAGACCAAA88.4123424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761454AGAGAAGGAGAAGACCAAATTTGGTCTTCTCCTTCTCT0.131000.101400.724100.750000.962000.87500


Target Position: 3124, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3124GACACCUGUUCACAGAAAA92.1852201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9563142GACACCTGTTCACAGAAAATTTTCTGTGAACAGGTGTC0.210300.011000.819000.750000.929300.87500


Target Position: 783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
783AUAAAGAUAAAGAUAAAAA88.2458435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
841801ATAAAGATAAAGATAAAAATTTTTATCTTTATCTTTAT0.891100.859700.543100.500001.000001.00000


Target Position: 742, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
742ACUAGAAGAAGAAGAGGAU81.4849984

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
918760ACTAGAAGAAGAAGAGGATATCCTCTTCTTCTTCTAGT0.526600.470800.525900.750001.000001.00000


Target Position: 291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291CGGAUUUCCGAUUGAAUGA81.6383971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
796309CGGATTTCCGATTGAATGATCATTCAATCGGAAATCCG0.245900.022000.689700.750000.907600.62500


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044ACCAUGAAUAUACUACCAA83.4705787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6621062ACCATGAATATACTACCAATTGGTAGTATATTCATGGT0.233200.036500.706900.750001.000001.00000


Target Position: 3578, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3578CAUUUUUUGCUAUAAUCAU87.0812501

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3576-3598GACATTTTTTGCTATAATCATTAAUGAUUAUAGCAAAAAAUGUCCAUUUUUUGCUAUAAUCAUUAU8.7-12.012


Target Position: 2102, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2102UCUUAUAACCGUGCCAAUC55.84923269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9022120TCTTATAACCGTGCCAATCGATTGGCACGGTTATAAGA0.109300.034300.543100.500001.000001.00000


Target Position: 3649, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3649UCUUUCCUCAAGUAUCUUC58.51153114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8023667TCTTTCCTCAAGTATCTTCGAAGATACTTGAGGAAAGA0.511400.439800.551700.500001.000001.00000


Target Position: 3163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3163CCUGACUUGAGUGUUCCUU68.62762275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9333181CCTGACTTGAGTGTTCCTTAAGGAACACTCAAGTCAGG0.090100.012000.706901.000001.000001.00000


Target Position: 388, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
388GUCCAAGCAUAGCAACAGU80.62481057

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
998406GTCCAAGCATAGCAACAGTACTGTTGCTATGCTTGGAC0.437700.132700.612100.500001.000001.00000


Target Position: 348, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
348ACCGGCACAAAGAACACAA78.72871245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
238366ACCGGCACAAAGAACACAATTGTGTTCTTTGTGCCGGT0.823500.238200.706900.750001.000001.00000


Target Position: 1094, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1094UGGAGAAAGGAAAUGACUA85.8073602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521112TGGAGAAAGGAAATGACTATAGTCATTTCCTTTCTCCA0.346100.051500.672400.750001.000001.00000


Target Position: 2947, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947CUAUAUUUUAAUAGAAAUA93.0309169

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2945-2967TTCTATATTTTAATAGAAATAAAUAUUUCUAUUAAAAUAUAGAACUAUAUUUUAAUAGAAAUAAAU6.9-8.002


Target Position: 812, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
812CCAGAUAACAAGAAAAAGA88.3043431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
597830CCAGATAACAAGAAAAAGATCTTTTTCTTGTTATCTGG0.890400.424600.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
810-832AGCCAGATAACAAGAAAAAGAAGUCUUUUUCUUGUUAUCUGGCUCCAGAUAACAAGAAAAAGAAGU5.513.422


Target Position: 809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
809GAGCCAGAUAACAAGAAAA98.514234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
252827GAGCCAGATAACAAGAAAATTTTCTTGTTATCTGGCTC0.710000.346300.810300.750001.000001.00000


Target Position: 508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
508GGAAAAACGAAAAGAGGAA90.0356309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563526GGAAAAACGAAAAGAGGAATTCCTCTTTTCGTTTTTCC0.222500.154000.698301.000001.000001.00000


Target Position: 2353, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2353GGAAGUUCAAGCCACAGAC75.55651553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8962371GGAAGTTCAAGCCACAGACGTCTGTGGCTTGAACTTCC0.090500.046300.551700.750001.000001.00000


Target Position: 2269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2269GGUCAUGAAGGAUGCAAAG77.15611391

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6142287GGTCATGAAGGATGCAAAGCTTTGCATCCTTCATGACC0.199900.058200.715500.750001.000001.00000


Target Position: 3538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3538AAUGGAAAAAAACAUAAAA86.4617540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9873556AATGGAAAAAAACATAAAATTTTATGTTTTTTTCCATT0.325400.071900.508600.500001.000001.00000


Target Position: 1960, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1960UGGUAUUCUGAAUAAGCAU79.19261203

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8521978TGGTATTCTGAATAAGCATATGCTTATTCAGAATACCA0.102400.017900.689700.750001.000001.00000


Target Position: 407, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
407GAACAUAAAGAUUCUGAAA98.477936

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
405-427GTGAACATAAAGATTCTGAAAAGUUUCAGAAUCUUUAUGUUCACGAACAUAAAGAUUCUGAAAAGU20.46.922


Target Position: 685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
685UGAUUAUAAACCUAAGAAA90.1823301

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
308703TGATTATAAACCTAAGAAATTTCTTAGGTTTATAATCA0.704100.324900.724100.750001.000001.00000


Target Position: 820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
820CAAGAAAAAGAAGCCGAAG68.44832299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
983838CAAGAAAAAGAAGCCGAAGCTTCGGCTTCTTTTTCTTG0.409400.381900.508600.500001.000001.00000


Target Position: 1217, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1217GAGAAACUGAAAAUCAAAG76.6761439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661235GAGAAACTGAAAATCAAAGCTTTGATTTTCAGTTTCTC0.448300.309600.672400.500001.000001.00000


Target Position: 3413, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3413AGAUUUUAUUGUAUAAAAA96.598457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7003431AGATTTTATTGTATAAAAATTTTTATACAATAAAATCT0.430000.032500.724100.750001.000001.00000


Target Position: 3171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3171GAGUGUUCCUUUUUAAAUG80.44291073

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6913189GAGTGTTCCTTTTTAAATGCATTTAAAAAGGAACACTC0.284400.039500.655200.500001.000001.00000


Target Position: 3123, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3123AGACACCUGUUCACAGAAA89.0327371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753141AGACACCTGTTCACAGAAATTTCTGTGAACAGGTGTCT0.185400.009700.724100.750000.929300.75000


Target Position: 3726, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3726AACUUAAUGGAAAAAAAAA86.3426556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9193744AACTTAATGGAAAAAAAAATTTTTTTTTCCATTAAGTT0.949500.789100.646600.500001.000001.00000


Target Position: 1927, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1927GCCCGAGGAUGAUCUUUUU84.0175729

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2192719GCCCGAGGATGATCTTTTT1/1/0/0100.00TOP1NM_003286.21NANANA20:39744049..39744067(+)00TOP1(0.002)


Target Position: 3271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3271GAGGGAUGAAGGGCGAGUG68.24952321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9553289GAGGGATGAAGGGCGAGTGCACTCGCCCTTCATCCCTC0.385300.155100.517200.500001.000001.00000


Target Position: 3375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3375UCCAUCUUUUUCUUUUUAA74.80771650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2583393TCCATCTTTTTCTTTTTAATTAAAAAGAAAAAGATGGA0.670400.177700.836200.750001.000001.00000


Target Position: 3531, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3531UGUAAAAAAUGGAAAAAAA88.6666400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5623549TGTAAAAAATGGAAAAAAATTTTTTTCCATTTTTTACA0.382300.050400.706900.750001.000001.00000


Target Position: 3594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3594CAUUAGUUUUAGAGGCAUU87.9264449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603612CATTAGTTTTAGAGGCATTAATGCCTCTAAAACTAATG0.073900.070100.646600.750001.000001.00000


Target Position: 724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
724GAAGGAGAAGAAAAGAAAA98.132139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
379742GAAGGAGAAGAAAAGAAAATTTTCTTTTCTTCTCCTTC0.759100.330900.672400.750001.000001.00000


Target Position: 3291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3291AUCUAAGGAUAAUGAAAUA91.8672220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9373309ATCTAAGGATAATGAAATATATTTCATTATCCTTAGAT0.229300.023700.637900.500001.000001.00000


Target Position: 586, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
586UCCACCACAAAUUAAAGAU66.8982439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
393604TCCACCACAAATTAAAGATATCTTTAATTTGTGGTGGA0.401200.309600.689700.750001.000001.00000


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623GGAACCAGUAUCGAGAAGA83.063823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091641GGAACCAGTATCGAGAAGATCTTCTCGATACTGGTTCC0.086600.018000.646600.750001.000001.00000


Target Position: 1803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1803UGGAUGGUCAGGAAUAUGU69.09482237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7791821TGGATGGTCAGGAATATGTACATATTCCTGACCATCCA0.126100.025400.637900.500001.000001.00000


Target Position: 777, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
777CCAAGAAUAAAGAUAAAGA92.2691196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
617795CCAAGAATAAAGATAAAGATCTTTATCTTTATTCTTGG0.877800.562200.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
775-797ACCCAAGAATAAAGATAAAGATAUCUUUAUCUUUAUUCUUGGGUCCAAGAAUAAAGAUAAAGAUAU6.912.012


Target Position: 1049, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1049GAAUAUACUACCAAGGAAA98.884930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8491067GAATATACTACCAAGGAAATTTCCTTGGTAGTATATTC0.103500.041800.672400.750001.000001.00000


Target Position: 1809, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1809GUCAGGAAUAUGUGGUAGA84.0483726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8591827GTCAGGAATATGTGGTAGATCTACCACATATTCCTGAC0.099600.018600.594800.500001.000001.00000


Target Position: 958, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
958GAAUGUCAAGUUUUAUUAU93.4353146

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
956-978GAGAATGTCAAGTTTTATTATGAAUAAUAAAACUUGACAUUCUCGAAUGUCAAGUUUUAUUAUGAU-7.520.522


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412UAAAGAUUCUGAAAAGAAA90.3048296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
869430TAAAGATTCTGAAAAGAAATTTCTTTTCAGAATCTTTA0.179900.029200.534500.500000.989100.62500


Target Position: 1506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1506ACAUCCAAGGUUCCAUUAA79.88171127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211524ACATCCAAGGTTCCATTAATTAATGGAACCTTGGATGT0.352000.058200.672400.750001.000001.00000


Target Position: 1161, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1161AGAUGAGCCAGUAUUUCAA93.5242142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7191179AGATGAGCCAGTATTTCAATTGAAATACTGGCTCATCT0.519400.043600.577600.750001.000001.00000


Target Position: 768, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
768UGAAAAAACCCAAGAAUAA85.2791651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
547786TGAAAAAACCCAAGAATAATTATTCTTGGGTTTTTTCA0.532800.250000.689700.750001.000001.00000


Target Position: 2152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2152GGCACCACCAAAAACUUUU74.75581654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9062170GGCACCACCAAAAACTTTTAAAAGTTTTTGGTGGTGCC0.088200.072501.000001.000001.000001.00000


Target Position: 2978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2978CCCUUCCCUCUCUCCCAUU69.03582244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2472996CCCTTCCCTCTCTCCCATTAATGGGAGAGAGGGAAGGG0.519500.480700.982801.000001.000001.00000


Target Position: 3593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3593UCAUUAGUUUUAGAGGCAU71.75781967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9333611TCATTAGTTTTAGAGGCATATGCCTCTAAAACTAATGA0.080800.079900.569000.750001.000001.00000


Target Position: 1593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1593GGCGGCUGAAAAAAUGUGU69.90662155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4981611GGCGGCTGAAAAAATGTGTACACATTTTTTCAGCCGCC0.300200.066000.793100.750001.000001.00000


Target Position: 2781, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2781GUUUUGAAUUUUGUUUUUA83.7294760

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2779-2801TTGTTTTGAATTTTGTTTTTATTUAAAAACAAAAUUCAAAACAAGUUUUGAAUUUUGUUUUUAUUU5.67.700


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822AGAAAAAGAAGCCGAAGAA86.4832538

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822840AGAAAAAGAAGCCGAAGAATTCTTCGGCTTCTTTTTCT0.400600.379400.551700.750001.000001.00000


Target Position: 3654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3654CCUCAAGUAUCUUCUAUUU88.5021414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2113672CCTCAAGTATCTTCTATTTAAATAGAAGATACTTGAGG0.567600.409900.844801.000001.000001.00000


Target Position: 1515, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515GUUCCAUUAAAUACAUCAU85.3382643

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1513-1535AGGTTCCATTAAATACATCATGCAUGAUGUAUUUAAUGGAACCUGUUCCAUUAAAUACAUCAUGCU21.520.122


Target Position: 2046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2046AGCAGCAGCUAAAAGAACU75.91431516

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382064AGCAGCAGCTAAAAGAACTAGTTCTTTTAGCTGCTGCT0.404900.018400.646600.500000.907600.62500


Target Position: 2366, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2366ACAGACCGAGAGGAAAAUA79.21151201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7982384ACAGACCGAGAGGAAAATATATTTTCCTCTCGGTCTGT0.119900.055600.663800.750001.000001.00000


