siRNAs predicted by more than 1 tools

ToolsTarget Position
Biltr, Ernai, Rnaxs, Sidirect 2035   2922  
Biltr, Sidirect 640   657   668   769   926   1190   1262   1595   1948   2529   2582   2583   2610   2626   2655   2868   2968   3198   3291   3482  
3643   3653   3654   3655   3735   3738   3739   3747   3764   3773   3811   3814   3823  
Biltr, Rnaxs, Sidirect 642   644   775   866   917   929   979   990   996   1191   1231   1232   1281   1283   1295   1297   1617   1940   1941   1949  
2036   2039   2168   2173   2175   2176   2346   2348   2350   2476   2479   2481   2492   2496   2502   2505   2560   2613   2615   2625  
2653   2666   2667   2818   2907   2908   2912   2933   2964   2966   3196   3614   3716   3719   3788   3865  
Biltr, Ernai, Sidirect 3744  
Biltr, Ernai 3696   3697  
Biltr, Ernai, Rnaxs 968   1624   2817   2960   3663  
Biltr, Rnaxs 5   6   7   11   67   68   251   291   292   293   294   295   296   297   356   360   364   365   373   374  
375   376   378   379   383   396   397   401   402   411   412   414   415   416   417   418   419   420   421   450  
474   475   476   479   480   482   483   484   485   486   493   534   537   539   540   551   554   555   578   579  
604   609   610   611   612   613   618   619   623   624   625   629   630   631   632   637   643   645   646   647  
648   653   654   655   656   665   666   667   673   674   675   687   694   695   696   698   699   719   720   721  
722   723   724   725   727   728   729   730   731   732   734   735   743   749   753   754   755   756   757   758  
759   760   761   762   764   765   766   767   768   770   771   772   774   776   782   783   794   795   796   797  
798   801   803   806   822   823   824   825   826   827   828   831   832   833   839   864   865   874   875   876  
900   901   902   903   904   905   906   907   913   914   915   916   927   928   932   933   934   935   936   954  
955   956   957   965   966   967   969   971   972   974   975   976   977   978   980   981   982   986   989   991  
995   997   1001   1005   1006   1007   1008   1009   1010   1011   1014   1015   1016   1020   1021   1022   1040   1041   1044   1046  
1054   1090   1091   1092   1093   1180   1181   1184   1185   1186   1187   1188   1233   1237   1238   1239   1246   1247   1250   1251  
1258   1259   1260   1261   1264   1265   1266   1267   1268   1270   1274   1275   1276   1279   1280   1282   1296   1298   1301   1302  
1303   1304   1305   1310   1318   1319   1321   1322   1323   1325   1342   1343   1344   1345   1370   1371   1372   1380   1381   1382  
1402   1403   1423   1424   1425   1426   1430   1449   1450   1451   1452   1460   1461   1468   1469   1470   1471   1472   1473   1474  
1510   1511   1512   1515   1516   1517   1518   1519   1520   1524   1525   1526   1527   1529   1554   1555   1556   1557   1558   1559  
1563   1564   1565   1596   1597   1612   1614   1615   1622   1623   1625   1634   1635   1660   1661   1662   1666   1667   1707   1784  
1786   1787   1838   1839   1840   1841   1845   1846   1847   1848   1849   1860   1861   1862   1863   1865   1866   1867   1868   1869  
1870   1871   1872   1874   1875   1899   1900   1904   1905   1906   1909   1910   1915   1929   1938   1939   1942   1943   1944   1950  
1960   1961   1962   1963   1964   1967   1968   1969   1972   1973   1974   1982   1983   1985   1987   1990   1991   1992   1993   1994  
1995   2015   2019   2020   2021   2022   2023   2024   2025   2026   2027   2028   2029   2030   2031   2032   2033   2034   2037   2038  
2040   2079   2080   2108   2109   2120   2133   2143   2145   2146   2147   2148   2151   2152   2163   2164   2165   2166   2167   2169  
2170   2171   2172   2174   2177   2178   2179   2180   2181   2182   2183   2184   2201   2243   2246   2247   2248   2249   2250   2251  
2252   2253   2263   2286   2287   2296   2337   2338   2339   2340   2341   2342   2343   2344   2345   2347   2414   2415   2426   2455  
2458   2459   2465   2466   2467   2468   2470   2471   2472   2473   2474   2475   2477   2478   2480   2482   2483   2490   2491   2493  
2494   2495   2497   2498   2501   2503   2504   2506   2507   2508   2514   2515   2516   2517   2526   2527   2528   2533   2536   2537  
2555   2556   2557   2558   2559   2561   2562   2563   2564   2568   2569   2570   2571   2578   2579   2604   2605   2606   2607   2614  
2619   2624   2633   2634   2645   2646   2647   2651   2652   2654   2661   2662   2663   2665   2672   2673   2674   2675   2676   2677  
2685   2686   2687   2688   2689   2690   2694   2698   2699   2700   2743   2744   2745   2748   2784   2785   2786   2787   2788   2789  
2790   2791   2792   2793   2794   2816   2819   2820   2821   2822   2827   2828   2857   2858   2859   2862   2863   2864   2865   2866  
2867   2876   2877   2878   2880   2889   2891   2892   2893   2896   2897   2898   2899   2900   2901   2902   2903   2904   2905   2906  
2909   2910   2911   2913   2914   2916   2920   2921   2923   2924   2925   2929   2932   2934   2935   2947   2952   2953   2954   2958  
2959   2961   2962   2965   2972   2973   2976   2982   2983   2984   2985   2987   2988   2996   2997   2998   3003   3004   3007   3008  
3009   3010   3011   3015   3016   3017   3018   3022   3023   3024   3037   3038   3075   3076   3077   3078   3079   3080   3081   3082  
3083   3129   3130   3131   3132   3133   3134   3138   3139   3140   3141   3151   3152   3153   3158   3159   3160   3165   3166   3167  
3168   3169   3170   3171   3172   3173   3174   3177   3178   3180   3181   3182   3187   3188   3189   3190   3191   3192   3193   3194  
3195   3197   3218   3219   3220   3224   3225   3226   3229   3258   3259   3262   3263   3264   3271   3272   3273   3274   3275   3276  
3277   3278   3279   3280   3292   3293   3299   3300   3304   3305   3306   3311   3312   3313   3314   3316   3317   3318   3319   3321  
3322   3325   3329   3330   3331   3332   3334   3335   3360   3361   3362   3363   3364   3365   3373   3376   3377   3381   3382   3384  
3385   3394   3418   3419   3420   3421   3425   3426   3428   3429   3430   3431   3432   3433   3444   3446   3450   3451   3453   3454  
3456   3457   3458   3461   3462   3467   3468   3469   3470   3471   3472   3492   3493   3494   3498   3499   3500   3502   3503   3506  
3507   3509   3510   3511   3516   3517   3539   3540   3542   3583   3584   3585   3589   3590   3591   3592   3593   3594   3595   3596  
3597   3598   3599   3600   3602   3603   3604   3607   3608   3609   3610   3613   3620   3621   3622   3623   3624   3627   3628   3629  
3632   3633   3634   3635   3661   3662   3664   3703   3704   3705   3706   3712   3713   3714   3715   3718   3720   3723   3724   3725  
3736   3753   3768   3769   3772   3783   3786   3787   3789   3800   3801   3802   3828   3830   3839   3840   3841   3842   3843   3844  
3845   3846   3848   3849   3850   3851   3852   3855   3856   3857   3858   3859   3860   3861   3862   3863   3864   3866   3867  


Target Position: 624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
624GGUCAUAGGGGUUCCACAG75.75561216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
647642GGTCATAGGGGTTCCACAGCTGTGGAACCCCTATGACC0.087600.014600.569000.750000.967400.75000


Target Position: 902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
902GCAAACUUGAUAGGAGAGU64.07742418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
818920GCAAACTTGATAGGAGAGTACTCTCCTATCAAGTTTGC0.043600.006300.646600.750001.000001.00000


Target Position: 2337, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2337AGACUCCAUCUCAGAAAAA87.8728326

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8012355AGACTCCATCTCAGAAAAATTTTTCTGAGATGGAGTCT0.508700.003600.724100.750000.989100.62500


Target Position: 2344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2344AUCUCAGAAAAAAAAAAAA81.6086706

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7662362ATCTCAGAAAAAAAAAAAATTTTTTTTTTTTCTGAGAT0.802200.342600.681000.500001.000001.00000


Target Position: 2032, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2032ACCCCAUCAUUGUUUUUAA87.725333

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1592050ACCCCATCATTGTTTTTAATTAAAAACAATGATGGGGT0.640300.501500.819000.750001.000001.00000


Target Position: 3841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3841UAGUAAGACCUCAAUAAAU84.4897507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8373859TAGTAAGACCTCAATAAATATTTATTGAGGTCTTACTA0.414600.003500.663800.500001.000001.00000


Target Position: 1596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1596GUGUUUGGCACAUAAGUAG73.57311437

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9431614GTGTTTGGCACATAAGTAGCTACTTATGTGCCAAACAC0.018800.002900.620700.500000.989100.62500


Target Position: 604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
604CUGGCCCAGGUUGUUGAAG52.67693350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
905622CTGGCCCAGGTTGTTGAAGCTTCAACAACCTGGGCCAG0.027800.008900.646600.500001.000001.00000


Target Position: 2480, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2480UCUAAAAUUUAAGUAAGUA84.2102528

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7072498TCTAAAATTTAAGTAAGTATACTTACTTAAATTTTAGA0.564600.445000.543100.750001.000001.00000


Target Position: 2527, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2527CUGUUUAUGUGCUCAUCAU89.3556256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9332545CTGTTTATGTGCTCATCATATGATGAGCACATAAACAG0.021400.004700.629300.750001.000001.00000


Target Position: 3753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3753UAGUUAUAUUACAUAUAUA101.5759

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793771TAGTTATATTACATATATATATATATGTAATATAACTA0.027800.001000.629300.500001.000001.00000


Target Position: 926, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
926CCACAAUAGAGCAGUUUAU86.1834403

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
924-946AGCCACAATAGAGCAGTTTATGAAUAAACUGCUCUAUUGUGGCUCCACAAUAGAGCAGUUUAUGAU11.813.532


Target Position: 3418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3418GGGUCUUUGCUCCUGCUAC74.47841328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8913436GGGTCTTTGCTCCTGCTACGTAGCAGGAGCAAAGACCC0.132500.002000.810300.750000.956500.87500


Target Position: 2515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2515AAGAAAAAAAAACUGUUUA81.5703712

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6812533AAGAAAAAAAAACTGTTTATAAACAGTTTTTTTTTCTT0.095300.044500.603400.500001.000001.00000


