Input target sequence

Length: 9829
GGGAGTCCCGGGTCCCCTTCCCACTGCGCGCGGATTTCCCTCTCTGAGGAAGTTTATCCTTGTGCCTTCTGGAGGATTTCTCTCTAGCTCGACTCACTCTGGACTGACTCGCTCCCTGGCTTTCTCAGTTCGTTTTGGGAGATAACTTGTTTTGCTCCAAGCCGCATCCGTTGACCCCTTACAGTCGGATGGTCTAGATGACTGAATGGAGTTTTGAGTTGGACTTTTGTGTCCCTGACGGAGTTGGGCCTGATCCCAGAGCACTGGGGGTGGGGAGGAGGTGTTACTGTAAAATGCAAGTTGGATAAAAGGAGGACCTCTCGCCAAGGGCCCCAATGAGTGGCACACAGTCTACTATCACCGACAGGTTTCCCCTCAAAAAACCTATAAGGCATGGAAGTATTTTGAACCGAGAGTCACCAACAGATAAGAAGCAGAAAGTTGAGCGCATTGCATCACATGATTTTGACCCCACAGATAGCTCCTCCAAGAAGACAAAGTCTAGTTCAGAGGAGAGTAGATCCGAGATATATGGTCTTGTTCAGCGTTGCGTAATCATCCAGAAAGATGACAATGGATTTGGGCTGACGGTCAGTGGAGACAATCCAGTCTTCGTACAGTCTGTCAAAGAAGATGGAGCAGCCATGCGGGCTGGAGTACAGACAGGTGATCGAATCATCAAGGTGAATGGAACTCTGGTGACTCATTCAAATCATCTGGAGGTGGTGAAGCTAATCAAATCTGGTTCCTATGTAGCTCTCACTGTTCAGGGACGCCCACCTGGGTCGCCCCAGATTCCACTTGCCGACTCTGAAGTAGAGCCGTCAGTCATTGGACATATGTCTCCCATCATGACATCTCCTCATTCACCTGGAGCATCTGGGAATATGGAGAGAATCACTAGTCCTGTGCTCATGGGGGAGGAAAACAATGTGGTTCATAACCAGAAAGTAGAAATTCTGAGAAAAATGTTACAGAAAGAACAGGAACGGCTACAGTTATTGCAGGAAGATTACAACCGAACACCTGCCCAAAGATTGCTAAAAGAGATCCAAGAGGCCAAGAAACACATTCCTCAGCTGCAAGAGCAGTTATCCAAAGCCACAGGCTCTGCTCAGGATGGAGCTGTAGTTACACCCTCCAGACCTTTAGGGGACACCCTAACAGTCAGTGAGGCAGAAACAGATCCTGGAGATGTACTGGGCAGGACTGACTGTAGCAGTGGAGATGCTTCTCGGCCCAGTAGTGACAATGCAGATAGTCCCAAGAGTGGCCCAAAAGAGAGAATTTATCTAGAGGAAAACCCAGAGAAAAGTGAAACAATTCAGGACACTGACACTCAATCACTTGTCGGAAGTCCCTCAACCCGTATAGCACCTCATATTATTGGAGCAGAAGATGATGATTTTGGTACTGAACATGAACAGATCAATGGACAGTGCAGCTGTTTCCAGAGCATTGAATTACTAAAATCTCGCCCGGCTCATTTGGCTGTTTTCTTACACCATGTAGTTTCACAATTTGACCCTGCGACTTTGCTCTGTTATCTCTATTCAGACCTGTATAAACATACCAATTCCAAAGAAACTCGTCGCATCTTCCTTGAGTTTCATCAGTTCTTTCTAGATCGATCAGCACACCTGAAAGTTTCTGTTCCTGATGAAATGTCTGCAGATCTAGAAAAGAGAAGACCTGAGCTCATTCCTGAGGATCTGCATCGCCACTATATCCAAACTATGCAAGAAAGAGTCCATCCAGAAGTTCAAAGGCACTTAGAAGATTTTCGGCAGAAACGTAGTATGGGACTGACCTTGGCTGAAAGCGAGCTGACTAAACTTGATGCAGAGCGAGACAAGGACCGATTGACTTTGGAGAAGGAGCGGACATGTGCAGAACAGATTGTTGCCAAAATTGAAGAAGTATTGATGACTGCTCAGGCTGTAGAGGAAGATAAGAGCTCCACCATGCAGTATGTTATTCTCATGTATATGAAGCATTTGGGAGTAAAAGTGAAAGAGCCTCGAAATTTGGAGCACAAACGGGGTCGGATTGGATTTCTTCCCAAAATCAAGCAAAGTATGAAGAAAGATAAAGAAGGGGAAGAAAAAGGGAAGCGAAGAGGATTCCCCAGCATCCTGGGACCCCCACGGAGACCAAGCCGTCATGACAACAGTGCAATTGGCAGAGCCATGGAACTACAGAAGGCGCGCCACCCTAAGCACTTATCCACACCCTCATCTGTGAGTCCTGAACCTCAGGACTCTGCCAAGTTGCGCCAGAGTGGGTTAGCAAATGAAGGAACAGACGCTGGATACCTGCCTGCCAATTCCATGTCTTCTGTAGCTTCAGGGGCCTCTTTTTCCCAGGAAGGAGGGAAAGAGAATGATACAGGATCAAAGCAAGTTGGAGAAACATCAGCACCTGGAGACACCTTAGATGGCACACCTCGTACTCTCAATACTGTCTTTGATTTCCCACCACCTCCATTAGACCAAGTGCAGGAGGAGGAATGTGAAGTAGAAAGGGTGACTGAACATGGGACACCAAAGCCCTTTCGAAAGTTTGACAGTGTAGCTTTTGGAGAAAGTCAAAGTGAGGATGAACAATTTGAAAATGACTTAGAGACAGATCCACCCAACTGGCAGCAGCTTGTTAGTCGAGAAGTGTTACTGGGACTAAAACCTTGTGAAATCAAAAGACAGGAAGTGATTAATGAATTGTTCTACACTGAAAGAGCTCATGTTCGAACACTGAAGGTTCTTGATCAAGTGTTCTATCAGCGAGTATCCAGAGAAGGAATTCTGTCACCCTCAGAGCTACGGAAAATTTTTTCAAACTTGGAAGATATTCTTCAACTTCATATTGGATTGAATGAACAAATGAAGGCTGTTCGAAAGAGAAATGAGACCTCTGTTATCGATCAGATTGGGGAAGATTTGCTGACATGGTTCAGCGGACCAGGAGAGGAGAAATTGAAACATGCTGCTGCTACCTTTTGCAGTAACCAACCTTTCGCCCTGGAAATGATCAAATCTCGTCAGAAAAAGGATTCTCGATTTCAGACTTTTGTGCAAGATGCTGAAAGTAATCCACTGTGTCGTCGTCTTCAACTGAAGGATATTATTCCCACTCAAATGCAAAGGCTTACTAAGTACCCACTTCTGTTGGATAATATTGCCAAATACACAGAATGGCCAACAGAAAGGGAGAAGGTGAAGAAAGCTGCAGATCACTGTCGTCAGATCTTAAATTATGTAAATCAGGCTGTCAAGGAGGCAGAAAACAAGCAGCGCCTAGAAGATTATCAGCGTCGCCTTGATACCTCCAGCCTGAAGTTGTCAGAGTACCCAAATGTTGAAGAGCTCAGGAATTTGGATTTAACAAAAAGGAAGATGATTCATGAAGGGCCATTGGTTTGGAAGGTGAATAGAGATAAAACTATTGATTTATACACGTTGCTGCTGGAAGACATTCTTGTATTGTTACAAAAGCAGGATGATAGACTGGTTTTAAGGTGTCATAGTAAGATTCTGGCATCTACAGCTGATAGCAAACACACGTTTAGCCCTGTCATTAAGTTGAGTACAGTGTTGGTTCGACAAGTGGCAACAGATAACAAAGCTTTATTCGTCATTTCCATGTCAGACAATGGCGCTCAGATTTATGAACTGGTGGCACAGACAGTTTCTGAAAAGACTGTCTGGCAGGACCTAATCTGTCGGATGGCTGCATCAGTGAAGGAGCAATCCACAAAGCCAATTCCATTACCACAGTCAACACCTGGCGAAGGAGATAATGATGAAGAAGATCCTTCAAAATTAAAAGAGGAGCAGCATGGCATTTCAGTCACTGGTTTGCAGAGTCCAGACAGAGATTTGGGATTAGAATCTACCTTAATATCGTCAAAACCTCAGTCTCATTCACTGAGTACCTCTGGGAAATCAGAGGTACGTGATCTGTTTGTGGCTGAGAGACAGTTTGCAAAGGAACAACATACAGATGGGACACTAAAGGAAGTTGGAGAAGATTATCAAATCGCAATCCCAGATTCACACCTGCCTGTCTCAGAAGAACGGTGGGCATTGGATGCACTAAGAAATTTGGGTTTGTTGAAGCAGTTGCTGGTGCAACAGCTAGGTTTGACTGAGAAGAGCGTTCAGGAAGACTGGCAACATTTCCCAAGATACAGAACAGCCTCTCAGGGGCCGCAGACAGACAGTGTCATCCAGAACTCTGAAAATATTAAGGCCTATCATTCTGGTGAAGGACATATGCCCTTTAGAACTGGAACTGGTGACATTGCAACTTGTTACAGTCCACGGACTTCAACTGAATCTTTTGCTCCACGGGATTCAGTGGGACTGGCACCCCAGGATAGCCAGGCAAGTAACATTTTAGTAATGGACCACATGATTATGACCCCAGAGATGCCTACCATGGAGCCAGAAGGGGGTCTTGATGACAGTGGAGAGCACTTTTTTGATGCCCGTGAAGCACATAGTGATGAGAATCCATCAGAAGGTGATGGAGCAGTTAACAAGGAAGAGAAGGATGTTAATTTACGCATCTCAGGAAACTATTTGATCCTTGATGGCTATGACCCAGTGCAGGAGAGTTCCACAGATGAGGAGGTTGCTTCCTCACTTACCCTGCAGCCCATGACAGGCATCCCTGCTGTGGAATCCACCCACCAGCAGCAACATTCTCCTCAGAATACTCACTCCGATGGGGCAATTTCACCATTCACCCCCGAATTTCTGGTCCAGCAGCGCTGGGGAGCTATGGAGTATTCCTGTTTTGAGATCCAGAGTCCCTCCTCTTGTGCAGATTCACAGAGCCAGATCATGGAGTACATTCATAAGATAGAGGCTGACCTTGAACACTTAAAGAAGGTGGAGGAAAGTTACACCATTCTTTGCCAAAGGCTGGCTGGATCAGCCCTCACAGACAAGCACTCAGATAAAAGTTAGAGCCGCATGTCCTGGAGGTGACTGCAGGTTGTTGGATTTGGAGTATCGGCCGTGTCTCACCACATCCTGGCTCCAGTGTGGATGCAGAGAGAGTGTGACAGAGGATCTGCCTGTGAACCACCTGGGATTAGTCAAGTCCCAAGGTGCCCAGAGTGGGACTAGTTCTTCACAGTGTGGCAGCTGCACTAATCTGTTTGTGAGGGAATATCCATTCCCTCACTCTACTCTCCTCACTATCGGAAATTCATTTTGATTCAGAATAAAAACCAAATGTATAGAGCTTTGGGTGTAGGATATGAAATTGTACTTAGATTTAAGAAAAAGAGAAAATCAGATGTATTTATTTGACTTCATTCCGTATTTGAAAGCACATTTTAATTTTTATTTGCCTTGTTTTGTTTTAATTGAGTAGTGAGAGTTTTAGACCTTTGTCTTTAGTACACCCAAGGATCAACTGCTCCTGAAGCAAAGAGGTCAGGATGGAGTATGCAGAAGTTGGGTAGAGAGGTTAAGAAGAGGAGGAAGTGAGACGGGGAAGGGAGGAGCACCTTGCTTCACTATACAGTATTCCAAGCTCTCTGCTGTCCAGTAGGCTGCTTCTCTGAGGGTCACCTCAAAGGTATGCTATGCCGTGTGGCTCTTATGTGCCCAGGTGGTGTGGTCAGAGAGTGGATGGGCTTCCTCCCGCCCTGAGGCAAGCACCTCTTCTCTGTAGCTGGGATCAACCACAATTAATAGGAATCCTCAACATACTAAATAGCAGGCACTTGAAAATGGGTGTGTTTTCTTCCATTGTCGTCTTTTCTATTGAGGGTTGGGATTTGGGTGGGAGAGGAAAGCAAATTTTATTTTCTTGACTATAAATTTGTTATTCTTGGTATCATTTCATTTTTATAATTATACATTAGACATTGGCACTTGTGTAAAACTGTCCCTGCAGATTGAGCAGGAAGTAAAAACAAATGGAAATGCTTCGGATAGTGGCAGGGGTGGGGGTTGCTAAGGAAAGGGTGGGATGGGAGTGGGTAAAGAGTTTGGGAAGGTTATCTAACTGAATCACTACTGAGTTGAATCATGGCTATCATTAGCCACAGGTACTGCTGATTATAAGGCCAGTAAAATTTTAGTACCTGGAGGTTTGACTCTAATTTTTGCACTGATGGTGCCAAAGGGCCCTGAGTCAAAAGGATAGCCAAGGGTGGAGTGGAAAAAGATATGGTGAAGGCAGAACTGCTCACACCAGCTCCAGAAGCACGTCCTCTGACTTCACTGCCGCAGCTCTTTCCACACGGGGCCGTGATTGACCCTAAAAATTGCAGACCAGCACATACACTGGACACTGCAGGCAAGGTGTTGGTAACTGCCTGCTCTAGGATGAATAGTAGCGTTAGCAGCACCCTACAGAGGGTAAGTTTCAGAATTGTAATTTGAGAACTCCTTCAATTATATTGACTTTCTTTGGTTTTCCTTGTGCATTAGGTATATATTTTTTGAAGTATTTTTGCCAACTAAAATGAAGTCTGTAAATTCTGTTAATAAACAAGGAGTTCATCCGTTGCTCACATCTTTCATTGGTGCCCTCTGAACTCTGTGGGTTGCTAGGATGTAATTTTAATGCTTCCCTGCAGTCCAAAGATGATTTTTTCACCACAAATGGTAAGGGATGCCCACCTACTTTTATAAACACCACTGCAACTTAACAAGTTTATTTATCTATGTCCAGATTTCTGTTTCTGTCCTAAATTGATCTGTGTTTTTAGGTGGATCAACTTGGATCTTTAGACCTCATCTATAAATTGAAATTATATTTTTAGTCATAAGCCAAGTACAATCTAACTCAGAATGGGATTAAAAATTTTAGAAGCAGAAGCTAATATATAAATGAAGTTTGGGATTTGGAACTTTCTGTATCTCTTAGGAGGAACAAGTAAAAACCAAATGGTTACATTGTGCTGCTAGAAATAATGTCATTCTCAATTAAAAGGGTTACACCTGTAGCCACTTGACACTAACACCATCGAGGGCAATTAATCAGGAGAAAAGTAAATATAAAAACTTTGCTCTTAACGTCACACACTACAGGGTAATTATGTAATTCTCTAGCACTCAATTAAGAAGCTTGTAGGTTAGCAAAATTTCAGTTTCTCTAGTTCAGCCAGTGTCTTGTCCTTAGTAATTATTTGCTTTCCCTGCAGTTCAATTTCTCCTTGGAACTCTAACAGGACTAACTGGAAAAATACTTTGACCATAGCTCTAGTACTTCCAAATAAATTCATATCTAGATTTTCAAACAAAGCCCCAAGATGAAGTCTAATTCTGAAAATATCTCACAATTTTTGAATGTTCTTTTTATCTTACCGACCTAACTTCTCTTTTCCCTCCCAACTTGGCCTCCCACACGTTCCATTTCATTTTGGCCATTATAGTCACATCCGTTTGACTTTGGTTGTGACATCTTCCTTTCAGGATGATGGAATTAGATGCAGTCTGTCTTTGAGTGAGACTGGTCACCATCAGAGGAGTTTTTTCTAAGTGACGTGACTAGAAGTTGAAATCTACTTCCCTGCTAAAGGGCACAGGGGTGGTGTACAAAGAAAGCTACCTTCCCAGAGCAAGCAGGCTGCATTTTAGCTATGGAAGTGACCTGCTGTGACACTGTGCTCTCTTCTGTGGGCTTAATGGTTCCTTTGCTATGAAGTGGCAAATTACATGTAGAGTGTCTCCTTCCTTTTCAGAGAACAGTTAATCAAGGCAAATCAGCAAGCCCCCAAAGTGCTGTAATTTAACATCATGATTACCACCTTCGAAGCTATATATTTTGCATACTTTAAAATCACCTAACTTGGACTGCTTGAATTACATTGGCTTTTAGAACCGAAATTGTAACTATGTATTGTATTTCATGGGAGGTATATTTTATGAGCTTTTTGGCTTTCTTTTTTCCCACAGCAACTGCCAATGAAGGATGAATCCCCTTTTTAAAAAGTTGTTGTTGTTGTTGTTTATTTGATTTTGAGTTAGGAGGGATAATAGAGAAGTCCATTTAAAAATTATTTTTAGAAGCTAAAGAAAGTAATTATGCTTCCTGTGAATTGTCTTTTACTGGCATCTTTGTTTTCCTCTTTGATGTTAGTAAATTTGGTGTAATACGTGGGGCTTCCATATTTCAAAGTGGAAGCTTTCTTCTCTGAAGTCGATATATGGTTTTGAATTACTAGAGCTTTGGTCAGTATTTCCTTCCCTATATGTCACAGAGGGCACCACTGAGAACTGCGTGCATAGGACCTCAAAATACAAAATTAGCAGGGCCTCACAGTCAGCTTCCTCATGGCTAGTTTTTCCCCCTTATATTACAATTTTTGTTTTATAAGTCATTTTTTTCCTGATATTTCCACCACTTTTCAGAGTCATCTACAAAATTTTTCTTTCCTCAAGAAAAGAGTTCCTTTTGCCTTATTCCTTATGCCTTCCCCACTGGTATTGAGGGTTTTGATAATAAATTGGTAGGAAAAAAAAGTACCTCCTAGAAGGAAGCCTTCCCCACCATTTCCAGGTGCCAACTGCTAAGCAGATATATTCCAAAAATGGTAACTGTCATGTGCACACTGTTGGTTATTTTTAATAAGCCTCTTCCTACTAGAACATTTTATTTTCCTTGTTCACCATACAATCATGTACTCTTTAACAGAAATTGCTTTTAAAAAATATCTGGAACTATCTTTAAAAAAACTTTATTAATAATCATGTATTTTTACTGATCACATTTTGAAATGCCTAAAAGACTTTATTGTTCTAATTATCCAGATGTACCTTTGTAAAATAGCTCTTTTATGAATTAGCTGATAAGGCTGTATGTTTCTGGAACAAAATATTGGTCATCTAAAAACTTTCTGTTTTCTGGGGTCTGGGAAAATAGAAAATAAGATTTCAAATATTAAATAAGCTTAAAGGAACCAAGCATGTGACTTTTTATTTGTATTCTGGTTGATTTGTCTTGTCCAAGTTATATTAGAAAAGTTGAGGAGTCGAGGAGCCTGTAATTAATTTTCCTGTCAGTGACTGTCAGACATCTTCCTGCTTATTAGAGCATCCCTAGCAACAAGGCTAAACCTTCATGACAGTGCTGGCAGGTGGGCTTGCCCTAGCATGTGGGGCAGGTTTGTTGTTTTTTTAATAGCTTTATTGAGATATTCACATATCATATAATTCATCCATTTAAAGTGTATAATCAGATGGGTTTTGGTATATTATTGATTTTTAATTGTGGTGAAATATATATATAACAAAATTTGCTATTGTAACTATTTTTAAGTATAAAGTTCAGTGAGGTAGGCCAGCTTTTATGACGCACCTGAAGATAACTTTGGTTTTAATCCTACCCTAAATGAAGCATATGCCTCTATTTTTCCTGTCCCCAGTGCTGGGCTTCTTCACATACCAACATTTCTGTGCTTTTACCAACAGCATTTTAGCTCAGAAGGCTCGCTTACTTTGGGCATTTGCTGTATTTTGGTTTTGAAATACTTGTAATTTGACTTATTCTTGGGATAATATTTTAGTTTTCAGTCATTCAAGGGCACATTTGGCTGACGGAGCTAATAAGCGTAATAAAATGCTTAGTAGTTTATACCATCTTTTAGTTAAACATTTTAAAGATTAAGACTATTCAAATGTACTTTGCGGAAATTAACCTGTTTGTATGCCTGGCTTTGTTTACAAACATATATCTATATCTATATATATAGATACAGATACAGATACATATCTGGTGGAACAAAGAAATACCTGTACCATTCCCACTTGCTCTTTGATAGCCACCTCCTAGGAATGGAGACAATAAAACTCTGTATTTGCATGTG