Target Position: 2993, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2993CAUUUCAGGAAUUUAAAAU81.736954

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2991-3013CCCATTTCAGGAATTTAAAATTAAUUUUAAAUUCCUGAAAUGGGCAUUUCAGGAAUUUAAAAUUAU-9.112.002


Target Position: 2655, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2655CUUAACAAACCAACAUCUU74.61121670

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2653-2675GTCTTAACAAACCAACATCTTTGAAGAUGUUGGUUUGUUAAGACCUUAACAAACCAACAUCUUUGU19.27.202


Target Position: 847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
847GGAACAGAAGUGGAAAUGG69.53082196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
930865GGAACAGAAGTGGAAATGGCCATTTCCACTTCTGTTCC0.121300.108300.525900.500001.000001.00000


Target Position: 858, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
858GGAAAUGGUGGGAAGAAGA87.8486456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
573876GGAAATGGTGGGAAGAAGATCTTCTTCCCACCATTTCC0.798800.047700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
856-878GTGGAAATGGTGGGAAGAAGAGCUCUUCUUCCCACCAUUUCCACGGAAAUGGUGGGAAGAAGAGCU19.120.122


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776CCCAAGAAUAAAGAUAAAG66.61072466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
640794CCCAAGAATAAAGATAAAGCTTTATCTTTATTCTTGGG0.878100.471300.853400.750001.000001.00000


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675GCGAAAAGAUAAACCUGGA87.6793461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9892693GCGAAAAGATAAACCTGGATCCAGGTTTATCTTTTCGC0.106300.008900.551700.750001.000001.00000


Target Position: 2398, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2398GGGAACCUCCAAACUCAAU80.10821103

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6702416GGGAACCTCCAAACTCAATATTGAGTTTGGAGGTTCCC0.660300.035800.982801.000000.967400.62500


Target Position: 727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727GGAGAAGAAAAGAAAACUA98.984229

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
285745GGAGAAGAAAAGAAAACTATAGTTTTCTTTTCTTCTCC0.631900.621000.698301.000001.000001.00000


Target Position: 3722, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3722CUACAACUUAAUGGAAAAA83.8017755

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3720-3742TCCTACAACTTAATGGAAAAAAAUUUUUCCAUUAAGUUGUAGGACUACAACUUAAUGGAAAAAAAU20.119.0


Target Position: 819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
819ACAAGAAAAAGAAGCCGAA82.9074841

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
880837ACAAGAAAAAGAAGCCGAATTCGGCTTCTTTTTCTTGT0.416100.388600.534500.750001.000001.00000


Target Position: 3274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3274GGAUGAAGGGCGAGUGAAU90.9801260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7023292GGATGAAGGGCGAGTGAATATTCACTCGCCCTTCATCC0.153300.086200.862101.000001.000001.00000


Target Position: 2090, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2090GCGAAGAUCCUUUCUUAUA91.3363245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052108GCGAAGATCCTTTCTTATATATAAGAAAGGATCTTCGC0.218300.032200.879301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2088-2110CAGCGAAGATCCTTTCTTATAACUAUAAGAAAGGAUCUUCGCUGGCGAAGAUCCUUUCUUAUAACU6.921.002


Target Position: 2367, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2367CAGACCGAGAGGAAAAUAA89.1085366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7242385CAGACCGAGAGGAAAATAATTATTTTCCTCTCGGTCTG0.146200.058900.750000.750001.000001.00000


Target Position: 3292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3292UCUAAGGAUAAUGAAAUAA77.81851322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5913310TCTAAGGATAATGAAATAATTATTTCATTATCCTTAGA0.209500.098000.689700.750001.000001.00000


Target Position: 3277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3277UGAAGGGCGAGUGAAUCUA75.40441572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8233295TGAAGGGCGAGTGAATCTATAGATTCACTCGCCCTTCA0.165600.086200.551700.750001.000001.00000


Target Position: 925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
925AGUAUUUGCCCCACCAUAU79.4751175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
512943AGTATTTGCCCCACCATATATATGGTGGGGCAAATACT0.259000.117300.663800.750001.000001.00000


Target Position: 1234, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1234AGAGGAGAAUGAAAAAUUA98.014143

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5431252AGAGGAGAATGAAAAATTATAATTTTTCATTCTCCTCT0.587700.365500.689700.750001.000001.00000


Target Position: 2401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2401AACCUCCAAACUCAAUUAU69.39662208

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9722419AACCTCCAAACTCAATTATATAATTGAGTTTGGAGGTT0.574300.024600.603400.500001.000001.00000


Target Position: 2270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2270GUCAUGAAGGAUGCAAAGA76.55731449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8472288GTCATGAAGGATGCAAAGATCTTTGCATCCTTCATGAC0.163900.070700.594800.500001.000001.00000


Target Position: 3169, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3169UUGAGUGUUCCUUUUUAAA76.87271414

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7743187TTGAGTGTTCCTTTTTAAATTTAAAAAGGAACACTCAA0.591500.034300.646600.500001.000001.00000


Target Position: 3362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3362ACCCUUUAAGAUAUCCAUC63.10432770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8913380ACCCTTTAAGATATCCATCGATGGATATCTTAAAGGGT0.228900.070300.672400.500001.000001.00000


Target Position: 2470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2470UGAGAAGAUUUACAACAAA90.5082286

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6102488TGAGAAGATTTACAACAAATTTGTTGTAAATCTTCTCA0.690200.523400.724100.750001.000001.00000


Target Position: 2149, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2149GAGGGCACCACCAAAAACU75.62371544

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772167GAGGGCACCACCAAAAACTAGTTTTTGGTGGTGCCCTC0.174000.009500.603400.500000.962000.87500


Target Position: 2116, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2116CAAUCGAGCUGUUGCAAUU89.6095333

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2114-2136GCCAATCGAGCTGTTGCAATTCTAAUUGCAACAGCUCGAUUGGCCAAUCGAGCUGUUGCAAUUCUU20.021.003


Target Position: 838, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
838GAAAGAAGAGGAACAGAAG82.9515837

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
875856GAAAGAAGAGGAACAGAAGCTTCTGTTCCTCTTCTTTC0.659900.360100.534500.500001.000001.00000


Target Position: 3363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3363CCCUUUAAGAUAUCCAUCU75.81171530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5183381CCCTTTAAGATATCCATCTAGATGGATATCTTAAAGGG0.250100.064200.767200.750001.000001.00000


Target Position: 1813, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1813GGAAUAUGUGGUAGAGUUU89.3916344

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1811-1833CAGGAATATGTGGTAGAGTTTGAAAACUCUACCACAUAUUCCUGGGAAUAUGUGGUAGAGUUUGAU18.98.722


Target Position: 2916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2916CGUUUUUACAGUUAGGGUU79.14541209

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942934CGTTTTTACAGTTAGGGTTAACCCTAACTGTAAAAACG0.067100.016500.629301.000001.000001.00000


Target Position: 643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
643GGAUAUAAAGCCAUUAAAG84.6176688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
637661GGATATAAAGCCATTAAAGCTTTAATGGCTTTATATCC0.178300.074100.732800.750001.000001.00000


Target Position: 3674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3674UAUCAUGAAUUCCCUUUUA82.8789844

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9863692TATCATGAATTCCCTTTTATAAAAGGGAATTCATGATA0.452800.271600.508600.500001.000001.00000


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563AGAAGGACUGGCAGAAAUA90.9813259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9911581AGAAGGACTGGCAGAAATATATTTCTGCCAGTCCTTCT0.175600.008700.681000.750001.000001.00000


Target Position: 787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
787AGAUAAAGAUAAAAAAGUU92.1231205

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
734805AGATAAAGATAAAAAAGTTAACTTTTTTATCTTTATCT0.356400.332400.577600.750001.000001.00000


Target Position: 2277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2277AGGAUGCAAAGACGAAGAA81.11471020

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5352295AGGATGCAAAGACGAAGAATTCTTCGTCTTTGCATCCT0.239800.117900.672400.750001.000001.00000


Target Position: 3631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3631CAGAGUCCAUUUCCCACAU82.5968870

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813649CAGAGTCCATTTCCCACATATGTGGGAAATGGACTCTG0.222000.058600.629300.750001.000001.00000


Target Position: 601, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
601AGAUGAACCUGAAGAUGAU93.4297147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
974619AGATGAACCTGAAGATGATATCATCTTCAGGTTCATCT0.071900.025000.543100.750001.000001.00000


Target Position: 3645, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3645CACAUCUUUCCUCAAGUAU79.33551191

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2953663CACATCTTTCCTCAAGTATATACTTGAGGAAAGATGTG0.577800.230600.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3643-3665CCCACATCTTTCCTCAAGTATCTAUACUUGAGGAAAGAUGUGGGCACAUCUUUCCUCAAGUAUCUU20.319.202


Target Position: 2594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2594GGGAAAGAUGGAUAAACUG78.75441244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6412612GGGAAAGATGGATAAACTGCAGTTTATCCATCTTTCCC0.176800.087600.706900.750001.000001.00000


Target Position: 3655, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3655CUCAAGUAUCUUCUAUUUU79.00421218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4613673CTCAAGTATCTTCTATTTTAAAATAGAAGATACTTGAG0.567200.420200.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3653-3675TCCTCAAGTATCTTCTATTTTTAAAAAUAGAAGAUACUUGAGGACUCAAGUAUCUUCUAUUUUUAU6.920.302


Target Position: 3203, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3203CUUUUUAAUUAUUUUAAAA92.0295212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6423221CTTTTTAATTATTTTAAAATTTTAAAATAATTAAAAAG0.176700.075000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3201-3223TTCTTTTTAATTATTTTAAAATAUUUUAAAAUAAUUAAAAAGAACUUUUUAAUUAUUUUAAAAUAU-9.1-9.102


Target Position: 683, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
683GCUGAUUAUAAACCUAAGA83.8626746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
595701GCTGATTATAAACCTAAGATCTTAGGTTTATAATCAGC0.718000.285300.629300.750001.000001.00000


Target Position: 3660, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3660GUAUCUUCUAUUUUUAUCA90.6101281

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3658-3680AAGTATCTTCTATTTTTATCATGUGAUAAAAAUAGAAGAUACUUGUAUCUUCUAUUUUUAUCAUGU2.116.002


Target Position: 319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
319ACACAAAGAUAAACACAAA95.785670

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
232337ACACAAAGATAAACACAAATTTGTGTTTATCTTTGTGT0.962700.851500.706900.750001.000001.00000


Target Position: 1896, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1896AGAACCUACAACUAUUUAU82.9972835

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3471914AGAACCTACAACTATTTATATAAATAGTTGTAGGTTCT0.403700.152800.681000.750001.000001.00000


Target Position: 3179, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3179CUUUUUAAAUGUGAAUUUU77.35231368

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6783197CTTTTTAAATGTGAATTTTAAAATTCACATTTAAAAAG0.162700.090600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3177-3199TCCTTTTTAAATGTGAATTTTTAAAAAUUCACAUUUAAAAAGGACUUUUUAAAUGUGAAUUUUUAU7.4-9.101


Target Position: 1514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1514GGUUCCAUUAAAUACAUCA92.5756185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5871532GGTTCCATTAAATACATCATGATGTATTTAATGGAACC0.680900.222900.629300.750001.000001.00000


Target Position: 691, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
691UAAACCUAAGAAAAUUAAA79.78341139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
981709TAAACCTAAGAAAATTAAATTTAATTTTCTTAGGTTTA0.828400.592800.534500.500001.000001.00000


Target Position: 3731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3731AAUGGAAAAAAAAAAAAAA84.222719

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9823749AATGGAAAAAAAAAAAAAATTTTTTTTTTTTTTCCATT0.991500.816800.508600.500001.000001.00000


Target Position: 2682, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2682GAUAAACCUGGAGAUAUUA94.1635110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4652700GATAAACCTGGAGATATTATAATATCTCCAGGTTTATC0.733000.086800.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2680-2702AAGATAAACCTGGAGATATTATAUAAUAUCUCCAGGUUUAUCUUGAUAAACCUGGAGAUAUUAUAU6.613.912


Target Position: 279, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
279CCCAGAUCGAAGCGGAUUU70.83572071

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_927919CCCAGATCGAAGCGGATTT1/1/0/094.96TOP1NM_003286.21NANANANA00TOP1(0.002)


Target Position: 3519, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3519CUUUUGUAAUUGUGUAAAA91.1533253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6123537CTTTTGTAATTGTGTAAAATTTTACACAATTACAAAAG0.215300.116000.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3517-3539TTCTTTTGTAATTGTGTAAAAAAUUUUACACAAUUACAAAAGAACUUUUGUAAUUGUGUAAAAAAU14.77.202


Target Position: 2757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2757AUCAAAAUUCUAGCUGUAU72.13361921

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7482775ATCAAAATTCTAGCTGTATATACAGCTAGAATTTTGAT0.217400.027200.637900.500001.000001.00000


Target Position: 438, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
438AGAAGGAGAAGACCAAACA84.2756716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958456AGAAGGAGAAGACCAAACATGTTTGGTCTTCTCCTTCT0.123700.093000.517200.500000.962001.00000


Target Position: 3374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3374AUCCAUCUUUUUCUUUUUA77.81021324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9073392ATCCATCTTTTTCTTTTTATAAAAAGAAAAAGATGGAT0.711300.175200.646600.500001.000001.00000