Target Position: 1949, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1949GCAUUUUUGUUAACCAUAU85.9519415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2691967GCATTTTTGTTAACCATATATATGGTTAACAAAAATGC0.311800.070800.810301.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1947-1969AGGCATTTTTGTTAACCATATCCAUAUGGUUAACAAAAAUGCCUGCAUUUUUGUUAACCAUAUCCU20.0-3.331


Target Position: 3453, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3453GCUCCUCACCUUCCUUCCU71.96331602

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7873471GCTCCTCACCTTCCTTCCTAGGAAGGAAGGTGAGGAGC0.903300.364200.508600.750001.000001.00000


Target Position: 3720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3720GUAACAGCAUUAUUUCAAG79.8813836

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8073738GTAACAGCATTATTTCAAGCTTGAAATAATGCTGTTAC0.071700.055300.543100.500001.000001.00000


Target Position: 379, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
379GCGACCUGGAGUGAAGAGG53.41473308

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
964397GCGACCTGGAGTGAAGAGGCCTCTTCACTCCAGGTCGC0.101700.001100.577600.500001.000001.00000


Target Position: 1865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1865AGAGAAGGCACCAGAAUGA84.1584535

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8191883AGAGAAGGCACCAGAATGATCATTCTGGTGCCTTCTCT0.085300.028800.500000.500001.000001.00000


Target Position: 2495, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2495AGUAAAAGUAGAUAAAUAA98.090134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5602513AGTAAAAGTAGATAAATAATTATTTATCTACTTTTACT0.106500.066900.672400.750001.000001.00000


Target Position: 2348, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2348CAGAAAAAAAAAAAAUUGA83.8367560

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8092366CAGAAAAAAAAAAAATTGATCAATTTTTTTTTTTTCTG0.277400.184800.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2346-2368CTCAGAAAAAAAAAAAATTGAGTUCAAUUUUUUUUUUUUCUGAGCAGAAAAAAAAAAAAUUGAGUU-3.35.511


Target Position: 1612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1612UAGACCACUUAUCCCUCAU72.61481545

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7611630TAGACCACTTATCCCTCATATGAGGGATAAGTGGTCTA0.503800.059500.517200.500000.923900.62500


Target Position: 934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
934GAGCAGUUUAUGAAGAUCU84.5145505

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
701952GAGCAGTTTATGAAGATCTAGATCTTCATAAACTGCTC0.077900.019700.586200.500001.000001.00000


Target Position: 3591, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3591CUCUCUCGACUUCCCAUAC67.80362059

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7053609CTCTCTCGACTTCCCATACGTATGGGAAGTCGAGAGAG0.391400.178800.629300.500001.000001.00000


Target Position: 3498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3498UUUGUUCAUCCUUCAGAAU68.23182008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9493516TTTGTTCATCCTTCAGAATATTCTGAAGGATGAACAAA0.171700.049400.491400.500001.000001.00000


Target Position: 2165, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2165ACCCCAUUCUGCUUUAAAA87.89325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4602183ACCCCATTCTGCTTTAAAATTTTAAAGCAGAATGGGGT0.199900.102600.853400.750001.000001.00000


Target Position: 1846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1846CAUGGAUUAGGAAGGGCAA88.2587299

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8001864CATGGATTAGGAAGGGCAATTGCCCTTCCTAATCCATG0.127000.032500.508600.750001.000001.00000


Target Position: 11, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
11GGGGCUGGGAAGUAGUCGG61.87262633

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
91729GGGGCTGGGAAGTAGTCGGCCGACTACTTCCCAGCCCC0.042400.002200.577600.500001.000001.00000


Target Position: 3166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3166CCUCUCCCUCUAGCUCCCA69.25561895

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8923184CCTCTCCCTCTAGCTCCCATGGGAGCTAGAGGGAGAGG0.604100.555100.500000.750001.000001.00000


Target Position: 3311, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3311ACCCCAUGCCUUCUCCCAU69.10931909

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2703329ACCCCATGCCTTCTCCCATATGGGAGAAGGCATGGGGT0.914200.238400.698300.750000.994600.62500


Target Position: 760, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
760CAGGAAGAGGUUGAACUAA89.8129235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
770778CAGGAAGAGGTTGAACTAATTAGTTCAACCTCTTCCTG0.053100.019200.750000.750001.000001.00000


Target Position: 3196, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3196CUCUAGUUCAUUUUCUUUA86.2952398

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6593214CTCTAGTTCATTTTCTTTATAAAGAAAATGAACTAGAG0.144300.009100.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3194-3216TGCTCTAGTTCATTTTCTTTAGAUAAAGAAAAUGAACUAGAGCACUCUAGUUCAUUUUCUUUAGAU5.518.922


Target Position: 901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
901UGCAAACUUGAUAGGAGAG63.91172434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811919TGCAAACTTGATAGGAGAGCTCTCCTATCAAGTTTGCA0.045300.005200.543100.500001.000001.00000


Target Position: 7, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
7GGGCGGGGCUGGGAAGUAG67.56232091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
93425GGGCGGGGCTGGGAAGTAGCTACTTCCCAGCCCCGCCC0.030700.001400.819000.750001.000001.00000


Target Position: 655, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
655CUCAUAUUUAAGGGAAAAU73.95631387

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
761673CTCATATTTAAGGGAAAATATTTTCCCTTAAATATGAG0.056300.058200.801700.750001.000001.00000


Target Position: 2034, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2034CCCAUCAUUGUUUUUAAAA81.0258756

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
852052CCCATCATTGTTTTTAAAATTTTAAAAACAATGATGGG0.697800.527600.991401.000001.000001.00000


Target Position: 3592, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3592UCUCUCGACUUCCCAUACA73.46771448

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8933610TCTCTCGACTTCCCATACATGTATGGGAAGTCGAGAGA0.396600.185500.517200.500001.000001.00000


Target Position: 1282, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1282UCUUUGUGAUUUUGAGUAA82.9444614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7411300TCTTTGTGATTTTGAGTAATTACTCAAAATCACAAAGA0.061600.010800.689700.750001.000001.00000


Target Position: 251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
251GGCAUGACCGACCCACCAG69.72791838

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
533269GGCATGACCGACCCACCAGCTGGTGGGTCGGTCATGCC0.116300.018800.715500.750000.962000.75000


Target Position: 647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
647UUCAGAAACUCAUAUUUAA86.9733365

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
699665TTCAGAAACTCATATTTAATTAAATATGAGTTTCTGAA0.517700.007200.637900.500001.000001.00000


Target Position: 728, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
728GGGUCAUGUUAAUUGGGAA100.65815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
574746GGGTCATGTTAATTGGGAATTCCCAATTAACATGACCC0.109100.014100.819001.000001.000001.00000


Target Position: 1461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1461GGUUUAUAGGCCCCCUCAG70.42871761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7021479GGTTTATAGGCCCCCTCAGCTGAGGGGGCCTATAAACC0.245300.007000.569000.750000.967400.87500


Target Position: 3516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3516UUCAACUCACAUGUCUCUU59.85372800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8803534TTCAACTCACATGTCTCTTAAGAGACATGTGAGTTGAA0.042200.029100.534500.500001.000001.00000


Target Position: 2184, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2184AAAAAAAAAAAAAAAAUUA85.3982446

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9592202AAAAAAAAAAAAAAAATTATAATTTTTTTTTTTTTTTT0.636800.588000.465500.500001.000001.00000


Target Position: 2517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2517GAAAAAAAAACUGUUUAUG69.82661828

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7622535GAAAAAAAAACTGTTTATGCATAAACAGTTTTTTTTTC0.100500.045700.517200.500001.000001.00000


Target Position: 3159, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3159UCCUCUGCCUCUCCCUCUA74.20461363

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4353177TCCTCTGCCTCTCCCTCTATAGAGGGAGAGGCAGAGGA0.709600.452100.698300.750001.000001.00000


Target Position: 3195, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3195GCUCUAGUUCAUUUUCUUU87.363345

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6213213GCTCTAGTTCATTTTCTTTAAAGAAAATGAACTAGAGC0.152800.011700.853401.000001.000001.00000


Target Position: 3451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3451CAGCUCCUCACCUUCCUUC64.82152342

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7693469CAGCTCCTCACCTTCCTTCGAAGGAAGGTGAGGAGCTG0.465500.224600.612100.500001.000001.00000


Target Position: 3082, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3082UGCUUUUCCCCUCUACUGU64.20332407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5723100TGCTTTTCCCCTCTACTGTACAGTAGAGGGGAAAAGCA0.228500.053400.646600.500001.000001.00000


Target Position: 825, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
825GCUGGAAGAGUUGAAUAAA93.3151126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
742843GCTGGAAGAGTTGAATAAATTTATTCAACTCTTCCAGC0.067200.005300.853401.000001.000001.00000


Target Position: 2143, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2143CCAGCCCAGGCAACAUAGC53.31263315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9292161CCAGCCCAGGCAACATAGCGCTATGTTGCCTGGGCTGG0.114900.001500.491400.500000.951100.75000


Target Position: 2248, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2248CUGAGGCACAAGAAUCAUU81.0164757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9022266CTGAGGCACAAGAATCATTAATGATTCTTGTGCCTCAG0.288500.001900.775900.750001.000001.00000


Target Position: 3865, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3865GAGAACAAAAAAAAAAAAA86.0924408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4133883GAGAACAAAAAAAAAAAAATTTTTTTTTTTTTGTTCTC0.993500.665000.810300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3863-3885TGGAGAACAAAAAAAAAAAAAAAUUUUUUUUUUUUUGUUCUCCAGAGAACAAAAAAAAAAAAAAAU-11.319.200


Target Position: 3226, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3226GUGAUCAUGAAGUGCAAAU78.8387928

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6843244GTGATCATGAAGTGCAAATATTTGCACTTCATGATCAC0.077700.047200.784500.750001.000001.00000


Target Position: 1558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1558GCACCUAGUCAGGAAUAUU88.996275

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9651576GCACCTAGTCAGGAATATTAATATTCCTGACTAGGTGC0.069900.001100.844801.000000.956500.87500


Target Position: 1281, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1281GUCUUUGUGAUUUUGAGUA85.1069470

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6871299GTCTTTGTGATTTTGAGTATACTCAAAATCACAAAGAC0.076900.015700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1279-1301GTGTCTTTGTGATTTTGAGTAAAUACUCAAAAUCACAAAGACACGUCUUUGUGAUUUUGAGUAAAU19.219.222


Target Position: 769, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
769GUUGAACUAAAGAAGUUGA85.5658434

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
767-789AGGTTGAACTAAAGAAGTTGAAAUCAACUUCUUUAGUUCAACCUGUUGAACUAAAGAAGUUGAAAU19.219.222


Target Position: 1237, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1237UGCCAAUUUUCCUACUCUC66.52322187

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8861255TGCCAATTTTCCTACTCTCGAGAGTAGGAAAATTGGCA0.132000.041600.543100.500001.000001.00000


Target Position: 2789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2789CCCACCGCACCCCAACUUU65.36972295

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3602807CCCACCGCACCCCAACTTTAAAGTTGGGGTGCGGTGGG0.372000.044000.991401.000001.000001.00000


Target Position: 1867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1867AGAAGGCACCAGAAUGAGU77.38241060

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8111885AGAAGGCACCAGAATGAGTACTCATTCTGGTGCCTTCT0.284200.020500.517200.500001.000001.00000


Target Position: 1961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1961ACCAUAUCCUUCUGAGUUC66.67032173

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7581979ACCATATCCTTCTGAGTTCGAACTCAGAAGGATATGGT0.259000.203500.681000.500001.000001.00000


Target Position: 1251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1251CUCUCACACUGGUUCUCAA98.4829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6541269CTCTCACACTGGTTCTCAATTGAGAACCAGTGTGAGAG0.086400.051200.663800.750001.000001.00000


Target Position: 2920, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2920UUCAUAUAUAUUAGUCAUU70.18331787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6622938TTCATATATATTAGTCATTAATGACTAATATATATGAA0.105000.100800.663800.500001.000001.00000


Target Position: 1010, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1010GGAAAGGCUUGGUAAAAAA96.667757

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5761028GGAAAGGCTTGGTAAAAAATTTTTTACCAAGCCTTTCC0.192700.013900.870701.000001.000001.00000


Target Position: 876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
876CAAGGAUUUGCAAGCUGAA92.5046147

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
944894CAAGGATTTGCAAGCTGAATTCAGCTTGCAAATCCTTG0.074000.011400.474100.750001.000001.00000


Target Position: 2133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2133GAGUUUGAGACCAGCCCAG71.50891653

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9812151GAGTTTGAGACCAGCCCAGCTGGGCTGGTCTCAAACTC0.011800.001600.525900.500000.945700.62500


Target Position: 2988, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2988GAGGAAACCAAGAGAACUU86.2346400

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7323006GAGGAAACCAAGAGAACTTAAGTTCTCTTGGTTTCCTC0.093800.005800.672400.750001.000001.00000


Target Position: 3844, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3844UAAGACCUCAAUAAAUAUU72.35231566

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8923862TAAGACCTCAATAAATATTAATATTTATTGAGGTCTTA0.400700.002000.525900.500001.000001.00000


Target Position: 1905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1905GCCAACCAUAAACUUCUCA77.8131022

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4781923GCCAACCATAAACTTCTCATGAGAAGTTTATGGTTGGC0.141600.029700.775900.750001.000001.00000


Target Position: 2174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2174UGCUUUAAAAAAAAAAAAA76.54111148

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2452192TGCTTTAAAAAAAAAAAAATTTTTTTTTTTTTAAAGCA0.956500.305700.853400.750001.000001.00000


Target Position: 3828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3828AUAGUCUUGUAUAUAGUAA89.4989249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9443846ATAGTCTTGTATATAGTAATTACTATATACAAGACTAT0.055600.013400.508600.500001.000001.00000


Target Position: 2934, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2934UCAUUUAAUUCUUACAUAA90.3328215

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4762952TCATTTAATTCTTACATAATTATGTAAGAATTAAATGA0.143400.116800.689700.750001.000001.00000


Target Position: 695, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
695CGUUGUCAGCACUUGGAAU89.3383258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850713CGTTGTCAGCACTTGGAATATTCCAAGTGCTGACAACG0.037900.004100.767201.000001.000001.00000


Target Position: 2897, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2897CUGCCGAACACCAUUCUAA89.1394269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5162915CTGCCGAACACCATTCTAATTAGAATGGTGTTCGGCAG0.358700.142700.750000.750000.989100.87500


Target Position: 729, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
729GGUCAUGUUAAUUGGGAAA89.3272259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
566747GGTCATGTTAATTGGGAAATTTCCCAATTAACATGACC0.104600.039600.853401.000001.000001.00000


Target Position: 794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
794UGGAGAAGUCUGUGGAGAA90.2425218

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862812TGGAGAAGTCTGTGGAGAATTCTCCACAGACTTCTCCA0.035200.007200.672400.750001.000001.00000


Target Position: 3078, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3078CCAGUGCUUUUCCCCUCUA84.0694542

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8863096CCAGTGCTTTTCCCCTCTATAGAGGGGAAAAGCACTGG0.711400.002100.672401.000001.000001.00000


Target Position: 990, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
990CAAAGACAGUAGAUUGAAA103.1875

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4151008CAAAGACAGTAGATTGAAATTTCAATCTACTGTCTTTG0.233900.095200.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
988-1010TTCAAAGACAGTAGATTGAAAAGUUUCAAUCUACUGUCUUUGAACAAAGACAGUAGAUUGAAAAGU16.319.212


Target Position: 3842, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3842AGUAAGACCUCAAUAAAUA95.439482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8123860AGTAAGACCTCAATAAATATATTTATTGAGGTCTTACT0.502700.003400.663800.750001.000001.00000


Target Position: 1345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1345CAGCAAUCCACCUUUUCUG72.75181527

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9271363CAGCAATCCACCTTTTCTGCAGAAAAGGTGGATTGCTG0.067400.001500.500000.500001.000001.00000


Target Position: 3151, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3151UCCUCUUGUCCUCUGCCUC55.7223149

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6333169TCCTCTTGTCCTCTGCCTCGAGGCAGAGGACAAGAGGA0.613000.514900.560300.500001.000001.00000


Target Position: 3661, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3661UUGGUUAAUCUUUGCCUUU63.39832490

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8343679TTGGTTAATCTTTGCCTTTAAAGGCAAAGATTAACCAA0.075900.007900.646600.500001.000001.00000


Target Position: 2026, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2026ACCCCCACCCCAUCAUUGU58.71032892

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9122044ACCCCCACCCCATCATTGTACAATGATGGGGTGGGGGT0.608300.524000.646600.500001.000001.00000


Target Position: 3188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3188CCUCUCUGCUCUAGUUCAU81.4147727

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723206CCTCTCTGCTCTAGTTCATATGAACTAGAGCAGAGAGG0.033200.008700.689701.000001.000001.00000


Target Position: 2982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2982AGAGAUGAGGAAACCAAGA81.5208717

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9353000AGAGATGAGGAAACCAAGATCTTGGTTTCCTCATCTCT0.208300.004100.500000.500001.000001.00000


Target Position: 619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
619GAAGAGGUCAUAGGGGUUC61.5552655

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
900637GAAGAGGTCATAGGGGTTCGAACCCCTATGACCTCTTC0.037100.001900.500000.500001.000001.00000


Target Position: 475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
475CGGAGCGAGGAGGUGACCA75.38011244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
836493CGGAGCGAGGAGGTGACCATGGTCACCTCCTCGCTCCG0.040600.015300.569000.750000.962000.75000


Target Position: 3446, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3446UUGAACAGCUCCUCACCUU68.04522031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7933464TTGAACAGCTCCTCACCTTAAGGTGAGGAGCTGTTCAA0.424000.118700.508600.500000.940200.62500


Target Position: 3462, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3462CUUCCUUCCUCCAACCCUA86.1028407

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9613480CTTCCTTCCTCCAACCCTATAGGGTTGGAGGAAGGAAG0.719200.673200.465500.750001.000001.00000


Target Position: 2415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2415AGGCUAGAGGAUCACUUGA81.9005685

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9142433AGGCTAGAGGATCACTTGATCAAGTGATCCTCTAGCCT0.256200.004500.620700.500001.000001.00000


Target Position: 979, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
979CCAGAAAAUUUCAAAGACA93.2219129

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
479997CCAGAAAATTTCAAAGACATGTCTTTGAAATTTTCTGG0.176600.094700.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
977-999TGCCAGAAAATTTCAAAGACAGTUGUCUUUGAAAUUUUCUGGCACCAGAAAAUUUCAAAGACAGUU19.212.222


Target Position: 1666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1666GGGUUCUAGACUUUGUCCU74.57541321

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7751684GGGTTCTAGACTTTGTCCTAGGACAAAGTCTAGAACCC0.051600.012800.646600.750000.902200.62500


Target Position: 3585, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3585GGGAUCCUCUCUCGACUUC67.66552078

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4233603GGGATCCTCTCTCGACTTCGAAGTCGAGAGAGGATCCC0.230700.141200.819000.750000.978300.75000


Target Position: 2109, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2109GGCGGGCGGAUCACUUGAG67.33492114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702127GGCGGGCGGATCACTTGAGCTCAAGTGATCCGCCCGCC0.042600.001100.689700.750000.978300.62500


Target Position: 3663, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3663GGUUAAUCUUUGCCUUUAA97.2844

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_7366319GGTTAATCTTTGCCTTTAA1/1/0/097.21BAG1NM_004323.41NANANA9:33252661..33252679(-)00BAG1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6423681GGTTAATCTTTGCCTTTAATTAAAGGCAAAGATTAACC0.088500.028600.819001.000001.000001.00000


Target Position: 3723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3723ACAGCAUUAUUUCAAGCAU80.6213791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7803741ACAGCATTATTTCAAGCATATGCTTGAAATAATGCTGT0.051100.034900.551700.750000.989100.62500


Target Position: 2036, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2036CAUCAUUGUUUUUAAAAAA95.413183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4542054CATCATTGTTTTTAAAAAATTTTTTAAAAACAATGATG0.517700.421400.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2034-2056CCCATCATTGTTTTTAAAAAATTUUUUUUAAAAACAAUGAUGGGCAUCAUUGUUUUUAAAAAAUUU-9.113.621


Target Position: 3331, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3331UCAUCUCAACCCCCUCAUU70.83951720

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2633349TCATCTCAACCCCCTCATTAATGAGGGGGTTGAGATGA0.931600.795400.715500.750001.000001.00000


Target Position: 2859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2859GGGCCACAACAUUUAAUGA92.9201135

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122877GGGCCACAACATTTAATGATCATTAAATGTTGTGGCCC0.310300.006400.767200.750000.978300.62500


Target Position: 2645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2645GCCCUUUGCGCUAUAACUC65.51212284

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7182663GCCCTTTGCGCTATAACTCGAGTTATAGCGCAAAGGGC0.068900.010500.689700.750000.978300.62500


Target Position: 774, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
774ACUAAAGAAGUUGAAACAU73.70631416

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
674792ACTAAAGAAGTTGAAACATATGTTTCAACTTCTTTAGT0.108100.035200.551700.750001.000001.00000


Target Position: 1093, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1093CUGCAGUCUACAAACUUUG67.95572038