Target Position: 1952, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1952CUCAAUACUGGUAUUCUGA84.4056705

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1950-1972GACTCAATACTGGTATTCTGAATUCAGAAUACCAGUAUUGAGUCCUCAAUACUGGUAUUCUGAAUU13.416.103


Target Position: 2400, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2400GAACCUCCAAACUCAAUUA95.636876

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6372418GAACCTCCAAACTCAATTATAATTGAGTTTGGAGGTTC0.703200.039000.637900.750001.000001.00000


Target Position: 538, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
538CUCUGGGGAUGCAAAAAUA92.2357198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
458556CTCTGGGGATGCAAAAATATATTTTTGCATCCCCAGAG0.747300.124200.767200.750001.000001.00000


Target Position: 723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
723AGAAGGAGAAGAAAAGAAA90.6776277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
288741AGAAGGAGAAGAAAAGAAATTTCTTTTCTTCTCCTTCT0.950000.404100.724100.750001.000001.00000


Target Position: 2734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2734ACUUAUUUAAAAAUAUUUC65.28472578

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132752ACTTATTTAAAAATATTTCGAAATATTTTTAAATAAGT0.446800.316200.534500.500001.000001.00000


Target Position: 548, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
548GCAAAAAUAAAGAAGGAGA86.1832567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710566GCAAAAATAAAGAAGGAGATCTCCTTCTTTATTTTTGC0.151800.164800.629300.750001.000001.00000


Target Position: 3456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3456GGAAAAUGAGUAUUUGGUC76.44061464

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593474GGAAAATGAGTATTTGGTCGACCAAATACTCATTTTCC0.080500.010700.551700.750001.000001.00000


Target Position: 3190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3190UGAAUUUUUAUUUCUUUUU66.722459

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8653208TGAATTTTTATTTCTTTTTAAAAAGAAATAAAAATTCA0.098100.037800.724100.750001.000001.00000


Target Position: 3371, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3371GAUAUCCAUCUUUUUCUUU81.7015959

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3713389GATATCCATCTTTTTCTTTAAAGAAAAAGATGGATATC0.382100.149800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3369-3391AAGATATCCATCTTTTTCTTTTTAAAGAAAAAGAUGGAUAUCUUGAUAUCCAUCUUUUUCUUUUUU5.521.202


Target Position: 390, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
390CCAAGCAUAGCAACAGUGA81.5968974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
603408CCAAGCATAGCAACAGTGATCACTGTTGCTATGCTTGG0.591200.363500.620700.750001.000001.00000


Target Position: 1041, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1041UCGACCAUGAAUAUACUAC61.30722909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441059TCGACCATGAATATACTACGTAGTATATTCATGGTCGA0.202500.075100.612100.500001.000001.00000


Target Position: 3573, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3573GAAGACAUUUUUUGCUAUA93.4789144

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3571-3593GTGAAGACATTTTTTGCTATAATUAUAGCAAAAAAUGUCUUCACGAAGACAUUUUUUGCUAUAAUU19.719.202


Target Position: 3700, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3700GUAGGUUAUUUAAAAUAAA97.305949

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3698-3720CTGTAGGTTATTTAAAATAAATTUUUAUUUUAAAUAACCUACAGGUAGGUUAUUUAAAAUAAAUUU-9.719.802


Target Position: 3167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3167ACUUGAGUGUUCCUUUUUA88.9482376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8743185ACTTGAGTGTTCCTTTTTATAAAAAGGAACACTCAAGT0.187500.015700.672400.750001.000001.00000


Target Position: 2268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2268AGGUCAUGAAGGAUGCAAA93.1763159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5612286AGGTCATGAAGGATGCAAATTTGCATCCTTCATGACCT0.302400.050400.844800.750001.000001.00000


Target Position: 470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
470UCAGAAAAGCAUAAAGACA82.0937923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
967488TCAGAAAAGCATAAAGACATGTCTTTATGCTTTTCTGA0.930500.441100.517200.500001.000001.00000


Target Position: 3646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3646ACAUCUUUCCUCAAGUAUC70.88662066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9163664ACATCTTTCCTCAAGTATCGATACTTGAGGAAAGATGT0.584800.272900.525900.500001.000001.00000


Target Position: 293, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
293GAUUUCCGAUUGAAUGAUU84.9609666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
844311GATTTCCGATTGAATGATTAATCATTCAATCGGAAATC0.105300.018100.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
291-313CGGATTTCCGATTGAATGATTCTAAUCAUUCAAUCGGAAAUCCGGAUUUCCGAUUGAAUGAUUCUU16.220.721


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754AGAGGAUGGUAAAUUGAAA96.148365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
402772AGAGGATGGTAAATTGAAATTTCAATTTACCATCCTCT0.758600.185800.724100.750001.000001.00000


Target Position: 3461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3461AUGAGUAUUUGGUCCAAAA88.7002398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9823479ATGAGTATTTGGTCCAAAATTTTGGACCAAATACTCAT0.104200.020700.655200.500001.000001.00000


Target Position: 2264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2264GCCAAGGUCAUGAAGGAUG66.08032506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5812282GCCAAGGTCATGAAGGATGCATCCTTCATGACCTTGGC0.331500.046500.844800.750001.000001.00000


Target Position: 3269, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3269GGGAGGGAUGAAGGGCGAG61.65442884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5663287GGGAGGGATGAAGGGCGAGCTCGCCCTTCATCCCTCCC0.413400.142900.681000.750001.000001.00000


Target Position: 1235, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1235GAGGAGAAUGAAAAAUUAC79.23311200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8731253GAGGAGAATGAAAAATTACGTAATTTTTCATTCTCCTC0.550400.368100.629300.500001.000001.00000


Target Position: 3586, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3586GCUAUAAUCAUUAGUUUUA92.489188

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3843604GCTATAATCATTAGTTTTATAAAACTAATGATTATAGC0.366400.287000.819001.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3584-3606TTGCTATAATCATTAGTTTTAGAUAAAACUAAUGAUUAUAGCAAGCUAUAAUCAUUAGUUUUAGAU4.9-2.702


Target Position: 1387, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1387CGAGGAUAUAAUCAUCAAC80.42661077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8401405CGAGGATATAATCATCAACGTTGATGATTATATCCTCG0.105400.047000.646600.750000.983700.62500


Target Position: 3507, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507CUUUUAUUUUUUCUUUUGU71.54011990

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3505-3527GGCTTTTATTTTTTCTTTTGTAAACAAAAGAAAAAAUAAAAGCCCUUUUAUUUUUUCUUUUGUAAU12.2-9.701


Target Position: 1202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1202CAGAUGAGCAAGGAAGAGA83.9745735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7711220CAGATGAGCAAGGAAGAGATCTCTTCCTTGCTCATCTG0.632600.039400.560300.500001.000001.00000


Target Position: 515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
515CGAAAAGAGGAAAAGGUUC68.80262268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
790533CGAAAAGAGGAAAAGGTTCGAACCTTTTCCTCTTTTCG0.614100.022400.620700.750001.000001.00000


Target Position: 2365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2365CACAGACCGAGAGGAAAAU76.71811431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252383CACAGACCGAGAGGAAAATATTTTCCTCTCGGTCTGTG0.109700.054000.784500.750001.000001.00000


Target Position: 1139, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1139CUAAGCAAAUGUGAUUUUA85.49631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8721157CTAAGCAAATGTGATTTTATAAAATCACATTTGCTTAG0.095900.031500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1137-1159ACCTAAGCAAATGTGATTTTACCUAAAAUCACAUUUGCUUAGGUCUAAGCAAAUGUGAUUUUACCU7.419.723


Target Position: 3144, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3144GCAUGAUGGGAAAAUAUUU88.8426383

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3142-3164AAGCATGATGGGAAAATATTTCCAAAUAUUUUCCCAUCAUGCUUGCAUGAUGGGAAAAUAUUUCCU-10.319.402


Target Position: 1897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1897GAACCUACAACUAUUUAUG79.94711118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611915GAACCTACAACTATTTATGCATAAATAGTTGTAGGTTC0.293700.137500.517200.500001.000001.00000


Target Position: 541, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
541UGGGGAUGCAAAAAUAAAG65.1032591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
710559TGGGGATGCAAAAATAAAGCTTTATTTTTGCATCCCCA0.795800.434000.706900.500001.000001.00000


Target Position: 1710, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1710UGAGAGCAGGCAAUGAAAA81.6415969

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5571728TGAGAGCAGGCAATGAAAATTTTCATTGCCTGCTCTCA0.643500.050800.724100.750001.000001.00000


Target Position: 3642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3642UCCCACAUCUUUCCUCAAG55.72923276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413660TCCCACATCTTTCCTCAAGCTTGAGGAAAGATGTGGGA0.586800.157400.732800.500001.000001.00000


Target Position: 2732, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2732CAACUUAUUUAAAAAUAUU91.1056254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602750CAACTTATTTAAAAATATTAATATTTTTAAATAAGTTG0.510500.156600.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2730-2752GACAACTTATTTAAAAATATTTCAAUAUUUUUAAAUAAGUUGUCCAACUUAUUUAAAAAUAUUUCU-10.34.601


Target Position: 3166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3166GACUUGAGUGUUCCUUUUU81.41991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8643184GACTTGAGTGTTCCTTTTTAAAAAGGAACACTCAAGTC0.118100.016300.819000.750001.000001.00000


Target Position: 501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
501GAGACAAGGAAAAACGAAA94.0677114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
532519GAGACAAGGAAAAACGAAATTTCGTTTTTCCTTGTCTC0.654400.621500.810300.750001.000001.00000


Target Position: 1531, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1531CAUGCUUAACCCUAGUUCA92.0451208

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1529-1551ATCATGCTTAACCCTAGTTCACGUGAACUAGGGUUAAGCAUGAUCAUGCUUAACCCUAGUUCACGU18.919.723


Target Position: 1225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1225GAAAAUCAAAGAGGAGAAU78.89871230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4211243GAAAATCAAAGAGGAGAATATTCTCCTCTTTGATTTTC0.461900.239200.663800.750001.000001.00000


Target Position: 2999, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2999AGGAAUUUAAAAUUAAGUA87.0747502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4123017AGGAATTTAAAATTAAGTATACTTAATTTTAAATTCCT0.715000.167900.663800.750001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756AGGAUGGUAAAUUGAAAAA82.8153851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
220774AGGATGGTAAATTGAAAAATTTTTCAATTTACCATCCT0.745000.231800.844800.750001.000001.00000


Target Position: 2733, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2733AACUUAUUUAAAAAUAUUU78.3241275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7322751AACTTATTTAAAAATATTTAAATATTTTTAAATAAGTT0.470800.185300.646600.500001.000001.00000


Target Position: 3289, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3289GAAUCUAAGGAUAAUGAAA101.31716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663307GAATCTAAGGATAATGAAATTTCATTATCCTTAGATTC0.202900.016200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3287-3309GTGAATCTAAGGATAATGAAATAUUUCAUUAUCCUUAGAUUCACGAAUCUAAGGAUAAUGAAAUAU8.96.911


Target Position: 1895, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1895AAGAACCUACAACUAUUUA84.1166723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9321913AAGAACCTACAACTATTTATAAATAGTTGTAGGTTCTT0.541200.176700.603400.500001.000001.00000


Target Position: 1240, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1240GAAUGAAAAAUUACUGAAA97.589147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3631258GAATGAAAAATTACTGAAATTTCAGTAATTTTTCATTC0.423400.327000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1238-1260GAGAATGAAAAATTACTGAAAGAUUUCAGUAAUUUUUCAUUCUCGAAUGAAAAAUUACUGAAAGAU20.37.422


Target Position: 3635, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3635GUCCAUUUCCCACAUCUUU76.84181420

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5103653GTCCATTTCCCACATCTTTAAAGATGTGGGAAATGGAC0.260800.162100.819000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3633-3655GAGTCCATTTCCCACATCTTTCCAAAGAUGUGGGAAAUGGACUCGUCCAUUUCCCACAUCUUUCCU19.220.102


Target Position: 2363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2363GCCACAGACCGAGAGGAAA85.1104660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9022381GCCACAGACCGAGAGGAAATTTCCTCTCGGTCTGTGGC0.089200.050301.000001.000001.000001.00000


Target Position: 2977, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2977UCCCUUCCCUCUCUCCCAU62.30432831

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172995TCCCTTCCCTCTCTCCCATATGGGAGAGAGGGAAGGGA0.660300.640400.715500.750001.000001.00000


Target Position: 1808, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1808GGUCAGGAAUAUGUGGUAG77.15461392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8431826GGTCAGGAATATGTGGTAGCTACCACATATTCCTGACC0.104900.019900.681000.750001.000001.00000


Target Position: 954, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954CAGAGAAUGUCAAGUUUUA98.587932

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_595419CAGAGAATGTCAAGTTTTA1/1/0/097.21TOP1NM_003286.21NANANA20:39721201..39721219(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870972CAGAGAATGTCAAGTTTTATAAAACTTGACATTCTCTG0.169400.016000.750000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
952-974TCCAGAGAATGTCAAGTTTTATTUAAAACUUGACAUUCUCUGGACAGAGAAUGUCAAGUUUUAUUU3.219.122


Target Position: 1243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1243UGAAAAAUUACUGAAAGAA81.25271011