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081111CTGCAGTCTACAAACTTTGCAAAGTTTGTAGACTGCAG0.164300.005000.637900.500000.956500.87500


Target Position: 631, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
631GGGGUUCCACAGUCUUUUC72.12141581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
932649GGGGTTCCACAGTCTTTTCGAAAAGACTGTGGAACCCC0.029800.001400.819000.750001.000001.00000


Target Position: 6, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
6GGGGCGGGGCUGGGAAGUA75.28031252

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
92524GGGGCGGGGCTGGGAAGTATACTTCCCAGCCCCGCCCC0.031200.001500.810301.000001.000001.00000


Target Position: 2570, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2570UUUUUUUUUUUUGGAUUAA66.35692206

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9622588TTTTTTTTTTTTGGATTAATTAATCCAAAAAAAAAAAA0.114100.070400.465500.500001.000001.00000


Target Position: 828, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
828GGAAGAGUUGAAUAAAGAG85.7494422

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
686846GGAAGAGTTGAATAAAGAGCTCTTTATTCAACTCTTCC0.107900.007900.560300.750001.000001.00000


Target Position: 3735, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3735CAAGCAUAACUUGUAAUAU89.41251

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3733-3755TTCAAGCATAACTTGTAATATAGAUAUUACAAGUUAUGCUUGAACAAGCAUAACUUGUAAUAUAGU8.519.722


Target Position: 1707, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1707GCCACAGGCCAUGAGAUAC69.98531805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7331725GCCACAGGCCATGAGATACGTATCTCATGGCCTGTGGC0.117900.005700.819000.750000.929300.62500


Target Position: 2286, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2286UUGCUGUGAGCCGAGAUUA71.64541637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9782304TTGCTGTGAGCCGAGATTATAATCTCGGCTCACAGCAA0.146800.001000.612100.500000.945700.75000


Target Position: 3589, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3589UCCUCUCUCGACUUCCCAU72.83771518

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2483607TCCTCTCTCGACTTCCCATATGGGAAGTCGAGAGAGGA0.331000.162400.715500.750001.000001.00000


Target Position: 2564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2564GCUUUUUUUUUUUUUUUUG65.44622292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5192582GCTTTTTTTTTTTTTTTTGCAAAAAAAAAAAAAAAAGC0.263900.061300.706900.750001.000001.00000


Target Position: 1266, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1266UCAAUGAAAAAUAGUGUCU66.26952214

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8591284TCAATGAAAAATAGTGTCTAGACACTATTTTTCATTGA0.105500.035300.500000.500001.000001.00000


Target Position: 1526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1526CAUAGCUGUAAAACCAGAA89.3258260

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9181544CATAGCTGTAAAACCAGAATTCTGGTTTTACAGCTATG0.127400.030900.482800.750000.902200.75000


Target Position: 1554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1554GGUUGCACCUAGUCAGGAA98.902624

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9631572GGTTGCACCTAGTCAGGAATTCCTGACTAGGTGCAACC0.081400.001100.681001.000000.956500.75000


Target Position: 3738, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3738GCAUAACUUGUAAUAUAGU86.6446382

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3736-3758AAGCATAACTTGTAATATAGTTAACUAUAUUACAAGUUAUGCUUGCAUAACUUGUAAUAUAGUUAU-2.711.613


Target Position: 297, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
297GCGGAUGAAGAAGAAAACC60.60222734

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
833315GCGGATGAAGAAGAAAACCGGTTTTCTTCTTCATCCGC0.231600.053400.569000.500001.000001.00000


Target Position: 1090, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1090CGGCUGCAGUCUACAAACU81.3298733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8601108CGGCTGCAGTCTACAAACTAGTTTGTAGACTGCAGCCG0.243900.002500.706900.750000.972800.75000


Target Position: 1840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1840CAGAGCCAUGGAUUAGGAA88.9951276

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6801858CAGAGCCATGGATTAGGAATTCCTAATCCATGGCTCTG0.436300.008000.612100.750000.978300.75000


Target Position: 2558, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2558UGGUUUGCUUUUUUUUUUU67.73722067

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6842576TGGTTTGCTTTTTTTTTTTAAAAAAAAAAAGCAAACCA0.102200.007900.844800.750001.000001.00000


Target Position: 2958, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2958GAGGUAGACAGAUAUCCUU90.0598224

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9222976GAGGTAGACAGATATCCTTAAGGATATCTGTCTACCTC0.023700.001700.672400.750000.940200.75000


Target Position: 1020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1020GGUAAAAAAGGUUCAGGCA88.3787296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8851038GGTAAAAAAGGTTCAGGCATGCCTGAACCTTTTTTACC0.030700.004800.500000.750001.000001.00000


Target Position: 2167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2167CCCAUUCUGCUUUAAAAAA83.3714591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2112185CCCATTCTGCTTTAAAAAATTTTTTAAAGCAGAATGGG0.767000.123500.991401.000001.000001.00000


Target Position: 2903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2903AACACCAUUCUAAACUAUU76.0231190

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8552921AACACCATTCTAAACTATTAATAGTTTAGAATGGTGTT0.463600.176500.637900.500001.000001.00000


Target Position: 3783, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3783UAUAACAUAACAUAUAUAA87.464341

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7963801TATAACATAACATATATAATTATATATGTTATGTTATA0.276200.090600.508600.500001.000001.00000


Target Position: 775, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
775CUAAAGAAGUUGAAACAUU85.5019438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
576793CTAAAGAAGTTGAAACATTAATGTTTCAACTTCTTTAG0.102800.023400.663800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
773-795AACTAAAGAAGTTGAAACATTTGAAUGUUUCAACUUCUUUAGUUCUAAAGAAGUUGAAACAUUUGU14.87.122


Target Position: 295, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
295CCGCGGAUGAAGAAGAAAA87.1258353

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719313CCGCGGATGAAGAAGAAAATTTTCTTCTTCATCCGCGG0.689800.006200.913801.000001.000001.00000


Target Position: 3004, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3004CUUAGGUCAUUAGCGCAAG64.56722371

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8753022CTTAGGTCATTAGCGCAAGCTTGCGCTAATGACCTAAG0.159800.014500.500000.500001.000001.00000


Target Position: 2913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2913UAAACUAUUCAUAUAUAUU85.8792418

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9762931TAAACTATTCATATATATTAATATATATGAATAGTTTA0.412800.333600.525900.500001.000001.00000


Target Position: 916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
916AGAGUAAAAGCCACAAUAG77.34821064

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
822934AGAGTAAAAGCCACAATAGCTATTGTGGCTTTTACTCT0.467600.056200.551700.500001.000001.00000


Target Position: 1962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1962CCAUAUCCUUCUGAGUUCU78.3513974

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5221980CCATATCCTTCTGAGTTCTAGAACTCAGAAGGATATGG0.235500.207800.620700.750001.000001.00000


Target Position: 1283, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1283CUUUGUGAUUUUGAGUAAA87.2757349

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911301CTTTGTGATTTTGAGTAAATTTACTCAAAATCACAAAG0.048400.006500.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1281-1303GTCTTTGTGATTTTGAGTAAAGCUUUACUCAAAAUCACAAAGACCUUUGUGAUUUUGAGUAAAGCU20.320.532


Target Position: 2039, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2039CAUUGUUUUUAAAAAAUUA96.587258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5072057CATTGTTTTTAAAAAATTATAATTTTTTAAAAACAATG0.443600.363700.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2037-2059ATCATTGTTTTTAAAAAATTAAGUAAUUUUUUAAAAACAAUGAUCAUUGUUUUUAAAAAAUUAAGU-12.05.321


Target Position: 2024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2024CCACCCCCACCCCAUCAUU68.38561993

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1072042CCACCCCCACCCCATCATTAATGATGGGGTGGGGGTGG0.657300.363000.836201.000001.000001.00000


Target Position: 3510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3510UCAGAAUUCAACUCACAUG68.34131999

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6133528TCAGAATTCAACTCACATGCATGTGAGTTGAATTCTGA0.094400.014900.569000.500001.000001.00000


Target Position: 2877, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2877AGAAGUUACUGUGCACCAA89.2194265

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8452895AGAAGTTACTGTGCACCAATTGGTGCACAGTAACTTCT0.038700.024500.577600.750000.983700.62500


Target Position: 761, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
761AGGAAGAGGUUGAACUAAA93.0177133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
749779AGGAAGAGGTTGAACTAAATTTAGTTCAACCTCTTCCT0.059400.034800.844800.750001.000001.00000


Target Position: 2028, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2028CCCCACCCCAUCAUUGUUU65.34712297

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1352046CCCCACCCCATCATTGTTTAAACAATGATGGGGTGGGG0.587100.493500.991401.000001.000001.00000


Target Position: 1899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1899GGUGAAGCCAACCAUAAAC74.27191355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7911917GGTGAAGCCAACCATAAACGTTTATGGTTGGCTTCACC0.076200.003900.706900.750001.000001.00000


Target Position: 2690, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2690GAGAGAGAGUCGUUGAAGU89.1044271

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682708GAGAGAGAGTCGTTGAAGTACTTCAACGACTCTCTCTC0.106000.012700.603400.500001.000001.00000


Target Position: 824, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
824AGCUGGAAGAGUUGAAUAA89.6643245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
890842AGCTGGAAGAGTTGAATAATTATTCAACTCTTCCAGCT0.030500.003300.819000.750001.000001.00000


Target Position: 3259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3259CCCCUGCUUAGAACCCUCC52.98073335

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8663277CCCCTGCTTAGAACCCTCCGGAGGGTTCTAAGCAGGGG0.243500.111100.620700.500001.000001.00000


Target Position: 1990, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1990UCACAGCUGUUCUAUCCAU79.6216864

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6162008TCACAGCTGTTCTATCCATATGGATAGAACAGCTGTGA0.373000.145500.569000.750000.956500.75000


Target Position: 419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
419CCCAGGGCGAAGAGAUGAA81.4389722

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
662437CCCAGGGCGAAGAGATGAATTCATCTCTTCGCCCTGGG0.128200.008900.819001.000000.983700.62500


Target Position: 383, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
383CCUGGAGUGAAGAGGCGAC67.92012046

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
963401CCTGGAGTGAAGAGGCGACGTCGCCTCTTCACTCCAGG0.015400.002000.525900.750001.000001.00000


Target Position: 875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
875CCAAGGAUUUGCAAGCUGA88.0828312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
808893CCAAGGATTTGCAAGCTGATCAGCTTGCAAATCCTTGG0.046000.012400.620700.750001.000001.00000


Target Position: 3139, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3139CUCUGAUUUUUUUCCUCUU80.5624798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3373157CTCTGATTTTTTTCCTCTTAAGAGGAAAAAAATCAGAG0.673800.509500.672400.750001.000001.00000


Target Position: 2876, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2876GAGAAGUUACUGUGCACCA91.6914178

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702894GAGAAGTTACTGTGCACCATGGTGCACAGTAACTTCTC0.051100.028900.465500.500000.983700.62500


Target Position: 579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
579CAGCAGUGAACCAGUUGUC71.60421639

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
979597CAGCAGTGAACCAGTTGTCGACAACTGGTTCACTGCTG0.073000.005200.465500.500000.994600.62500


Target Position: 3596, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3596UCGACUUCCCAUACAUUUC59.11952862

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5503614TCGACTTCCCATACATTTCGAAATGTATGGGAAGTCGA0.555400.261000.620700.500001.000001.00000


Target Position: 2177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2177UUUAAAAAAAAAAAAAAAA74.22811361

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8382195TTTAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTAAA0.961400.916800.500000.500001.000001.00000


Target Position: 375, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
375GGAAGCGACCUGGAGUGAA86.9868362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
830393GGAAGCGACCTGGAGTGAATTCACTCCAGGTCGCTTCC0.164600.003000.698301.000001.000001.00000


Target Position: 3170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3170UCCCUCUAGCUCCCACUUC48.99113526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513188TCCCTCTAGCTCCCACTTCGAAGTGGGAGCTAGAGGGA0.770200.415200.698300.500000.978300.75000


Target Position: 1014, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1014AGGCUUGGUAAAAAAGGUU71.74491622

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9531032AGGCTTGGTAAAAAAGGTTAACCTTTTTTACCAAGCCT0.134400.001200.698300.750001.000001.00000


Target Position: 1239, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1239CCAAUUUUCCUACUCUCAC68.23072009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6721257CCAATTTTCCTACTCTCACGTGAGAGTAGGAAAATTGG0.127200.015200.551700.750001.000001.00000


Target Position: 826, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
826CUGGAAGAGUUGAAUAAAG76.98241100

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
719844CTGGAAGAGTTGAATAAAGCTTTATTCAACTCTTCCAG0.733600.010500.646600.500001.000001.00000


Target Position: 1525, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1525CCAUAGCUGUAAAACCAGA89.0846273

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5241543CCATAGCTGTAAAACCAGATCTGGTTTTACAGCTATGG0.128200.029000.620700.750000.902200.62500


Target Position: 1296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1296AGUAAAGCUCCUAUCUGUU82.1394671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7871314AGTAAAGCTCCTATCTGTTAACAGATAGGAGCTTTACT0.111800.004000.560300.750001.000001.00000


Target Position: 612, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
612GGUUGUUGAAGAGGUCAUA91.9896166

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
917630GGTTGTTGAAGAGGTCATATATGACCTCTTCAACAACC0.024600.003300.810301.000001.000001.00000


Target Position: 694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
694CCGUUGUCAGCACUUGGAA84.2961521

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
971712CCGTTGTCAGCACTTGGAATTCCAAGTGCTGACAACGG0.046500.001100.741401.000001.000001.00000


Target Position: 1597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1597UGUUUGGCACAUAAGUAGA78.8343929

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9171615TGTTTGGCACATAAGTAGATCTACTTATGTGCCAAACA0.032800.002400.482800.500001.000001.00000


Target Position: 2907, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2907CCAUUCUAAACUAUUCAUA88.9701277

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1982925CCATTCTAAACTATTCATATATGAATAGTTTAGAATGG0.457100.205100.801701.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2905-2927CACCATTCTAAACTATTCATATAUAUGAAUAGUUUAGAAUGGUGCCAUUCUAAACUAUUCAUAUAU8.713.422


Target Position: 1786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1786AGUCUUCAGAAGGUUAGAA84.6475494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7521804AGTCTTCAGAAGGTTAGAATTCTAACCTTCTGAAGACT0.058900.005800.534500.750001.000001.00000


Target Position: 1787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1787GUCUUCAGAAGGUUAGAAC69.98061806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7571805GTCTTCAGAAGGTTAGAACGTTCTAACCTTCTGAAGAC0.057300.008200.672400.500001.000001.00000


Target Position: 1267, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1267CAAUGAAAAAUAGUGUCUU83.6263575

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8121285CAATGAAAAATAGTGTCTTAAGACACTATTTTTCATTG0.109900.042400.508600.750001.000001.00000


Target Position: 2468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2468CAAGACCCCAUCUCUAAAA86.6329383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4272486CAAGACCCCATCTCTAAAATTTTAGAGATGGGGTCTTG0.294300.166500.646600.750000.929300.62500


Target Position: 2998, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2998AGAGAACUUAGGUCAUUAG77.88431016

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7423016AGAGAACTTAGGTCATTAGCTAATGACCTAAGTTCTCT0.061200.013500.551700.500001.000001.00000


Target Position: 2786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2786CAGCCCACCGCACCCCAAC56.82653052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262804CAGCCCACCGCACCCCAACGTTGGGGTGCGGTGGGCTG0.260800.018700.637900.500000.929300.75000


Target Position: 2528, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2528UGUUUAUGUGCUCAUCAUA88.3544298

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8752546TGTTTATGTGCTCATCATATATGATGAGCACATAAACA0.051400.002200.663800.750001.000001.00000


Target Position: 833, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
833AGUUGAAUAAAGAGCUUAC75.87651202

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
788851AGTTGAATAAAGAGCTTACGTAAGCTCTTTATTCAACT0.049200.004200.525900.500001.000001.00000


Target Position: 3273, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3273CCUCCAAUGGCUCACUUUC67.51272102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3433291CCTCCAATGGCTCACTTTCGAAAGTGAGCCATTGGAGG0.645900.101100.672400.750001.000001.00000


Target Position: 980, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
980CAGAAAAUUUCAAAGACAG79.6404861

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
857998CAGAAAATTTCAAAGACAGCTGTCTTTGAAATTTTCTG0.145600.056400.500000.500001.000001.00000


Target Position: 935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
935AGCAGUUUAUGAAGAUCUU82.1829666

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
762953AGCAGTTTATGAAGATCTTAAGATCTTCATAAACTGCT0.056200.014800.715500.750001.000001.00000


Target Position: 2822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2822ACUAUUGAUCUAUUUUUGU72.34121569

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8432840ACTATTGATCTATTTTTGTACAAAAATAGATCAATAGT0.130800.065000.500000.500001.000001.00000


Target Position: 2479, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2479CUCUAAAAUUUAAGUAAGU79.4857877

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7762497CTCTAAAATTTAAGTAAGTACTTACTTAAATTTTAGAG0.568700.377000.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2477-2499ATCTCTAAAATTTAAGTAAGTAAACUUACUUAAAUUUUAGAGAUCUCUAAAAUUUAAGUAAGUAAU9.87.132


Target Position: 3509, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3509UUCAGAAUUCAACUCACAU74.47431332

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713527TTCAGAATTCAACTCACATATGTGAGTTGAATTCTGAA0.143700.028500.517200.500001.000001.00000


Target Position: 1862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1862CAAAGAGAAGGCACCAGAA95.810573

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9491880CAAAGAGAAGGCACCAGAATTCTGGTGCCTTCTCTTTG0.042400.045800.474100.750001.000001.00000


Target Position: 2987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2987UGAGGAAACCAAGAGAACU73.39631457

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9433005TGAGGAAACCAAGAGAACTAGTTCTCTTGGTTTCCTCA0.108000.005000.517200.500001.000001.00000


Target Position: 719, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
719AUGGUUGCCGGGUCAUGUU67.09522133

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
937737ATGGTTGCCGGGTCATGTTAACATGACCCGGCAACCAT0.073200.001400.508600.500001.000001.00000


Target Position: 1185, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1185UGGAGCGGAAUUUACCUGA68.32012001

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9051203TGGAGCGGAATTTACCTGATCAGGTAAATTCCGCTCCA0.030700.004300.620700.500000.951100.87500


Target Position: 2962, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2962UAGACAGAUAUCCUUAUUU77.94561003

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552980TAGACAGATATCCTTATTTAAATAAGGATATCTGTCTA0.016900.002100.672400.500000.940200.62500


Target Position: 2346, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2346CUCAGAAAAAAAAAAAAUU76.89421110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2702364CTCAGAAAAAAAAAAAATTAATTTTTTTTTTTTCTGAG0.542000.324700.801700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2344-2366ATCTCAGAAAAAAAAAAAATTGAAAUUUUUUUUUUUUCUGAGAUCUCAGAAAAAAAAAAAAUUGAU-12.020.411


Target Position: 3171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3171CCCUCUAGCUCCCACUUCC66.28162212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7723189CCCTCTAGCTCCCACTTCCGGAAGTGGGAGCTAGAGGG0.514800.221000.620700.500000.978300.87500


Target Position: 732, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
732CAUGUUAAUUGGGAAAAAG75.191258

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
869750CATGTTAATTGGGAAAAAGCTTTTTCCCAATTAACATG0.311800.034600.517200.500001.000001.00000


Target Position: 1635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1635ACCUAAUUCCAGAGCAUCU76.5531146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8791653ACCTAATTCCAGAGCATCTAGATGCTCTGGAATTAGGT0.031900.005600.629300.500001.000001.00000


Target Position: 2474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2474CCCAUCUCUAAAAUUUAAG63.9082436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3752492CCCATCTCTAAAATTTAAGCTTAAATTTTAGAGATGGG0.549600.253100.853400.750001.000001.00000


Target Position: 2179, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2179UAAAAAAAAAAAAAAAAAA80.6168792

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992197TAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTA0.915100.870900.534500.500001.000001.00000


Target Position: 1370, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1370GCCACCUCUGCCCAAAUUU70.01981803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5371388GCCACCTCTGCCCAAATTTAAATTTGGGCAGAGGTGGC0.143600.016001.000001.000001.000001.00000


Target Position: 2604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2604GUGGCUCUAGUCAUAAUUU85.0102472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9762622GTGGCTCTAGTCATAATTTAAATTATGACTAGAGCCAC0.017300.001000.793100.750001.000001.00000


Target Position: 3507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3507CCUUCAGAAUUCAACUCAC79.5278871

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6623525CCTTCAGAATTCAACTCACGTGAGTTGAATTCTGAAGG0.134000.031100.551700.750001.000001.00000


Target Position: 1191, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1191GGAAUUUACCUGAUUUCUU86.9268366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9671209GGAATTTACCTGATTTCTTAAGAAATCAGGTAAATTCC0.014300.005400.732801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1189-1211GCGGAATTTACCTGATTTCTTCAAAGAAAUCAGGUAAAUUCCGCGGAAUUUACCUGAUUUCUUCAU14.82.132


Target Position: 2494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2494AAGUAAAAGUAGAUAAAUA101.44611

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8052512AAGTAAAAGTAGATAAATATATTTATCTACTTTTACTT0.088600.064500.594800.500001.000001.00000