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8011261TGAAAAATTACTGAAAGAATTCTTTCAGTAATTTTTCA0.385100.343700.551700.750001.000001.00000


Target Position: 2776, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2776GAUUUGUUUUGAAUUUUGU81.24991012

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2774-2796ATGATTTGTTTTGAATTTTGTTTACAAAAUUCAAAACAAAUCAUGAUUUGUUUUGAAUUUUGUUUU-3.35.302


Target Position: 2292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2292AGAAGGUAGUAGAGUCAAA97.049354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312310AGAAGGTAGTAGAGTCAAATTTGACTCTACTACCTTCT0.081600.037700.724100.750001.000001.00000


Target Position: 3355, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3355UCGCUGUACCCUUUAAGAU72.26441903

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9093373TCGCTGTACCCTTTAAGATATCTTAAAGGGTACAGCGA0.113300.013200.612100.750001.000001.00000


Target Position: 885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
885CUGAAGGCAUCAAGUGGAA85.0622662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
999903CTGAAGGCATCAAGTGGAATTCCACTTGATGCCTTCAG0.066600.036200.612100.750000.972800.62500


Target Position: 2723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2723UCCUAUGGACAACUUAUUU72.57291878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122741TCCTATGGACAACTTATTTAAATAAGTTGTCCATAGGA0.223400.031300.870700.750001.000001.00000


Target Position: 1233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233AAGAGGAGAAUGAAAAAUU80.34481086

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7061251AAGAGGAGAATGAAAAATTAATTTTTCATTCTCCTCTT0.583800.368600.629300.500001.000001.00000


Target Position: 844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
844AGAGGAACAGAAGUGGAAA87.5994467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
534862AGAGGAACAGAAGTGGAAATTTCCACTTCTGTTCCTCT0.240300.135100.724100.750001.000001.00000


Target Position: 1887, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1887GAGUUUUUAAGAACCUACA88.7333392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7131905GAGTTTTTAAGAACCTACATGTAGGTTCTTAAAAACTC0.224700.064900.603400.500000.989100.62500


Target Position: 3191, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3191GAAUUUUUAUUUCUUUUUA93.0276170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8943209GAATTTTTATTTCTTTTTATAAAAAGAAATAAAAATTC0.090600.039900.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3189-3211GTGAATTTTTATTTCTTTTTAATUAAAAAGAAAUAAAAAUUCACGAAUUUUUAUUUCUUUUUAAUU5.5-12.001


Target Position: 1940, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1940CUUUUUGAUAGACUCAAUA87.5247472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7631958CTTTTTGATAGACTCAATATATTGAGTCTATCAAAAAG0.136500.025500.594800.750000.934800.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1938-1960ATCTTTTTGATAGACTCAATACTUAUUGAGUCUAUCAAAAAGAUCUUUUUGAUAGACUCAAUACUU19.27.702


Target Position: 312, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
312CUCAUAAACACAAAGAUAA89.9996311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
354330CTCATAAACACAAAGATAATTATCTTTGTGTTTATGAG0.872100.663700.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
310-332TTCTCATAAACACAAAGATAAACUUAUCUUUGUGUUUAUGAGAACUCAUAAACACAAAGAUAAACU6.98.922


Target Position: 1138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1138CCUAAGCAAAUGUGAUUUU77.20291382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9151156CCTAAGCAAATGTGATTTTAAAATCACATTTGCTTAGG0.085300.034000.844801.000001.000001.00000


Target Position: 3653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653UCCUCAAGUAUCUUCUAUU79.19251204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2103671TCCTCAAGTATCTTCTATTAATAGAAGATACTTGAGGA0.568600.411700.862100.750001.000001.00000


Target Position: 3273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3273GGGAUGAAGGGCGAGUGAA86.1589568

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6123291GGGATGAAGGGCGAGTGAATTCACTCGCCCTTCATCCC0.191300.107000.819001.000001.000001.00000


Target Position: 3725, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3725CAACUUAAUGGAAAAAAAA93.4385145

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4853743CAACTTAATGGAAAAAAAATTTTTTTTCCATTAAGTTG0.936300.789400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3723-3745TACAACTTAATGGAAAAAAAAAAUUUUUUUUCCAUUAAGUUGUACAACUUAAUGGAAAAAAAAAAU-11.34.9


Target Position: 2275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2275GAAGGAUGCAAAGACGAAG74.34221695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8852293GAAGGATGCAAAGACGAAGCTTCGTCTTTGCATCCTTC0.235100.071700.534500.500001.000001.00000


Target Position: 3494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3494CAAGAUUUUAGGGCUUUUA83.8534749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7013512CAAGATTTTAGGGCTTTTATAAAAGCCCTAAAATCTTG0.153300.074500.612100.750001.000001.00000


Target Position: 1074, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1074GGAAAAAUUUCUUUAAAGA93.9749118

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1072-1094TAGGAAAAATTTCTTTAAAGACTUCUUUAAAGAAAUUUUUCCUAGGAAAAAUUUCUUUAAAGACUU-3.80.421


Target Position: 1297, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297GAUUGCUAACUUCAAGAUA93.6058135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6071315GATTGCTAACTTCAAGATATATCTTGAAGTTAGCAATC0.199300.051100.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1295-1317AGGATTGCTAACTTCAAGATAGAUAUCUUGAAGUUAGCAAUCCUGAUUGCUAACUUCAAGAUAGAU20.419.732


Target Position: 2880, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880CUUAGCUACUGUAUGCAAA90.3759294

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2878-2900CTCTTAGCTACTGTATGCAAAGTUUUGCAUACAGUAGCUAAGAGCUUAGCUACUGUAUGCAAAGUU21.119.502


Target Position: 3278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3278GAAGGGCGAGUGAAUCUAA98.304238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6363296GAAGGGCGAGTGAATCTAATTAGATTCACTCGCCCTTC0.178600.093300.637900.750001.000001.00000


Target Position: 749, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
749GAAGAAGAGGAUGGUAAAU83.7645757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
496767GAAGAAGAGGATGGTAAATATTTACCATCCTCTTCTTC0.268900.202800.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
747-769AAGAAGAAGAGGATGGTAAATTGAUUUACCAUCCUCUUCUUCUUGAAGAAGAGGAUGGUAAAUUGU20.019.112


Target Position: 2970, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2970CCUAAACUCCCUUCCCUCU73.78861760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6072988CCTAAACTCCCTTCCCTCTAGAGGGAAGGGAGTTTAGG0.900700.593800.620700.750001.000001.00000


Target Position: 769, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GAAAAAACCCAAGAAUAAA92.7932177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
468787GAAAAAACCCAAGAATAAATTTATTCTTGGGTTTTTTC0.639000.253200.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
767-789TTGAAAAAACCCAAGAATAAAGAUUUAUUCUUGGGUUUUUUCAAGAAAAAACCCAAGAAUAAAGAU6.9-1.822


Target Position: 2930, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2930GGGUUUUGCAAUAACUUCU80.50511068

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2928-2950TAGGGTTTTGCAATAACTTCTATAGAAGUUAUUGCAAAACCCUAGGGUUUUGCAAUAACUUCUAUU14.618.802


Target Position: 3484, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3484GAAAAAUAAUCAAGAUUUU89.3319347

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7593502GAAAAATAATCAAGATTTTAAAATCTTGATTATTTTTC0.269500.026000.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3482-3504AGGAAAAATAATCAAGATTTTAGAAAAUCUUGAUUAUUUUUCCUGAAAAAUAAUCAAGAUUUUAGU5.3-9.701


Target Position: 542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
542GGGGAUGCAAAAAUAAAGA83.9988732

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
531560GGGGATGCAAAAATAAAGATCTTTATTTTTGCATCCCC0.795400.500300.767200.750001.000001.00000


Target Position: 642, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642AGGAUAUAAAGCCAUUAAA88.6412402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
694660AGGATATAAAGCCATTAAATTTAATGGCTTTATATCCT0.156100.046100.844800.750001.000001.00000


Target Position: 834, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
834CGAAGAAAGAAGAGGAACA91.4663238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
708852CGAAGAAAGAAGAGGAACATGTTCCTCTTCTTTCTTCG0.415500.350600.586200.750001.000001.00000


Target Position: 1708, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1708UCUGAGAGCAGGCAAUGAA82.0582929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8041726TCTGAGAGCAGGCAATGAATTCATTGCCTGCTCTCAGA0.150000.026100.551700.750000.967400.62500


Target Position: 3325, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3325CAUUUUCCCAUCAUCCUUU79.86381129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5563343CATTTTCCCATCATCCTTTAAAGGATGATGGGAAAATG0.522400.145000.655200.750001.000001.00000


Target Position: 292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292GGAUUUCCGAUUGAAUGAU79.8061135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
727310GGATTTCCGATTGAATGATATCATTCAATCGGAAATCC0.145600.033600.689701.000001.000001.00000


Target Position: 779, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
779AAGAAUAAAGAUAAAGAUA91.3062247

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
897797AAGAATAAAGATAAAGATATATCTTTATCTTTATTCTT0.883400.609600.594800.500001.000001.00000


Target Position: 1590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1590CUCGGCGGCUGAAAAAAUG61.94522856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681608CTCGGCGGCTGAAAAAATGCATTTTTTCAGCCGCCGAG0.551000.010300.655200.500001.000001.00000


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720CCAAGAAGGAGAAGAAAAG74.02431728

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
524738CCAAGAAGGAGAAGAAAAGCTTTTCTTCTCCTTCTTGG0.941700.377000.706900.750001.000001.00000


Target Position: 807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
807CUGAGCCAGAUAACAAGAA82.2182913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
630825CTGAGCCAGATAACAAGAATTCTTGTTATCTGGCTCAG0.699200.302200.612100.750001.000001.00000


Target Position: 1168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1168CCAGUAUUUCAAAGCCCAG71.23472019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7901186CCAGTATTTCAAAGCCCAGCTGGGCTTTGAAATACTGG0.147700.073700.560300.750001.000001.00000


Target Position: 3263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3263GGGUUGGGGAGGGAUGAAG63.67882716

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8313281GGGTTGGGGAGGGATGAAGCTTCATCCCTCCCCAACCC0.518200.018900.853400.750001.000001.00000


Target Position: 2157, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2157CACCAAAAACUUUUGAGAA92.8155175

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2155-2177ACCACCAAAAACTTTTGAGAAGTUUCUCAAAAGUUUUUGGUGGUCACCAAAAACUUUUGAGAAGUU20.418.802


Target Position: 10, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
10GCGAACUUAGGCUGUUACA82.3454899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
63628GCGAACTTAGGCTGTTACATGTAACAGCCTAAGTTCGC0.287400.062400.715500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
8-30ATGCGAACTTAGGCTGTTACACAUGUAACAGCCUAAGUUCGCAUGCGAACUUAGGCUGUUACACAU19.019.723


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847GACUCCAUCAGAUACUAUA98.488235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7431865GACTCCATCAGATACTATATATAGTATCTGATGGAGTC0.320600.028000.775900.750001.000001.00000


Target Position: 2397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2397UGGGAACCUCCAAACUCAA81.3791996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9932415TGGGAACCTCCAAACTCAATTGAGTTTGGAGGTTCCCA0.343300.008600.698300.750000.934800.62500


Target Position: 3503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3503AGGGCUUUUAUUUUUUCUU70.66252090

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8123521AGGGCTTTTATTTTTTCTTAAGAAAAAATAAAAGCCCT0.116000.033400.706900.750001.000001.00000


Target Position: 3373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3373UAUCCAUCUUUUUCUUUUU75.3971574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8433391TATCCATCTTTTTCTTTTTAAAAAGAAAAAGATGGATA0.721100.165600.543100.500001.000001.00000


Target Position: 3351, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3351GCAUUCGCUGUACCCUUUA81.17551018

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7173369GCATTCGCTGTACCCTTTATAAAGGGTACAGCGAATGC0.310800.030700.819001.000001.000001.00000


Target Position: 441, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
441AGGAGAAGACCAAACACAA94.328104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550459AGGAGAAGACCAAACACAATTGTGTTTGGTCTTCTCCT0.368300.085600.698300.750000.962000.75000


Target Position: 2644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2644AGGCAGCAAGUCUUAACAA89.3289348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6232662AGGCAGCAAGTCTTAACAATTGTTAAGACTTGCTGCCT0.585300.040900.698300.750001.000001.00000


Target Position: 2730, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2730GACAACUUAUUUAAAAAUA91.6741233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3952748GACAACTTATTTAAAAATATATTTTTAAATAAGTTGTC0.432900.138400.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2728-2750TGGACAACTTATTTAAAAATATTUAUUUUUAAAUAAGUUGUCCAGACAACUUAUUUAAAAAUAUUU-9.717.801


Target Position: 509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
509GAAAAACGAAAAGAGGAAA85.6372621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
588527GAAAAACGAAAAGAGGAAATTTCCTCTTTTCGTTTTTC0.210500.142400.672400.750001.000001.00000


Target Position: 2166, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2166CUUUUGAGAAGUCUAUGAU83.2787807

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2164-2186AACTTTTGAGAAGTCTATGATGAAUCAUAGACUUCUCAAAAGUUCUUUUGAGAAGUCUAUGAUGAU21.412.203


Target Position: 490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
490ACAUAAAGACAGAGACAAG80.79541048

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
746508ACATAAAGACAGAGACAAGCTTGTCTCTGTCTTTATGT0.853200.825600.569000.500001.000001.00000


Target Position: 3065, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3065AUGGGGAUCAAUUUUCAUU72.27111901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9703083ATGGGGATCAATTTTCATTAATGAAAATTGATCCCCAT0.322600.010200.646600.500001.000001.00000


Target Position: 3284, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3284CGAGUGAAUCUAAGGAUAA97.058553

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7913302CGAGTGAATCTAAGGATAATTATCCTTAGATTCACTCG0.193900.022400.758601.000001.000001.00000


Target Position: 1167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1167GCCAGUAUUUCAAAGCCCA85.7734604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6541185GCCAGTATTTCAAAGCCCATGGGCTTTGAAATACTGGC0.171700.080400.655200.750001.000001.00000


Target Position: 1877, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1877GUUGAGAAACGAGUUUUUA85.9437588

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491895GTTGAGAAACGAGTTTTTATAAAAACTCGTTTCTCAAC0.129800.011500.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1875-1897CTGTTGAGAAACGAGTTTTTAAGUAAAAACUCGUUUCUCAACAGGUUGAGAAACGAGUUUUUAAGU3.220.423


Target Position: 2998, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2998CAGGAAUUUAAAAUUAAGU78.29051279

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9503016CAGGAATTTAAAATTAAGTACTTAATTTTAAATTCCTG0.717600.080000.577600.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2996-3018TTCAGGAATTTAAAATTAAGTAGACUUAAUUUUAAAUUCCUGAACAGGAAUUUAAAAUUAAGUAGU-4.318.702


Target Position: 1594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1594GCGGCUGAAAAAAUGUGUG67.29482409

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811612GCGGCTGAAAAAATGTGTGCACACATTTTTTCAGCCGC0.070300.014700.629300.750001.000001.00000


Target Position: 2593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2593UGGGAAAGAUGGAUAAACU80.85441040

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9942611TGGGAAAGATGGATAAACTAGTTTATCCATCTTTCCCA0.173900.084700.637900.500001.000001.00000


Target Position: 8, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
8AUGCGAACUUAGGCUGUUA83.0272832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
98826ATGCGAACTTAGGCTGTTATAACAGCCTAAGTTCGCAT0.221300.045300.620700.500000.972800.75000


Target Position: 283, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
283GAUCGAAGCGGAUUUCCGA86.7953516

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
281-303CAGATCGAAGCGGATTTCCGATTUCGGAAAUCCGCUUCGAUCUGGAUCGAAGCGGAUUUCCGAUUU20.721.033


Target Position: 3286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3286AGUGAAUCUAAGGAUAAUG71.10212034

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8883304AGTGAATCTAAGGATAATGCATTATCCTTAGATTCACT0.222300.019400.551700.500001.000001.00000


Target Position: 3287, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3287GUGAAUCUAAGGAUAAUGA87.4792475

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3285-3307GAGTGAATCTAAGGATAATGAAAUCAUUAUCCUUAGAUUCACUCGUGAAUCUAAGGAUAAUGAAAU8.720.412


Target Position: 313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
313UCAUAAACACAAAGAUAAA88.7193394

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
490331TCATAAACACAAAGATAAATTTATCTTTGTGTTTATGA0.872300.694000.724100.750001.000001.00000


Target Position: 3170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3170UGAGUGUUCCUUUUUAAAU75.8271527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6493188TGAGTGTTCCTTTTTAAATATTTAAAAAGGAACACTCA0.652200.037700.715500.750001.000001.00000


Target Position: 478, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
478GCAUAAAGACAAACAUAAA102.1429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
32496GCATAAAGACAAACATAAATTTATGTTTGTCTTTATGC0.965000.908700.853401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
476-498AAGCATAAAGACAAACATAAAGAUUUAUGUUUGUCUUUAUGCUUGCAUAAAGACAAACAUAAAGAU6.93.512


Target Position: 2278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2278GGAUGCAAAGACGAAGAAG75.56971551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5372296GGATGCAAAGACGAAGAAGCTTCTTCGTCTTTGCATCC0.239800.115700.732800.750001.000001.00000


Target Position: 1259, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259GAAUAUGGAUUCUGUAUUA104.9723

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1257-1279AAGAATATGGATTCTGTATTATGUAAUACAGAAUCCAUAUUCUUGAAUAUGGAUUCUGUAUUAUGU11.612.622


Target Position: 3188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3188UGUGAAUUUUUAUUUCUUU78.15821290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8133206TGTGAATTTTTATTTCTTTAAAGAAATAAAAATTCACA0.114800.047000.706900.750001.000001.00000


Target Position: 3386, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3386CUUUUUAACCCUAAUCUUU79.66551151

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7633404CTTTTTAACCCTAATCTTTAAAGATTAGGGTTAAAAAG0.129800.127200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3384-3406TTCTTTTTAACCCTAATCTTTCAAAAGAUUAGGGUUAAAAAGAACUUUUUAACCCUAAUCUUUCAU6.9-9.103


Target Position: 1959, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1959CUGGUAUUCUGAAUAAGCA91.3237246

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1957-1979TACTGGTATTCTGAATAAGCATCUGCUUAUUCAGAAUACCAGUACUGGUAUUCUGAAUAAGCAUCU13.620.002


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757GGAUGGUAAAUUGAAAAAA90.852268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
251775GGATGGTAAATTGAAAAAATTTTTTCAATTTACCATCC0.514200.229200.870701.000001.000001.00000


Target Position: 1209, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1209GCAAGGAAGAGAAACUGAA93.0516167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3191227GCAAGGAAGAGAAACTGAATTCAGTTTCTCTTCCTTGC0.495200.420900.681001.000001.000001.00000


Target Position: 1510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1510CCAAGGUUCCAUUAAAUAC74.75961653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4301528CCAAGGTTCCATTAAATACGTATTTAATGGAACCTTGG0.878100.119800.663800.750001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833CCGAAGAAAGAAGAGGAAC62.48982822

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
635851CCGAAGAAAGAAGAGGAACGTTCCTCTTCTTTCTTCGG0.411100.343300.767200.750001.000001.00000


Target Position: 891, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
891GCAUCAAGUGGAAAUUCCU85.7363609

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
889-911AGGCATCAAGTGGAAATTCCTAGAGGAAUUUCCACUUGAUGCCUGCAUCAAGUGGAAAUUCCUAGU14.218.132


Target Position: 967, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967GUUUUAUUAUGAUGGUAAA95.649574

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_896719GTTTTATTATGATGGTAAA1/1/0/096.22TOP1NM_003286.21NANANA4:76724846..76724864(+)00TOP1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
965-987AAGTTTTATTATGATGGTAAAGTUUUACCAUCAUAAUAAAACUUGUUUUAUUAUGAUGGUAAAGUU20.0-9.722


Target Position: 878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
878CGCUAUCCUGAAGGCAUCA81.12671019

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978896CGCTATCCTGAAGGCATCATGATGCCTTCAGGATAGCG0.292500.009500.698300.750000.983700.62500


Target Position: 696, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
696CUAAGAAAAUUAAAACAGA90.9931257

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
694-716ACCTAAGAAAATTAAAACAGAAGUCUGUUUUAAUUUUCUUAGGUCUAAGAAAAUUAAAACAGAAGU10.37.122


Target Position: 3460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3460AAUGAGUAUUUGGUCCAAA86.2774561

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9803478AATGAGTATTTGGTCCAAATTTGGACCAAATACTCATT0.085500.018900.508600.500001.000001.00000


Target Position: 3202, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3202UCUUUUUAAUUAUUUUAAA82.1767917

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6863220TCTTTTTAATTATTTTAAATTTAAAATAATTAAAAAGA0.159000.076700.724100.750001.000001.00000


Target Position: 953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
953CCAGAGAAUGUCAAGUUUU83.9173738

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
878971CCAGAGAATGTCAAGTTTTAAAACTTGACATTCTCTGG0.141600.015600.844801.000001.000001.00000


Target Position: 543, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
543GGGAUGCAAAAAUAAAGAA91.6878231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91561GGGATGCAAAAATAAAGAATTCTTTATTTTTGCATCCC0.789700.576100.819001.000001.000001.00000


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957AGAAUGUCAAGUUUUAUUA87.8813452

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
984975AGAATGTCAAGTTTTATTATAATAAAACTTGACATTCT0.069200.024000.689700.750001.000001.00000


Target Position: 718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
718UACCAAGAAGGAGAAGAAA78.47971261

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
958736TACCAAGAAGGAGAAGAAATTTCTTCTCCTTCTTGGTA0.947400.359900.681000.500000.978300.75000


Target Position: 2095, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2095GAUCCUUUCUUAUAACCGU81.33161003

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2093-2115AAGATCCTTTCTTATAACCGTGCACGGUUAUAAGAAAGGAUCUUGAUCCUUUCUUAUAACCGUGCU20.618.703


Target Position: 3189, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3189GUGAAUUUUUAUUUCUUUU81.02161026

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6813207GTGAATTTTTATTTCTTTTAAAAGAAATAAAAATTCAC0.161200.037900.793100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3187-3209ATGTGAATTTTTATTTCTTTTTAAAAAGAAAUAAAAAUUCACAUGUGAAUUUUUAUUUCUUUUUAU5.57.401


Target Position: 3527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3527AUUGUGUAAAAAAUGGAAA76.36221468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9713545ATTGTGTAAAAAATGGAAATTTCCATTTTTTACACAAT0.299900.025800.508600.500001.000001.00000


Target Position: 2364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2364CCACAGACCGAGAGGAAAA89.5863335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8602382CCACAGACCGAGAGGAAAATTTTCCTCTCGGTCTGTGG0.099200.053200.844801.000001.000001.00000


Target Position: 1064, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1064GAAAUAUUUAGGAAAAAUU87.9347448

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1062-1084AGGAAATATTTAGGAAAAATTTCAAUUUUUCCUAAAUAUUUCCUGAAAUAUUUAGGAAAAAUUUCU0.4-10.311


Target Position: 633, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
633CUCCUAAAGAGGAUAUAAA93.6017136

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1063319CTCCTAAAGAGGATATAAA1/1/0/094.96TOP1NM_003286.21NANANA20:39708772..39708790(+)00TOP1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
631-653TCCTCCTAAAGAGGATATAAAGCUUUAUAUCCUCUUUAGGAGGACUCCUAAAGAGGAUAUAAAGCU3.519.922


Target Position: 2274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2274UGAAGGAUGCAAAGACGAA85.8192601

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8252292TGAAGGATGCAAAGACGAATTCGTCTTTGCATCCTTCA0.248700.082400.551700.750001.000001.00000


Target Position: 2282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2282GCAAAGACGAAGAAGGUAG72.95971846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4872300GCAAAGACGAAGAAGGTAGCTACCTTCTTCGTCTTTGC0.541700.146300.681000.750001.000001.00000


Target Position: 3268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3268GGGGAGGGAUGAAGGGCGA76.06451505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4433286GGGGAGGGATGAAGGGCGATCGCCCTTCATCCCTCCCC0.427500.149000.698300.750001.000001.00000


Target Position: 1377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1377GAAUCAUGCCCGAGGAUAU92.3834193

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9521395GAATCATGCCCGAGGATATATATCCTCGGGCATGATTC0.108000.011100.629300.750001.000001.00000


Target Position: 1527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1527ACAUCAUGCUUAACCCUAG76.12351500

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8661545ACATCATGCTTAACCCTAGCTAGGGTTAAGCATGATGT0.103400.107400.534500.500001.000001.00000


Target Position: 3482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3482AGGAAAAAUAAUCAAGAUU78.60291256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7893500AGGAAAAATAATCAAGATTAATCTTGATTATTTTTCCT0.226700.022500.836200.750001.000001.00000


Target Position: 3330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3330UCCCAUCAUCCUUUGUUCU64.82832616

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7773348TCCCATCATCCTTTGTTCTAGAACAAAGGATGATGGGA0.454800.332400.646600.500001.000001.00000


Target Position: 1365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1365UGCUGAAGAGACGAAUCAU81.30361005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031383TGCTGAAGAGACGAATCATATGATTCGTCTCTTCAGCA0.089000.013800.698300.750001.000001.00000


Target Position: 2200, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2200GAUUGAUGCCAAGAAGGAA96.244763

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9782218GATTGATGCCAAGAAGGAATTCCTTCTTGGCATCAATC0.162700.057700.508600.750000.989100.75000


Target Position: 1294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1294GAGGAUUGCUAACUUCAAG80.8491043

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321312GAGGATTGCTAACTTCAAGCTTGAAGTTAGCAATCCTC0.262900.018900.672400.500001.000001.00000


Target Position: 2997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2997UCAGGAAUUUAAAAUUAAG71.81611962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6913015TCAGGAATTTAAAATTAAGCTTAATTTTAAATTCCTGA0.745100.070400.586200.500001.000001.00000


Target Position: 3475, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3475CAAAAAAAGGAAAAAUAAU85.5834623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8933493CAAAAAAAGGAAAAATAATATTATTTTTCCTTTTTTTG0.090900.032400.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3473-3495TCCAAAAAAAGGAAAAATAATCAAUUAUUUUUCCUUUUUUUGGACAAAAAAAGGAAAAAUAAUCAU-9.7-11.311