Target Position: 1008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1008AAGGAAAGGCUUGGUAAAA78.6937943

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7701026AAGGAAAGGCTTGGTAAAATTTTACCAAGCCTTTCCTT0.083700.022400.637900.500001.000001.00000


Target Position: 3787, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3787ACAUAACAUAUAUAACAUA95.99472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8243805ACATAACATATATAACATATATGTTATATATGTTATGT0.042300.021000.663800.750001.000001.00000


Target Position: 3421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3421UCUUUGCUCCUGCUACUAC63.14912515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7303439TCTTTGCTCCTGCTACTACGTAGTAGCAGGAGCAAAGA0.250500.007100.543100.500000.956501.00000


Target Position: 2619, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2619AUUUAUGCUUAAUAACAUU80.9567764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8472637ATTTATGCTTAATAACATTAATGTTATTAAGCATAAAT0.360600.220100.500000.500000.907600.62500


Target Position: 1092, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1092GCUGCAGUCUACAAACUUU93.056132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8681110GCTGCAGTCTACAAACTTTAAAGTTTGTAGACTGCAGC0.163800.002400.853401.000000.956500.75000


Target Position: 986, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
986AUUUCAAAGACAGUAGAUU73.06071494

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8361004ATTTCAAAGACAGTAGATTAATCTACTGTCTTTGAAAT0.164000.049800.500000.500001.000001.00000


Target Position: 1983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1983GUUUCCUUCACAGCUGUUC56.93073042

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9522001GTTTCCTTCACAGCTGTTCGAACAGCTGTGAAGGAAAC0.223700.153900.474100.500001.000001.00000


Target Position: 356, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
356AGGAGUUGACCCUGAGUGA83.8112564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
940374AGGAGTTGACCCTGAGTGATCACTCAGGGTCAACTCCT0.031600.001300.620700.500000.923900.62500


Target Position: 771, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
771UGAACUAAAGAAGUUGAAA81.7665696

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
493789TGAACTAAAGAAGTTGAAATTTCAACTTCTTTAGTTCA0.134000.029600.724100.750000.972800.75000


Target Position: 3220, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3220GCCCGAGUGAUCAUGAAGU76.60251144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9573238GCCCGAGTGATCATGAAGTACTTCATGATCACTCGGGC0.144000.001100.793100.750001.000001.00000


Target Position: 2819, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2819UUCACUAUUGAUCUAUUUU70.35641770

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6962837TTCACTATTGATCTATTTTAAAATAGATCAATAGTGAA0.115900.007300.672400.500001.000001.00000


Target Position: 696, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
696GUUGUCAGCACUUGGAAUA82.8087621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
883714GTTGTCAGCACTTGGAATATATTCCAAGTGCTGACAAC0.031300.023200.603400.750001.000001.00000


Target Position: 1451, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1451GCCAGUUUCAGGUUUAUAG74.81381305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9461469GCCAGTTTCAGGTTTATAGCTATAAACCTGAAACTGGC0.018400.001300.827600.750000.972800.75000


Target Position: 954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
954GGAGGAGAUUGACACACUG85.2391461

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
926972GGAGGAGATTGACACACTGCAGTGTGTCAATCTCCTCC0.214400.001500.586200.750001.000001.00000


Target Position: 1622, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1622AUCCCUCAUUGUGACCUAA81.1372746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9791640ATCCCTCATTGTGACCTAATTAGGTCACAATGAGGGAT0.084200.059900.646600.500001.000001.00000


Target Position: 2475, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2475CCAUCUCUAAAAUUUAAGU79.1387902

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4502493CCATCTCTAAAATTTAAGTACTTAAATTTTAGAGATGG0.544000.274200.637900.750001.000001.00000


Target Position: 2968, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2968GAUAUCCUUAUUUUAGAGA83.8359561

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2966-2988CAGATATCCTTATTTTAGAGATGUCUCUAAAAUAAGGAUAUCUGGAUAUCCUUAUUUUAGAGAUGU11.719.922


Target Position: 3713, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3713UAUCUUGGUAACAGCAUUA82.9874609

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7913731TATCTTGGTAACAGCATTATAATGCTGTTACCAAGATA0.329800.012500.508600.500001.000001.00000


Target Position: 2615, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2615CAUAAUUUAUGCUUAAUAA102.5567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5102633CATAATTTATGCTTAATAATTATTAAGCATAAATTATG0.471300.077400.620700.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2613-2635GTCATAATTTATGCTTAATAACAUUAUUAAGCAUAAAUUAUGACCAUAAUUUAUGCUUAAUAACAU-2.3-10.313


Target Position: 3511, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3511CAGAAUUCAACUCACAUGU75.96541196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6773529CAGAATTCAACTCACATGTACATGTGAGTTGAATTCTG0.079000.013700.577600.500001.000001.00000


Target Position: 2345, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2345UCUCAGAAAAAAAAAAAAU70.26371783

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2802363TCTCAGAAAAAAAAAAAATATTTTTTTTTTTTCTGAGA0.683000.340100.715500.750001.000001.00000


Target Position: 3225, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3225AGUGAUCAUGAAGUGCAAA86.1388406

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6593243AGTGATCATGAAGTGCAAATTTGCACTTCATGATCACT0.084900.030000.706900.750001.000001.00000


Target Position: 3715, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3715UCUUGGUAACAGCAUUAUU76.21381175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5823733TCTTGGTAACAGCATTATTAATAATGCTGTTACCAAGA0.305200.013700.715500.750001.000001.00000


Target Position: 1942, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1942UUCAAAGGCAUUUUUGUUA69.63611852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8611960TTCAAAGGCATTTTTGTTATAACAAAAATGCCTTTGAA0.184200.002500.637900.500000.994600.62500


Target Position: 3182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3182CCACUUCCUCUCUGCUCUA89.6936244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9653200CCACTTCCTCTCTGCTCTATAGAGCAGAGAGGAAGTGG0.015000.015900.672401.000001.000001.00000


Target Position: 625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
625GUCAUAGGGGUUCCACAGU69.07281916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
763643GTCATAGGGGTTCCACAGTACTGTGGAACCCCTATGAC0.055600.011000.612100.500000.967400.75000


Target Position: 3450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3450ACAGCUCCUCACCUUCCUU74.82061304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6253468ACAGCTCCTCACCTTCCTTAAGGAAGGTGAGGAGCTGT0.469900.175900.569000.750001.000001.00000


Target Position: 2516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2516AGAAAAAAAAACUGUUUAU81.6716702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6192534AGAAAAAAAAACTGTTTATATAAACAGTTTTTTTTTCT0.093000.044400.681000.750001.000001.00000


Target Position: 3654, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3654GGAUUAUUUGGUUAAUCUU91.1897191

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3652-3674TGGGATTATTTGGTTAATCTTTGAAGAUUAACCAAAUAAUCCCAGGAUUAUUUGGUUAAUCUUUGU6.91.821


Target Position: 3542, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3542GAACCCUCACCUACUGUGU76.14571180

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9723560GAACCCTCACCTACTGTGTACACAGTAGGTGAGGGTTC0.021300.015700.465500.500000.940200.62500


Target Position: 1268, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1268AAUGAAAAAUAGUGUCUUU86.6316384

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981286AATGAAAAATAGTGTCTTTAAAGACACTATTTTTCATT0.119100.048700.508600.500001.000001.00000


Target Position: 2827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2827UGAUCUAUUUUUGUGUGAU79.4491880

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7062845TGATCTATTTTTGTGTGATATCACACAAAAATAGATCA0.091000.012700.543100.750001.000001.00000


Target Position: 1595, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1595GGUGUUUGGCACAUAAGUA98.731425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1593-1615AAGGTGTTTGGCACATAAGTAGAUACUUAUGUGCCAAACACCUUGGUGUUUGGCACAUAAGUAGAU11.619.333


Target Position: 2700, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2700CGUUGAAGUCCCAGGAAUU88.1683304

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8112718CGTTGAAGTCCCAGGAATTAATTCCTGGGACTTCAACG0.046900.003400.767201.000001.000001.00000


Target Position: 720, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
720UGGUUGCCGGGUCAUGUUA73.58931434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
928738TGGTTGCCGGGTCATGTTATAACATGACCCGGCAACCA0.088400.001500.810300.750001.000001.00000


Target Position: 823, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
823CAGCUGGAAGAGUUGAAUA94.657997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
899841CAGCTGGAAGAGTTGAATATATTCAACTCTTCCAGCTG0.029100.003800.741400.750001.000001.00000


Target Position: 2677, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2677ACAUCAUUUGGCAGAGAGA84.424512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9202695ACATCATTTGGCAGAGAGATCTCTCTGCCAAATGATGT0.035800.015500.482800.500001.000001.00000


Target Position: 2079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2079GCCUAUAAUCCCAGCACUU82.7376626

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312097GCCTATAATCCCAGCACTTAAGTGCTGGGATTATAGGC0.037500.001400.862101.000000.994600.75000


Target Position: 396, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
396GGCGACCCAGAGUGAGGAG67.6632079

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
824414GGCGACCCAGAGTGAGGAGCTCCTCACTCTGGGTCGCC0.132000.003200.689700.750000.934800.62500


Target Position: 1232, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1232CCAUUUGCCAAUUUUCCUA83.8586558

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4821250CCATTTGCCAATTTTCCTATAGGAAAATTGGCAAATGG0.138800.026500.672401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1230-1252GGCCATTTGCCAATTTTCCTACTUAGGAAAAUUGGCAAAUGGCCCCAUUUGCCAAUUUUCCUACUU18.720.023


Target Position: 493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
493AGGGAGGAAAUGGCGGCAG50.1753472

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
767511AGGGAGGAAATGGCGGCAGCTGCCGCCATTTCCTCCCT0.054400.060300.560300.500001.000001.00000


Target Position: 1993, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1993CAGCUGUUCUAUCCAUUUU84.3708514

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3922011CAGCTGTTCTATCCATTTTAAAATGGATAGAACAGCTG0.384600.182100.784500.750001.000001.00000


Target Position: 3079, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3079CAGUGCUUUUCCCCUCUAC71.0091700

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9403097CAGTGCTTTTCCCCTCTACGTAGAGGGGAAAAGCACTG0.708000.014300.603400.500001.000001.00000


Target Position: 722, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
722GUUGCCGGGUCAUGUUAAU76.12931181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
922740GTTGCCGGGTCATGTTAATATTAACATGACCCGGCAAC0.124600.001600.637900.750001.000001.00000


Target Position: 1449, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1449GGGCCAGUUUCAGGUUUAU82.4828646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541467GGGCCAGTTTCAGGTTTATATAAACCTGAAACTGGCCC0.232800.002600.948301.000000.972800.87500