Target Position: 1567, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1567GGACUGGCAGAAAUACGAG78.94491225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9481585GGACTGGCAGAAATACGAGCTCGTATTTCTGCCAGTCC0.394100.011600.560300.750001.000001.00000


Target Position: 1876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1876UGUUGAGAAACGAGUUUUU75.04141617

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9991894TGTTGAGAAACGAGTTTTTAAAAACTCGTTTCTCAACA0.124100.008400.706900.750001.000001.00000


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237GGAGAAUGAAAAAUUACUG80.03551109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7001255GGAGAATGAAAAATTACTGCAGTAATTTTTCATTCTCC0.529300.379800.586200.750001.000001.00000


Target Position: 1724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1724GAAAAGGAGGAAGGAGAAA84.1479722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221742GAAAAGGAGGAAGGAGAAATTTCTCCTTCCTCCTTTTC0.248500.157000.672400.750001.000001.00000


Target Position: 3647, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3647CAUCUUUCCUCAAGUAUCU83.5819773

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3645-3667CACATCTTTCCTCAAGTATCTTCAGAUACUUGAGGAAAGAUGUGCAUCUUUCCUCAAGUAUCUUCU14.514.802


Target Position: 1231, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231CAAAGAGGAGAAUGAAAAA96.998156

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_4123119CAAAGAGGAGAATGAAAAA1/1/0/097.75TOP1NM_003286.21NANANA20:39728701..39728719(+)00TOP1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5521249CAAAGAGGAGAATGAAAAATTTTTCATTCTCCTCTTTG0.585900.389200.646600.750001.000001.00000


Target Position: 1204, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1204GAUGAGCAAGGAAGAGAAA93.294154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6341222GATGAGCAAGGAAGAGAAATTTCTCTTCCTTGCTCATC0.884800.054900.681000.750001.000001.00000


Target Position: 350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
350CGGCACAAAGAACACAAGA82.4026889

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
471368CGGCACAAAGAACACAAGATCTTGTGTTCTTTGTGCCG0.777400.313700.689700.750001.000001.00000


Target Position: 349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
349CCGGCACAAAGAACACAAG70.52282105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
204367CCGGCACAAAGAACACAAGCTTGTGTTCTTTGTGCCGG0.776600.258200.775900.750001.000001.00000


Target Position: 297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
297UCCGAUUGAAUGAUUCUCA75.62091545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
885315TCCGATTGAATGATTCTCATGAGAATCATTCAATCGGA0.101600.021500.646600.500001.000001.00000


Target Position: 1536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1536UUAACCCUAGUUCACGAAU61.00412928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9171554TTAACCCTAGTTCACGAATATTCGTGAACTAGGGTTAA0.438000.031800.525900.500001.000001.00000


Target Position: 3518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3518UCUUUUGUAAUUGUGUAAA72.02441934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5463536TCTTTTGTAATTGTGTAAATTTACACAATTACAAAAGA0.232400.069000.724100.750001.000001.00000


Target Position: 1203, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1203AGAUGAGCAAGGAAGAGAA94.898689

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8051221AGATGAGCAAGGAAGAGAATTCTCTTCCTTGCTCATCT0.832800.043400.551700.750001.000001.00000


Target Position: 1110, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1110CUAAUGAAGAGAAGAAUAU83.7011762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5881128CTAATGAAGAGAAGAATATATATTCTTCTCTTCATTAG0.284400.222100.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1108-1130GACTAATGAAGAGAAGAATATTAAUAUUCUUCUCUUCAUUAGUCCUAAUGAAGAGAAGAAUAUUAU6.98.922


Target Position: 1083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1083UCUUUAAAGACUGGAGAAA74.06551722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9041101TCTTTAAAGACTGGAGAAATTTCTCCAGTCTTTAAAGA0.088700.015500.724100.750001.000001.00000


Target Position: 3009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3009AAUUAAGUAGAACAAAAAA89.8951316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9743027AATTAAGTAGAACAAAAAATTTTTTGTTCTACTTAATT0.902400.647200.508600.500001.000001.00000


Target Position: 2729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2729GGACAACUUAUUUAAAAAU89.7697324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3292747GGACAACTTATTTAAAAATATTTTTAAATAAGTTGTCC0.422200.123100.862101.000001.000001.00000


Target Position: 743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743CUAGAAGAAGAAGAGGAUG68.58422282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
959761CTAGAAGAAGAAGAGGATGCATCCTCTTCTTCTTCTAG0.289300.265400.517200.500001.000001.00000


Target Position: 3495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3495AAGAUUUUAGGGCUUUUAU75.25581591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9203513AAGATTTTAGGGCTTTTATATAAAAGCCCTAAAATCTT0.084400.038000.594800.500001.000001.00000


Target Position: 715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
715AGAUACCAAGAAGGAGAAG63.47822736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
889733AGATACCAAGAAGGAGAAGCTTCTCCTTCTTGGTATCT0.418000.344300.586200.500000.978301.00000


Target Position: 2938, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2938CAAUAACUUCUAUAUUUUA102.01410

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2936-2958TGCAATAACTTCTATATTTTAATUAAAAUAUAGAAGUUAUUGCACAAUAACUUCUAUAUUUUAAUU-10.34.602


Target Position: 2653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2653GUCUUAACAAACCAACAUC71.56131987

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802671GTCTTAACAAACCAACATCGATGTTGGTTTGTTAAGAC0.146400.131600.637900.500001.000001.00000


Target Position: 3666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3666UCUAUUUUUAUCAUGAAUU70.07372146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3903684TCTATTTTTATCATGAATTAATTCATGATAAAAATAGA0.373800.304000.715500.750001.000001.00000


Target Position: 784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
784UAAAGAUAAAGAUAAAAAA88.5873407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
881802TAAAGATAAAGATAAAAAATTTTTTATCTTTATCTTTA0.893700.857100.534500.500001.000001.00000


Target Position: 2762, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2762AAUUCUAGCUGUAUGAUUU88.1504439

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9922780AATTCTAGCTGTATGATTTAAATCATACAGCTAGAATT0.473100.044100.508600.500001.000001.00000


Target Position: 3288, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3288UGAAUCUAAGGAUAAUGAA84.6695685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513306TGAATCTAAGGATAATGAATTCATTATCCTTAGATTCA0.208100.017600.551700.750001.000001.00000


Target Position: 1031, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1031GCAAAAAUGCUCGACCAUG70.93422058

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181049GCAAAAATGCTCGACCATGCATGGTCGAGCATTTTTGC0.148700.128700.698300.750000.929300.62500


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806CCUGAGCCAGAUAACAAGA83.3969790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
625824CCTGAGCCAGATAACAAGATCTTGTTATCTGGCTCAGG0.687600.200100.620700.750000.983700.62500


Target Position: 811, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
811GCCAGAUAACAAGAAAAAG73.45971794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
280829GCCAGATAACAAGAAAAAGCTTTTTCTTGTTATCTGGC0.889100.414300.862100.750001.000001.00000


Target Position: 1709, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1709CUGAGAGCAGGCAAUGAAA90.8977264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6421727CTGAGAGCAGGCAATGAAATTTCATTGCCTGCTCTCAG0.180600.038500.784500.750001.000001.00000


Target Position: 1881, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1881AGAAACGAGUUUUUAAGAA85.4726633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191899AGAAACGAGTTTTTAAGAATTCTTAAAAACTCGTTTCT0.156900.077700.551700.750001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823GAAAAAGAAGCCGAAGAAA88.5833410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
388841GAAAAAGAAGCCGAAGAAATTTCTTCGGCTTCTTTTTC0.425200.382600.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
821-843AAGAAAAAGAAGCCGAAGAAAGAUUUCUUCGGCUUCUUUUUCUUGAAAAAGAAGCCGAAGAAAGAU21.05.511


Target Position: 952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
952UCCAGAGAAUGUCAAGUUU74.29671697

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
882970TCCAGAGAATGTCAAGTTTAAACTTGACATTCTCTGGA0.183500.015300.870700.750001.000001.00000


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554AUAAAGAAGGAGAAGGAAA82.9042842

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
900572ATAAAGAAGGAGAAGGAAATTTCCTTCTCCTTCTTTAT0.089600.086700.543100.500001.000001.00000


Target Position: 3068, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3068GGGAUCAAUUUUCAUUAAA90.8889266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4363086GGGATCAATTTTCATTAAATTTAATGAAAATTGATCCC0.307800.118700.991401.000000.972800.62500


Target Position: 3410, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3410GAAAGAUUUUAUUGUAUAA104.2064

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3408-3430TTGAAAGATTTTATTGTATAAAAUUAUACAAUAAAAUCUUUCAAGAAAGAUUUUAUUGUAUAAAAU8.55.301


Target Position: 2873, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2873GGAUUCUCUUAGCUACUGU85.8927594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732891GGATTCTCTTAGCTACTGTACAGTAGCTAAGAGAATCC0.072000.050200.663800.750001.000001.00000


Target Position: 1718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1718GGCAAUGAAAAGGAGGAAG65.36072574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5551736GGCAATGAAAAGGAGGAAGCTTCCTCCTTTTCATTGCC0.268700.198500.862100.750001.000001.00000


Target Position: 1012, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1012GGAAGUAGCUACGUUCUUU91.7347229

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1010-1032GAGGAAGTAGCTACGTTCTTTGCAAAGAACGUAGCUACUUCCUCGGAAGUAGCUACGUUCUUUGCU19.718.933


Target Position: 3522, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3522UUGUAAUUGUGUAAAAAAU76.0291509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8563540TTGTAATTGTGTAAAAAATATTTTTTACACAATTACAA0.101500.071500.637900.500001.000001.00000


Target Position: 1115, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1115GAAGAGAAGAAUAUUAUCA96.402860

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1113-1135ATGAAGAGAAGAATATTATCACCUGAUAAUAUUCUUCUCUUCAUGAAGAGAAGAAUAUUAUCACCU3.519.122


Target Position: 848, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
848GAACAGAAGUGGAAAUGGU84.7755680

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
846-868AGGAACAGAAGTGGAAATGGTGGACCAUUUCCACUUCUGUUCCUGAACAGAAGUGGAAAUGGUGGU20.119.212


Target Position: 3644, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3644CCACAUCUUUCCUCAAGUA95.704973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4233662CCACATCTTTCCTCAAGTATACTTGAGGAAAGATGTGG0.586100.171900.663801.000001.000001.00000


Target Position: 3497, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3497GAUUUUAGGGCUUUUAUUU84.0468727

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3495-3517AAGATTTTAGGGCTTTTATTTTTAAAUAAAAGCCCUAAAAUCUUGAUUUUAGGGCUUUUAUUUUUU-9.7-4.302


Target Position: 12, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
12GAACUUAGGCUGUUACACA98.329237

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
10-32GCGAACTTAGGCTGTTACACAACUGUGUAACAGCCUAAGUUCGCGAACUUAGGCUGUUACACAACU21.59.843


Target Position: 2681, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2681AGAUAAACCUGGAGAUAUU91.7305230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7382699AGATAAACCTGGAGATATTAATATCTCCAGGTTTATCT0.504400.028300.715500.750001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755GAGGAUGGUAAAUUGAAAA93.5886137

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
351773GAGGATGGTAAATTGAAAATTTTCAATTTACCATCCTC0.754900.186900.810300.750001.000001.00000


Target Position: 1707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1707CUCUGAGAGCAGGCAAUGA83.114818

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9221725CTCTGAGAGCAGGCAATGATCATTGCCTGCTCTCAGAG0.117600.012700.586200.500000.967400.75000


Target Position: 1214, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1214GAAGAGAAACUGAAAAUCA98.005745

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1212-1234AGGAAGAGAAACTGAAAATCAAAUGAUUUUCAGUUUCUCUUCCUGAAGAGAAACUGAAAAUCAAAU10.419.121


Target Position: 1711, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1711GAGAGCAGGCAAUGAAAAG75.51841557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7001729GAGAGCAGGCAATGAAAAGCTTTTCATTGCCTGCTCTC0.631400.062400.672400.500001.000001.00000


Target Position: 2528, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2528GAUGAAGACUAUGAGUUUU88.8988379

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2526-2548CTGATGAAGACTATGAGTTTTAGAAAACUCAUAGUCUUCAUCAGGAUGAAGACUAUGAGUUUUAGU19.220.412


Target Position: 2864, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2864GAAAUGUUUGGAUUCUCUU84.5694691

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8762882GAAATGTTTGGATTCTCTTAAGAGAATCCAAACATTTC0.338300.032700.534500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2862-2884CTGAAATGTTTGGATTCTCTTAGAAGAGAAUCCAAACAUUUCAGGAAAUGUUUGGAUUCUCUUAGU19.15.302


Target Position: 584, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
584AGUCCACCACAAAUUAAAG74.69551660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
819602AGTCCACCACAAATTAAAGCTTTAATTTGTGGTGGACT0.425100.257000.569000.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265GGAUUCUGUAUUAUGGAUA93.1338161

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1263-1285ATGGATTCTGTATTATGGATAACUAUCCAUAAUACAGAAUCCAUGGAUUCUGUAUUAUGGAUAACU21.220.422


Target Position: 2680, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2680AAGAUAAACCUGGAGAUAU81.5116981

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8352698AAGATAAACCTGGAGATATATATCTCCAGGTTTATCTT0.489400.018700.594800.500001.000001.00000