Target Position: 2651, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2651UGCGCUAUAACUCUACCUA81.5882710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4472669TGCGCTATAACTCTACCTATAGGTAGAGTTATAGCGCA0.300800.028000.681000.750001.000001.00000


Target Position: 1270, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1270UGAAAAAUAGUGUCUUUGU73.55171440

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7631288TGAAAAATAGTGTCTTTGTACAAAGACACTATTTTTCA0.145500.066000.517200.500001.000001.00000


Target Position: 3272, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3272CCCUCCAAUGGCUCACUUU76.36941164

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2363290CCCTCCAATGGCTCACTTTAAAGTGAGCCATTGGAGGG0.364600.094000.991401.000000.956500.75000


Target Position: 727, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
727CGGGUCAUGUUAAUUGGGA79.6119866

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
692745CGGGTCATGTTAATTGGGATCCCAATTAACATGACCCG0.114600.009000.543100.750001.000001.00000


Target Position: 3219, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3219AGCCCGAGUGAUCAUGAAG69.25061896

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9303237AGCCCGAGTGATCATGAAGCTTCATGATCACTCGGGCT0.156600.001400.715500.500001.000001.00000


Target Position: 2868, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2868CAUUUAAUGAGAAGUUACU83.5578578

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2866-2888AACATTTAATGAGAAGTTACTGTAGUAACUUCUCAUUAAAUGUUCAUUUAAUGAGAAGUUACUGUU12.9-10.312


Target Position: 1623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1623UCCCUCAUUGUGACCUAAU67.01622141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6221641TCCCTCATTGTGACCTAATATTAGGTCACAATGAGGGA0.091700.063700.862100.750001.000001.00000


Target Position: 378, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
378AGCGACCUGGAGUGAAGAG64.02942424

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
770396AGCGACCTGGAGTGAAGAGCTCTTCACTCCAGGTCGCT0.197200.004600.543100.500001.000001.00000


Target Position: 2634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2634CAUUGAUAGUAGCCCUUUG80.5342800

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9442652CATTGATAGTAGCCCTTTGCAAAGGGCTACTATCAATG0.018800.002100.508600.500001.000001.00000


Target Position: 3866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3866AGAACAAAAAAAAAAAAAA86.7537377

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3393884AGAACAAAAAAAAAAAAAATTTTTTTTTTTTTTGTTCT0.994800.668200.724100.750001.000001.00000


Target Position: 1968, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1968CCUUCUGAGUUCUAUGUUU87.6221338

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1711986CCTTCTGAGTTCTATGTTTAAACATAGAACTCAGAAGG0.509100.181100.844801.000001.000001.00000


Target Position: 1969, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1969CUUCUGAGUUCUAUGUUUC73.33721462

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9671987CTTCTGAGTTCTATGTTTCGAAACATAGAACTCAGAAG0.512900.183000.465500.500001.000001.00000


Target Position: 2180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2180AAAAAAAAAAAAAAAAAAA83.5835576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8232198AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.909900.862000.500000.500001.000001.00000


Target Position: 2578, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2578UUUUGGAUUAAUGAGGAAA71.09141693

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9702596TTTTGGATTAATGAGGAAATTTCCTCATTAATCCAAAA0.013800.006200.500000.500001.000001.00000


Target Position: 1617, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1617CACUUAUCCCUCAUUGUGA89.8522231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6111635CACTTATCCCTCATTGTGATCACAATGAGGGATAAGTG0.095100.029200.569000.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1615-1637ACCACTTATCCCTCATTGTGACCUCACAAUGAGGGAUAAGUGGUCACUUAUCCCUCAUUGUGACCU18.114.533


Target Position: 743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
743GGAAAAAGAACAGUCCACA88.8161282

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
866761GGAAAAAGAACAGTCCACATGTGGACTGTTCTTTTTCC0.034300.015700.663800.750001.000001.00000


Target Position: 2458, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2458GGCAACAUAGCAAGACCCC60.20792771

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7892476GGCAACATAGCAAGACCCCGGGGTCTTGCTATGTTGCC0.254900.171900.508600.500000.951100.75000


Target Position: 839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
839AUAAAGAGCUUACUGGAAU77.04551095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
907857ATAAAGAGCTTACTGGAATATTCCAGTAAGCTCTTTAT0.027400.002100.534500.500001.000001.00000


Target Position: 1995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1995GCUGUUCUAUCCAUUUUGU80.9684762

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8882013GCTGTTCTATCCATTTTGTACAAAATGGATAGAACAGC0.030600.013100.646600.750001.000001.00000


Target Position: 3602, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3602UCCCAUACAUUUCUUUCAC59.61752819

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7733620TCCCATACATTTCTTTCACGTGAAAGAAATGTATGGGA0.758300.390400.577600.500001.000001.00000


Target Position: 3129, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3129CAGGCCCAUUCUCUGAUUU77.0211098

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5563147CAGGCCCATTCTCTGATTTAAATCAGAGAATGGGCCTG0.543600.015000.784500.750001.000001.00000


Target Position: 1909, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1909ACCAUAAACUUCUCAGGAG71.37321668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9041927ACCATAAACTTCTCAGGAGCTCCTGAGAAGTTTATGGT0.028200.013300.543100.500001.000001.00000


Target Position: 292, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
292AGGCCGCGGAUGAAGAAGA73.85251397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
825310AGGCCGCGGATGAAGAAGATCTTCTTCATCCGCGGCCT0.887700.004600.620700.500001.000001.00000


Target Position: 3180, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3180UCCCACUUCCUCUCUGCUC51.0163433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9243198TCCCACTTCCTCTCTGCTCGAGCAGAGAGGAAGTGGGA0.024400.024300.560300.500001.000001.00000


Target Position: 3141, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3141CUGAUUUUUUUCCUCUUGU71.08691694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7783159CTGATTTTTTTCCTCTTGTACAAGAGGAAAAAAATCAG0.573500.504500.577600.500001.000001.00000


Target Position: 2559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2559GGUUUGCUUUUUUUUUUUU79.6952857

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6172577GGTTTGCTTTTTTTTTTTTAAAAAAAAAAAAGCAAACC0.119900.011800.853401.000001.000001.00000


Target Position: 3862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3862UUGGAGAACAAAAAAAAAA73.59521431

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6673880TTGGAGAACAAAAAAAAAATTTTTTTTTTGTTCTCCAA0.762100.071400.646600.500001.000001.00000


Target Position: 1863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1863AAAGAGAAGGCACCAGAAU75.24651255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9081881AAAGAGAAGGCACCAGAATATTCTGGTGCCTTCTCTTT0.090700.041100.491400.500001.000001.00000


Target Position: 1301, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1301AGCUCCUAUCUGUUUUCUC67.38782111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7841319AGCTCCTATCTGTTTTCTCGAGAAAACAGATAGGAGCT0.157300.051900.543100.500001.000001.00000


Target Position: 2862, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2862CCACAACAUUUAAUGAGAA96.70856

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5932880CCACAACATTTAATGAGAATTCTCATTAAATGTTGTGG0.270800.013300.672401.000000.978300.62500


Target Position: 1259, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1259CUGGUUCUCAAUGAAAAAU73.01041498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6521277CTGGTTCTCAATGAAAAATATTTTTCATTGAGAACCAG0.086900.018500.775900.750001.000001.00000


Target Position: 3329, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3329UCUCAUCUCAACCCCCUCA71.00861701

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9533347TCTCATCTCAACCCCCTCATGAGGGGGTTGAGATGAGA0.837100.792900.500000.500001.000001.00000


Target Position: 2506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2506AUAAAUAAAAAGAAAAAAA83.225600

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7502524ATAAATAAAAAGAAAAAAATTTTTTTCTTTTTATTTAT0.866200.200800.543100.500001.000001.00000


Target Position: 609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
609CCAGGUUGUUGAAGAGGUC72.00961595

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
962627CCAGGTTGTTGAAGAGGTCGACCTCTTCAACAACCTGG0.015400.002700.525900.750001.000001.00000


Target Position: 1870, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1870AGGCACCAGAAUGAGUAAA76.41381162

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6141888AGGCACCAGAATGAGTAAATTTACTCATTCTGGTGCCT0.256000.012200.844800.750000.994600.62500


Target Position: 2033, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2033CCCCAUCAUUGUUUUUAAA88.9498278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
862051CCCCATCATTGTTTTTAAATTTAAAAACAATGATGGGG0.697600.501500.991401.000001.000001.00000


Target Position: 2665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2665ACCUAAAGACUCACAUCAU85.6599429

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6372683ACCTAAAGACTCACATCATATGATGTGAGTCTTTAGGT0.088900.047600.698300.750000.983700.75000


Target Position: 2296, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2296CCGAGAUUACGCCCCUGCA80.6664787

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772314CCGAGATTACGCCCCTGCATGCAGGGGCGTAATCTCGG0.012500.006300.560300.750000.951100.75000


Target Position: 2246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2246GGCUGAGGCACAAGAAUCA92.0383163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9772264GGCTGAGGCACAAGAATCATGATTCTTGTGCCTCAGCC0.080000.001000.775900.750001.000001.00000


Target Position: 618, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
618UGAAGAGGUCAUAGGGGUU74.27131356

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
898636TGAAGAGGTCATAGGGGTTAACCCCTATGACCTCTTCA0.041500.001900.577600.750001.000001.00000


Target Position: 3859, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3859UAUUUGGAGAACAAAAAAA81.0977749

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6803877TATTTGGAGAACAAAAAAATTTTTTTGTTCTCCAAATA0.674100.042000.543100.500001.000001.00000


Target Position: 1054, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1054GACACAGUGGAGCAGAACA92.5907144

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9741072GACACAGTGGAGCAGAACATGTTCTGCTCCACTGTGTC0.012900.001300.612100.500001.000001.00000


Target Position: 3736, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3736AAGCAUAACUUGUAAUAUA98.100733

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9133754AAGCATAACTTGTAATATATATATTACAAGTTATGCTT0.047300.013600.594800.500001.000001.00000


Target Position: 2792, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2792ACCGCACCCCAACUUUAAU70.6031744

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3992810ACCGCACCCCAACTTTAATATTAAAGTTGGGGTGCGGT0.244100.035300.844800.750001.000001.00000


Target Position: 3599, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3599ACUUCCCAUACAUUUCUUU71.60151641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2323617ACTTCCCATACATTTCTTTAAAGAAATGTATGGGAAGT0.835800.369200.706900.750001.000001.00000


Target Position: 2984, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2984AGAUGAGGAAACCAAGAGA87.2207352

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703002AGATGAGGAAACCAAGAGATCTCTTGGTTTCCTCATCT0.175500.005200.500000.500001.000001.00000


Target Position: 376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
376GAAGCGACCUGGAGUGAAG80.5306801