Target Position: 1048, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1048UGAAUAUACUACCAAGGAA91.9809215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8161066TGAATATACTACCAAGGAATTCCTTGGTAGTATATTCA0.218300.034900.551700.750001.000001.00000


Target Position: 2769, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2769GCUGUAUGAUUUGUUUUGA85.6376620

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2767-2789TAGCTGTATGATTTGTTTTGAATUCAAAACAAAUCAUACAGCUAGCUGUAUGAUUUGUUUUGAAUU12.217.902


Target Position: 2903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2903GAUUAUAUUGGUGCGUUUU79.62671153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7552921GATTATATTGGTGCGTTTTAAAACGCACCAATATAATC0.151900.026200.681000.750001.000001.00000


Target Position: 3208, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3208UAAUUAUUUUAAAAUAUUU85.8453599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9563226TAATTATTTTAAAATATTTAAATATTTTAAAATAATTA0.234800.124900.534500.500001.000001.00000


Target Position: 1060, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1060CAAGGAAAUAUUUAGGAAA94.509897

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7041078CAAGGAAATATTTAGGAAATTTCCTAAATATTTCCTTG0.153000.047000.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1058-1080ACCAAGGAAATATTTAGGAAAAAUUUCCUAAAUAUUUCCUUGGUCAAGGAAAUAUUUAGGAAAAAU19.918.712


Target Position: 3125, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3125ACACCUGUUCACAGAAAAA89.5546336

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9623143ACACCTGTTCACAGAAAAATTTTTCTGTGAACAGGTGT0.208900.010600.706900.750000.929300.87500


Target Position: 2091, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2091CGAAGAUCCUUUCUUAUAA99.460626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6512109CGAAGATCCTTTCTTATAATTATAAGAAAGGATCTTCG0.231800.037600.758601.000001.000001.00000


Target Position: 3178, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3178CCUUUUUAAAUGUGAAUUU77.64181344

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7513196CCTTTTTAAATGTGAATTTAAATTCACATTTAAAAAGG0.136500.099600.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3176-3198TTCCTTTTTAAATGTGAATTTTTAAAUUCACAUUUAAAAAGGAACCUUUUUAAAUGUGAAUUUUUU14.8-3.801


Target Position: 1134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1134CCAACCUAAGCAAAUGUGA78.08611296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781152CCAACCTAAGCAAATGTGATCACATTTGCTTAGGTTGG0.071000.027200.620700.750001.000001.00000


Target Position: 1133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1133ACCAACCUAAGCAAAUGUG58.05083140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9701151ACCAACCTAAGCAAATGTGCACATTTGCTTAGGTTGGT0.072400.032700.560300.500001.000001.00000


Target Position: 857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
857UGGAAAUGGUGGGAAGAAG63.30182758

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
893875TGGAAATGGTGGGAAGAAGCTTCTTCCCACCATTTCCA0.790200.055400.706900.500001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719ACCAAGAAGGAGAAGAAAA83.0352828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
208737ACCAAGAAGGAGAAGAAAATTTTCTTCTCCTTCTTGGT0.930500.370400.853400.750000.978300.75000


Target Position: 3493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3493UCAAGAUUUUAGGGCUUUU68.93522256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7293511TCAAGATTTTAGGGCTTTTAAAAGCCCTAAAATCTTGA0.145000.070500.724100.750001.000001.00000


Target Position: 3130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3130UGUUCACAGAAAAAGCAUG66.57512469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9033148TGTTCACAGAAAAAGCATGCATGCTTTTTCTGTGAACA0.282500.062000.551700.500001.000001.00000


Target Position: 730, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730GAAGAAAAGAAAACUAGAA97.034855

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
728-750GAGAAGAAAAGAAAACTAGAAGAUUCUAGUUUUCUUUUCUUCUCGAAGAAAAGAAAACUAGAAGAU18.95.522


Target Position: 733, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
733GAAAAGAAAACUAGAAGAA93.6622132

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
731-753AAGAAAAGAAAACTAGAAGAAGAUUCUUCUAGUUUUCUUUUCUUGAAAAGAAAACUAGAAGAAGAU20.25.512


Target Position: 1055, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1055ACUACCAAGGAAAUAUUUA83.0931820

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8801073ACTACCAAGGAAATATTTATAAATATTTCCTTGGTAGT0.094400.024800.672400.750001.000001.00000


Target Position: 748, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
748AGAAGAAGAGGAUGGUAAA93.8769125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
433766AGAAGAAGAGGATGGTAAATTTACCATCCTCTTCTTCT0.309200.236400.724100.750001.000001.00000


Target Position: 3732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3732AUGGAAAAAAAAAAAAAAA77.59111349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7963750ATGGAAAAAAAAAAAAAAATTTTTTTTTTTTTTTCCAT0.994200.855900.655200.500001.000001.00000


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239AGAAUGAAAAAUUACUGAA89.6735329

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8391257AGAATGAAAAATTACTGAATTCAGTAATTTTTCATTCT0.528500.408800.551700.750001.000001.00000


Target Position: 778, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
778CAAGAAUAAAGAUAAAGAU92.2318199

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
776-798CCCAAGAATAAAGATAAAGATAAAUCUUUAUCUUUAUUCUUGGGCAAGAAUAAAGAUAAAGAUAAU6.96.921


Target Position: 2668, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2668CAUCUUUGCGAAAAGAUAA92.6439180

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2666-2688AACATCTTTGCGAAAAGATAAACUUAUCUUUUCGCAAAGAUGUUCAUCUUUGCGAAAAGAUAAACU6.912.013


Target Position: 3652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3652UUCCUCAAGUAUCUUCUAU70.03892148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7653670TTCCTCAAGTATCTTCTATATAGAAGATACTTGAGGAA0.574100.420800.629300.500001.000001.00000


Target Position: 951, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
951UUCCAGAGAAUGUCAAGUU69.21562224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915969TTCCAGAGAATGTCAAGTTAACTTGACATTCTCTGGAA0.142700.015600.525900.500001.000001.00000


Target Position: 1039, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1039GCUCGACCAUGAAUAUACU90.2376298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6281057GCTCGACCATGAATATACTAGTATATTCATGGTCGAGC0.181400.089100.646600.750001.000001.00000


Target Position: 1850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1850UCCAUCAGAUACUAUAACA83.3839793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8161868TCCATCAGATACTATAACATGTTATAGTATCTGATGGA0.445000.174800.663800.500001.000001.00000


Target Position: 583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
583UAGUCCACCACAAAUUAAA79.82041134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662601TAGTCCACCACAAATTAAATTTAATTTGTGGTGGACTA0.573400.321400.672400.500001.000001.00000


Target Position: 675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
675AGGAUGAUGCUGAUUAUAA94.3999102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
453693AGGATGATGCTGATTATAATTATAATCAGCATCATCCT0.321300.074300.810300.750001.000001.00000


Target Position: 1119, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1119AGAAGAAUAUUAUCACCAA99.734323

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7371137AGAAGAATATTATCACCAATTGGTGATAATATTCTTCT0.208600.117500.577600.750001.000001.00000


Target Position: 496, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
496AGACAGAGACAAGGAAAAA89.0115373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
377514AGACAGAGACAAGGAAAAATTTTTCCTTGTCTCTGTCT0.848400.799500.724100.750001.000001.00000


Target Position: 780, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
780AGAAUAAAGAUAAAGAUAA93.2333156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
294798AGAATAAAGATAAAGATAATTATCTTTATCTTTATTCT0.892100.612900.689700.750001.000001.00000


Target Position: 2297, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2297GUAGUAGAGUCAAAGAAGA91.4607240

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2295-2317AGGTAGTAGAGTCAAAGAAGAAGUCUUCUUUGACUCUACUACCUGUAGUAGAGUCAAAGAAGAAGU10.320.102


Target Position: 2991, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2991CCCAUUUCAGGAAUUUAAA83.6785768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7413009CCCATTTCAGGAATTTAAATTTAAATTCCTGAAATGGG0.167900.028100.991401.000000.918500.75000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2989-3011CTCCCATTTCAGGAATTTAAAATUUUAAAUUCCUGAAAUGGGAGCCCAUUUCAGGAAUUUAAAAUU-9.720.112


Target Position: 497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
497GACAGAGACAAGGAAAAAC74.08031720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771515GACAGAGACAAGGAAAAACGTTTTTCCTTGTCTCTGTC0.655600.628400.672400.500001.000001.00000


Target Position: 1296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296GGAUUGCUAACUUCAAGAU87.9973446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6471314GGATTGCTAACTTCAAGATATCTTGAAGTTAGCAATCC0.208700.037800.689701.000001.000001.00000


Target Position: 3332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3332CCAUCAUCCUUUGUUCUGA86.423549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273350CCATCATCCTTTGTTCTGATCAGAACAAAGGATGATGG0.083700.077200.620700.750001.000001.00000


Target Position: 1953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1953UCAAUACUGGUAUUCUGAA83.4931783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211971TCAATACTGGTATTCTGAATTCAGAATACCAGTATTGA0.189200.012800.551700.750001.000001.00000


Target Position: 300, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
300GAUUGAAUGAUUCUCAUAA100.4918

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828318GATTGAATGATTCTCATAATTATGAGAATCATTCAATC0.109200.053900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
298-320CCGATTGAATGATTCTCATAAACUUAUGAGAAUCAUUCAAUCGGGAUUGAAUGAUUCUCAUAAACU21.47.232


Target Position: 1954, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1954CAAUACUGGUAUUCUGAAU88.6469401

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9851972CAATACTGGTATTCTGAATATTCAGAATACCAGTATTG0.152500.009200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1952-1974CTCAATACTGGTATTCTGAATAAAUUCAGAAUACCAGUAUUGAGCAAUACUGGUAUUCUGAAUAAU20.411.602


Target Position: 3483, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3483GGAAAAAUAAUCAAGAUUU88.5864408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7853501GGAAAAATAATCAAGATTTAAATCTTGATTATTTTTCC0.221100.023700.870701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3481-3503AAGGAAAAATAATCAAGATTTTAAAAUCUUGAUUAUUUUUCCUUGGAAAAAUAAUCAAGAUUUUAU12.00.401


Target Position: 1443, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1443GACAUAAGUGGAAAGAAGU83.0716822

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1441-1463AGGACATAAGTGGAAAGAAGTCCACUUCUUUCCACUUAUGUCCUGACAUAAGUGGAAAGAAGUCCU10.311.630


Target Position: 837, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
837AGAAAGAAGAGGAACAGAA90.908262

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
812855AGAAAGAAGAGGAACAGAATTCTGTTCCTCTTCTTTCT0.425400.363100.551700.750001.000001.00000


Target Position: 2917, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2917GUUUUUACAGUUAGGGUUU74.45261685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572935GTTTTTACAGTTAGGGTTTAAACCCTAACTGTAAAAAC0.187600.016700.646600.750001.000001.00000


Target Position: 3349, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3349GAGCAUUCGCUGUACCCUU84.3354710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5823367GAGCATTCGCTGTACCCTTAAGGGTACAGCGAATGCTC0.727600.046500.672400.750000.918500.62500


Target Position: 394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
394GCAUAGCAACAGUGAACAU91.9383217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
276412GCATAGCAACAGTGAACATATGTTCACTGTTGCTATGC0.594700.395400.698301.000001.000001.00000


Target Position: 3350, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3350AGCAUUCGCUGUACCCUUU75.32511584

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5123368AGCATTCGCTGTACCCTTTAAAGGGTACAGCGAATGCT0.743300.061000.853400.750000.934800.62500


Target Position: 3164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3164CUGACUUGAGUGUUCCUUU81.6999960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9163182CTGACTTGAGTGTTCCTTTAAAGGAACACTCAAGTCAG0.085200.014700.784500.750001.000001.00000


Target Position: 1045, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1045CCAUGAAUAUACUACCAAG90.7721272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7771063CCATGAATATACTACCAAGCTTGGTAGTATATTCATGG0.216500.024600.706900.750001.000001.00000


Target Position: 781, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
781GAAUAAAGAUAAAGAUAAA108.322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
353799GAATAAAGATAAAGATAAATTTATCTTTATCTTTATTC0.891800.622900.672400.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
779-801AAGAATAAAGATAAAGATAAAAAUUUAUCUUUAUCUUUAUUCUUGAAUAAAGAUAAAGAUAAAAAU6.9-4.311


Target Position: 3643, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3643CCCACAUCUUUCCUCAAGU75.96171512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2913661CCCACATCTTTCCTCAAGTACTTGAGGAAAGATGTGGG0.586000.164900.784500.750001.000001.00000


Target Position: 1878, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1878UUGAGAAACGAGUUUUUAA82.8818843

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8341896TTGAGAAACGAGTTTTTAATTAAAAACTCGTTTCTCAA0.121800.029600.612100.500001.000001.00000


Target Position: 2735, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2735CUUAUUUAAAAAUAUUUCA82.3877894

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2733-2755AACTTATTTAAAAATATTTCAGAUGAAAUAUUUUUAAAUAAGUUCUUAUUUAAAAAUAUUUCAGAU1.8-7.502


Target Position: 3539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3539AUGGAAAAAAACAUAAAAA84.0019731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573557ATGGAAAAAAACATAAAAATTTTTATGTTTTTTTCCAT0.083000.010900.655200.500001.000001.00000


Target Position: 2595, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2595GGAAAGAUGGAUAAACUGA92.4712189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6302613GGAAAGATGGATAAACTGATCAGTTTATCCATCTTTCC0.181100.092700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2593-2615TGGGAAAGATGGATAAACTGAGCUCAGUUUAUCCAUCUUUCCCAGGAAAGAUGGAUAAACUGAGCU11.814.801


Target Position: 1238, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238GAGAAUGAAAAAUUACUGA89.7324326

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1236-1258AGGAGAATGAAAAATTACTGAAAUCAGUAAUUUUUCAUUCUCCUGAGAAUGAAAAAUUACUGAAAU11.620.411


Target Position: 3472, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3472GUCCAAAAAAAGGAAAAAU75.64421541

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3470-3492TGGTCCAAAAAAAGGAAAAATAAAUUUUUCCUUUUUUUGGACCAGUCCAAAAAAAGGAAAAAUAAU14.320.111


Target Position: 2859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2859UCACUGAAAUGUUUGGAUU74.67711662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9852877TCACTGAAATGTTTGGATTAATCCAAACATTTCAGTGA0.069100.026200.715500.750001.000001.00000


Target Position: 472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
472AGAAAAGCAUAAAGACAAA93.0859164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
424490AGAAAAGCATAAAGACAAATTTGTCTTTATGCTTTTCT0.957000.455200.724100.750001.000001.00000


Target Position: 3636, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3636UCCAUUUCCCACAUCUUUC56.71993225

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7393654TCCATTTCCCACATCTTTCGAAAGATGTGGGAAATGGA0.272600.176300.698300.500001.000001.00000


Target Position: 2188, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2188CUUGCAAACUAAGAUUGAU84.5006699

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2186-2208AACTTGCAAACTAAGATTGATGCAUCAAUCUUAGUUUGCAAGUUCUUGCAAACUAAGAUUGAUGCU20.420.003


Target Position: 3550, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3550CAUAAAAAGCAGAAUUUUA97.070252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3548-3570AACATAAAAAGCAGAATTTTAATUAAAAUUCUGCUUUUUAUGUUCAUAAAAAGCAGAAUUUUAAUU0.4-9.711


Target Position: 1230, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1230UCAAAGAGGAGAAUGAAAA79.94041119

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4481248TCAAAGAGGAGAATGAAAATTTTCATTCTCCTCTTTGA0.566800.403400.724100.750001.000001.00000


Target Position: 399, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
399GCAACAGUGAACAUAAAGA91.2285250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
568417GCAACAGTGAACATAAAGATCTTTATGTTCACTGTTGC0.623200.374100.629300.750001.000001.00000


Target Position: 3243, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3243CUUAAAGAUCGUGUAGAUU78.6571252

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3241-3263ATCTTAAAGATCGTGTAGATTGGAAUCUACACGAUCUUUAAGAUCUUAAAGAUCGUGUAGAUUGGU20.37.113


Target Position: 3504, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3504GGGCUUUUAUUUUUUCUUU82.4166888

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063522GGGCTTTTATTTTTTCTTTAAAGAAAAAATAAAAGCCC0.117500.032500.991401.000001.000001.00000


Target Position: 590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
590CCACAAAUUAAAGAUGAAC69.11212234

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574608CCACAAATTAAAGATGAACGTTCATCTTTAATTTGTGG0.383200.286300.698300.750001.000001.00000


Target Position: 813, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
813CAGAUAACAAGAAAAAGAA95.564977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
651831CAGATAACAAGAAAAAGAATTCTTTTTCTTGTTATCTG0.903800.638600.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
811-833GCCAGATAACAAGAAAAAGAAGCUUCUUUUUCUUGUUAUCUGGCCAGAUAACAAGAAAAAGAAGCU5.514.512


Target Position: 3498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3498AUUUUAGGGCUUUUAUUUU71.9351943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9833516ATTTTAGGGCTTTTATTTTAAAATAAAAGCCCTAAAAT0.069900.034500.508600.500001.000001.00000


Target Position: 2150, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2150AGGGCACCACCAAAAACUU75.79111532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802168AGGGCACCACCAAAAACTTAAGTTTTTGGTGGTGCCCT0.160700.009500.706900.750000.962000.75000


Target Position: 9, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
9UGCGAACUUAGGCUGUUAC60.93242940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
90927TGCGAACTTAGGCTGTTACGTAACAGCCTAAGTTCGCA0.255800.051200.672400.500000.972800.75000


Target Position: 1906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1906ACUAUUUAUGGAGAACAAG65.12182589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8451924ACTATTTATGGAGAACAAGCTTGTTCTCCATAAATAGT0.316800.108700.569000.500001.000001.00000


Target Position: 380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
380CGGGAAAAGUCCAAGCAUA95.343781

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
544398CGGGAAAAGTCCAAGCATATATGCTTGGACTTTTCCCG0.233600.134200.870701.000000.940200.75000


Target Position: 401, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
401AACAGUGAACAUAAAGAUU80.69151054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
840419AACAGTGAACATAAAGATTAATCTTTATGTTCACTGTT0.129000.067200.637900.500001.000001.00000


Target Position: 340, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
340UCGAGAACACCGGCACAAA78.10691294

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
491358TCGAGAACACCGGCACAAATTTGTGCCGGTGTTCTCGA0.329900.064200.793100.750001.000001.00000


Target Position: 1459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1459AGUCCGGCAUGAUAACAAG75.73571533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9771477AGTCCGGCATGATAACAAGCTTGTTATCATGCCGGACT0.071300.023400.569000.500001.000001.00000


Target Position: 3376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3376CCAUCUUUUUCUUUUUAAC74.09331717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4013394CCATCTTTTTCTTTTTAACGTTAAAAAGAAAAAGATGG0.673500.185800.698300.750001.000001.00000


Target Position: 3176, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3176UUCCUUUUUAAAUGUGAAU61.72982877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573194TTCCTTTTTAAATGTGAATATTCACATTTAAAAAGGAA0.151700.115300.663800.500001.000001.00000


Target Position: 1439, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1439CCAGGACAUAAGUGGAAAG75.0091623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8201457CCAGGACATAAGTGGAAAGCTTTCCACTTATGTCCTGG0.154700.020000.706900.750001.000001.00000


Target Position: 1885, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1885ACGAGUUUUUAAGAACCUA82.5159880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6591903ACGAGTTTTTAAGAACCTATAGGTTCTTAAAAACTCGT0.204200.057500.603400.750000.989100.62500


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832GCCGAAGAAAGAAGAGGAA85.2896649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
270850GCCGAAGAAAGAAGAGGAATTCCTCTTCTTTCTTCGGC0.490000.355000.827601.000001.000001.00000


Target Position: 382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
382GGAAAAGUCCAAGCAUAGC65.53052559

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
960400GGAAAAGTCCAAGCATAGCGCTATGCTTGGACTTTTCC0.477800.142200.517200.500000.983700.62500


Target Position: 641, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
641GAGGAUAUAAAGCCAUUAA96.256362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801659GAGGATATAAAGCCATTAATTAATGGCTTTATATCCTC0.132900.021800.775900.750001.000001.00000


Target Position: 2751, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2751UCAGAUAUCAAAAUUCUAG69.00932246

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8642769TCAGATATCAAAATTCTAGCTAGAATTTTGATATCTGA0.135700.050700.551700.500001.000001.00000


Target Position: 1210, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1210CAAGGAAGAGAAACUGAAA98.041742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5271228CAAGGAAGAGAAACTGAAATTTCAGTTTCTCTTCCTTG0.501000.416200.646600.750001.000001.00000


Target Position: 3529, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3529UGUGUAAAAAAUGGAAAAA76.43641465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6653547TGTGTAAAAAATGGAAAAATTTTTCCATTTTTTACACA0.313300.036400.706900.750001.000001.00000


Target Position: 1095, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1095GGAGAAAGGAAAUGACUAA100.08120

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5471113GGAGAAAGGAAATGACTAATTAGTCATTTCCTTTCTCC0.349300.053200.836201.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1093-1115CTGGAGAAAGGAAATGACTAATGUUAGUCAUUUCCUUUCUCCAGGGAGAAAGGAAAUGACUAAUGU20.319.123


Target Position: 747, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
747AAGAAGAAGAGGAUGGUAA86.5914531

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
670765AAGAAGAAGAGGATGGTAATTACCATCCTCTTCTTCTT0.267800.239700.603400.500001.000001.00000


Target Position: 1206, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1206UGAGCAAGGAAGAGAAACU76.05691507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9871224TGAGCAAGGAAGAGAAACTAGTTTCTCTTCCTTGCTCA0.482000.061700.517200.500001.000001.00000


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622CGGAACCAGUAUCGAGAAG68.50082291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621640CGGAACCAGTATCGAGAAGCTTCTCGATACTGGTTCCG0.487300.016300.775900.750001.000001.00000


Target Position: 3721, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3721CCUACAACUUAAUGGAAAA94.92587

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3719-3741TTCCTACAACTTAATGGAAAAAAUUUUCCAUUAAGUUGUAGGAACCUACAACUUAAUGGAAAAAAU20.119.0


Target Position: 1293, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1293AGAGGAUUGCUAACUUCAA91.6847232

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531311AGAGGATTGCTAACTTCAATTGAAGTTAGCAATCCTCT0.194000.011100.577600.750001.000001.00000


Target Position: 1107, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1107UGACUAAUGAAGAGAAGAA90.4071292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8091125TGACTAATGAAGAGAAGAATTCTTCTCTTCATTAGTCA0.653400.210500.551700.750001.000001.00000


Target Position: 1513, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1513AGGUUCCAUUAAAUACAUC70.14182140

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551531AGGTTCCATTAAATACATCGATGTATTTAATGGAACCT0.706300.209800.663800.500001.000001.00000


Target Position: 381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
381GGGAAAAGUCCAAGCAUAG78.86111233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
295399GGGAAAAGTCCAAGCATAGCTATGCTTGGACTTTTCCC0.511800.149600.819000.750000.940200.62500


Target Position: 3724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3724ACAACUUAAUGGAAAAAAA89.9723313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3853742ACAACTTAATGGAAAAAAATTTTTTTCCATTAAGTTGT0.860700.788600.706900.750001.000001.00000


Target Position: 1509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1509UCCAAGGUUCCAUUAAAUA77.49561359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5711527TCCAAGGTTCCATTAAATATATTTAATGGAACCTTGGA0.700600.097100.827600.750001.000001.00000


Target Position: 810, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
810AGCCAGAUAACAAGAAAAA84.9596667

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
298828AGCCAGATAACAAGAAAAATTTTTCTTGTTATCTGGCT0.906200.403700.853400.750001.000001.00000


Target Position: 1213, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1213GGAAGAGAAACUGAAAAUC72.91241850

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4101231GGAAGAGAAACTGAAAATCGATTTTCAGTTTCTCTTCC0.341300.315300.689700.750001.000001.00000


Target Position: 686, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
686GAUUAUAAACCUAAGAAAA99.866721

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
325704GATTATAAACCTAAGAAAATTTTCTTAGGTTTATAATC0.712400.338800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
684-706CTGATTATAAACCTAAGAAAATTUUUUCUUAGGUUUAUAAUCAGGAUUAUAAACCUAAGAAAAUUU7.1-8.022


Target Position: 2368, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2368AGACCGAGAGGAAAAUAAA92.9601171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5122386AGACCGAGAGGAAAATAAATTTATTTTCCTCTCGGTCT0.596700.059600.724100.750001.000001.00000


Target Position: 2373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2373GAGAGGAAAAUAAACAGAU88.7118396

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5862391GAGAGGAAAATAAACAGATATCTGTTTATTTTCCTCTC0.412500.069100.629300.750001.000001.00000


Target Position: 3702, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3702AGGUUAUUUAAAAUAAAUU81.3878994

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8323720AGGTTATTTAAAATAAATTAATTTATTTTAAATAACCT0.108500.047700.836200.750001.000001.00000


Target Position: 1807, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1807UGGUCAGGAAUAUGUGGUA83.986734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7401825TGGTCAGGAATATGTGGTATACCACATATTCCTGACCA0.140900.036400.663800.750001.000001.00000


Target Position: 581, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
581UCUAGUCCACCACAAAUUA80.76671049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533599TCTAGTCCACCACAAATTATAATTTGTGGTGGACTAGA0.595100.363300.689700.750001.000001.00000


Target Position: 1961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961GGUAUUCUGAAUAAGCAUC73.11611832

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6361979GGTATTCTGAATAAGCATCGATGCTTATTCAGAATACC0.685100.039200.672400.750001.000001.00000


Target Position: 1159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1159CCAGAUGAGCCAGUAUUUC67.28952410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6681177CCAGATGAGCCAGTATTTCGAAATACTGGCTCATCTGG0.491700.035900.672400.750001.000001.00000


Target Position: 1851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1851CCAUCAGAUACUAUAACAA99.72124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5281869CCATCAGATACTATAACAATTGTTATAGTATCTGATGG0.245100.087200.698301.000001.000001.00000


Target Position: 3602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3602UUAGAGGCAUUGUUAGUUU72.65851873

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723620TTAGAGGCATTGTTAGTTTAAACTAACAATGCCTCTAA0.126600.019100.534500.500001.000001.00000