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
851394GAAGCGACCTGGAGTGAAGCTTCACTCCAGGTCGCTTC0.171800.002700.534500.500001.000001.00000


Target Position: 3153, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3153CUCUUGUCCUCUGCCUCUC60.46582746

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8373171CTCTTGTCCTCTGCCTCTCGAGAGGCAGAGGACAAGAG0.616900.518000.500000.500001.000001.00000


Target Position: 3867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3867GAACAAAAAAAAAAAAAAA92.2278159

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5253885GAACAAAAAAAAAAAAAAATTTTTTTTTTTTTTTGTTC0.996100.668200.672400.750001.000001.00000


Target Position: 2507, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2507UAAAUAAAAAGAAAAAAAA81.8426692

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202525TAAATAAAAAGAAAAAAAATTTTTTTTCTTTTTATTTA0.900300.200600.534500.500001.000001.00000


Target Position: 3419, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3419GGUCUUUGCUCCUGCUACU85.5433436

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7523437GGTCTTTGCTCCTGCTACTAGTAGCAGGAGCAAAGACC0.173900.005100.646600.750000.956501.00000


Target Position: 2536, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2536UGCUCAUCAUAAAGUAGAA91.9757167

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6562554TGCTCATCATAAAGTAGAATTCTACTTTATGATGAGCA0.115100.009200.681000.750001.000001.00000


Target Position: 1187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1187GAGCGGAAUUUACCUGAUU84.4086513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9321205GAGCGGAATTTACCTGATTAATCAGGTAAATTCCGCTC0.021500.002600.801700.750000.951101.00000


Target Position: 734, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
734UGUUAAUUGGGAAAAAGAA84.3617515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
738752TGTTAATTGGGAAAAAGAATTCTTTTTCCCAATTAACA0.344000.028400.534500.750001.000001.00000


Target Position: 654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
654ACUCAUAUUUAAGGGAAAA82.6015634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
750672ACTCATATTTAAGGGAAAATTTTCCCTTAAATATGAGT0.059100.062500.706900.750000.994600.62500


Target Position: 3725, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3725AGCAUUAUUUCAAGCAUAA89.2062267

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7893743AGCATTATTTCAAGCATAATTATGCTTGAAATAATGCT0.049000.031300.819000.750000.989100.75000


Target Position: 905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
905AACUUGAUAGGAGAGUAAA85.3637451

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
689923AACTTGATAGGAGAGTAAATTTACTCTCCTATCAAGTT0.088100.013900.646600.500001.000001.00000


Target Position: 534, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
534CCACAGCAAUGAGAAGCAC70.37631768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
903552CCACAGCAATGAGAAGCACGTGCTTCTCATTGCTGTGG0.028200.011500.551700.750000.934800.75000


Target Position: 2426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2426UCACUUGAGCCCAGGAGUU67.31932116

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392444TCACTTGAGCCCAGGAGTTAACTCCTGGGCTCAAGTGA0.045100.001400.577600.750001.000001.00000


Target Position: 724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
724UGCCGGGUCAUGUUAAUUG61.51952660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
831742TGCCGGGTCATGTTAATTGCAATTAACATGACCCGGCA0.083700.003000.706900.500001.000001.00000


Target Position: 1261, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1261GGUUCUCAAUGAAAAAUAG86.0086410

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6391279GGTTCTCAATGAAAAATAGCTATTTTTCATTGAGAACC0.088700.016200.681000.750001.000001.00000


Target Position: 360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
360GUUGACCCUGAGUGAGGAA84.4951506

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
949378GTTGACCCTGAGTGAGGAATTCCTCACTCAGGGTCAAC0.161400.001200.474100.750000.923900.62500


Target Position: 3024, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3024UUGUAGAGUAAGCGGCAAA75.14051263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9713042TTGTAGAGTAAGCGGCAAATTTGCCGCTTACTCTACAA0.013400.004400.646600.500001.000001.00000


Target Position: 2414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2414GAGGCUAGAGGAUCACUUG81.1223747

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9092432GAGGCTAGAGGATCACTTGCAAGTGATCCTCTAGCCTC0.109800.001700.663800.500001.000001.00000


Target Position: 397, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
397GCGACCCAGAGUGAGGAGG49.19483515

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
807415GCGACCCAGAGTGAGGAGGCCTCCTCACTCTGGGTCGC0.103200.003400.577600.500000.934800.75000


Target Position: 3861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3861UUUGGAGAACAAAAAAAAA78.6349948

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8763879TTTGGAGAACAAAAAAAAATTTTTTTTTGTTCTCCAAA0.693500.043200.500000.500001.000001.00000


Target Position: 1967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1967UCCUUCUGAGUUCUAUGUU65.88972244

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2001985TCCTTCTGAGTTCTATGTTAACATAGAACTCAGAAGGA0.455800.182800.724100.750001.000001.00000


Target Position: 2933, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2933GUCAUUUAAUUCUUACAUA95.481380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5232951GTCATTTAATTCTTACATATATGTAAGAATTAAATGAC0.147200.125900.775900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2931-2953TAGTCATTTAATTCTTACATAACUAUGUAAGAAUUAAAUGACUAGUCAUUUAAUUCUUACAUAACU11.68.921


Target Position: 3718, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3718UGGUAACAGCAUUAUUUCA85.117468

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6913736TGGTAACAGCATTATTTCATGAAATAATGCTGTTACCA0.157800.029200.620700.500001.000001.00000


Target Position: 2470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2470AGACCCCAUCUCUAAAAUU80.0163823

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4362488AGACCCCATCTCTAAAATTAATTTTAGAGATGGGGTCT0.332700.174700.715500.750001.000001.00000


Target Position: 2030, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2030CCACCCCAUCAUUGUUUUU73.99151385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1452048CCACCCCATCATTGTTTTTAAAAACAATGATGGGGTGG0.568700.476900.844801.000001.000001.00000


Target Position: 1944, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1944CAAAGGCAUUUUUGUUAAC71.74681621

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8541962CAAAGGCATTTTTGTTAACGTTAACAAAAATGCCTTTG0.203400.003500.500000.500001.000001.00000


Target Position: 2182, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2182AAAAAAAAAAAAAAAAAAU76.74451128

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9052200AAAAAAAAAAAAAAAAAATATTTTTTTTTTTTTTTTTT0.849600.807100.491400.500001.000001.00000


Target Position: 1238, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1238GCCAAUUUUCCUACUCUCA84.2631524

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7601256GCCAATTTTCCTACTCTCATGAGAGTAGGAAAATTGGC0.056400.016000.775900.750001.000001.00000


Target Position: 2038, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2038UCAUUGUUUUUAAAAAAUU71.80711615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2842056TCATTGTTTTTAAAAAATTAATTTTTTAAAAACAATGA0.468700.368100.715500.750001.000001.00000


Target Position: 3851, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3851UCAAUAAAUAUUUGGAGAA79.6802860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8053869TCAATAAATATTTGGAGAATTCTCCAAATATTTATTGA0.046300.046000.551700.750001.000001.00000


Target Position: 1564, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1564AGUCAGGAAUAUUGGGAAU80.5729797

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7391582AGTCAGGAATATTGGGAATATTCCCAATATTCCTGACT0.062100.008100.698300.750001.000001.00000


Target Position: 1403, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1403ACCUCUGGGUGCUUUCUUU77.66411031

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611421ACCTCTGGGTGCTTTCTTTAAAGAAAGCACCCAGAGGT0.198500.001100.853400.750000.962000.62500


Target Position: 2483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2483AAAAUUUAAGUAAGUAAAA83.982549

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632501AAAATTTAAGTAAGTAAAATTTTACTTACTTAAATTTT0.232300.219500.500000.500001.000001.00000


Target Position: 1279, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1279GUGUCUUUGUGAUUUUGAG78.451970

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801297GTGTCTTTGTGATTTTGAGCTCAAAATCACAAAGACAC0.097100.003800.482800.500001.000001.00000


Target Position: 1519, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1519GUAGUCCCAUAGCUGUAAA90.145222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6161537GTAGTCCCATAGCTGTAAATTTACAGCTATGGGACTAC0.093400.044300.681000.750001.000001.00000


Target Position: 1310, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1310CUGUUUUCUCCUUCUGUCU74.59341320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6471328CTGTTTTCTCCTTCTGTCTAGACAGAAGGAGAAAACAG0.587000.164800.560300.500001.000001.00000


Target Position: 1987, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1987CCUUCACAGCUGUUCUAUC77.34671065

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3802005CCTTCACAGCTGTTCTATCGATAGAACAGCTGTGAAGG0.347100.131800.663800.750000.956500.62500


Target Position: 2029, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2029CCCACCCCAUCAUUGUUUU70.94321710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1402047CCCACCCCATCATTGTTTTAAAACAATGATGGGGTGGG0.574300.483800.991401.000001.000001.00000


Target Position: 3187, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3187UCCUCUCUGCUCUAGUUCA79.4753878

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8643205TCCTCTCTGCTCTAGTTCATGAACTAGAGCAGAGAGGA0.035200.009500.646600.500001.000001.00000


Target Position: 1848, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1848UGGAUUAGGAAGGGCAAAG54.54273239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6061866TGGATTAGGAAGGGCAAAGCTTTGCCCTTCCTAATCCA0.136000.067600.706900.500001.000001.00000


Target Position: 645, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
645UUUUCAGAAACUCAUAUUU68.93861932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
866663TTTTCAGAAACTCATATTTAAATATGAGTTTCTGAAAA0.231600.005900.500000.500001.000001.00000


Target Position: 2501, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2501AGUAGAUAAAUAAAAAGAA93.4047125

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302519AGTAGATAAATAAAAAGAATTCTTTTTATTTATCTACT0.379100.066700.534500.750001.000001.00000


Target Position: 1264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1264UCUCAAUGAAAAAUAGUGU69.07861915

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7661282TCTCAATGAAAAATAGTGTACACTATTTTTCATTGAGA0.094600.023100.517200.500001.000001.00000


Target Position: 1425, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1425CUGGUGAGAGCUCUAAUUU79.7254849

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8081443CTGGTGAGAGCTCTAATTTAAATTAGAGCTCTCACCAG0.503700.003400.784500.750001.000001.00000


Target Position: 1424, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1424GCUGGUGAGAGCUCUAAUU84.3361519

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031442GCTGGTGAGAGCTCTAATTAATTAGAGCTCTCACCAGC0.060700.001900.844801.000000.978300.62500


Target Position: 2568, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2568UUUUUUUUUUUUUUGGAUU59.17882855

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042586TTTTTTTTTTTTTTGGATTAATCCAAAAAAAAAAAAAA0.268400.113500.491400.500001.000001.00000


Target Position: 2685, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2685UGGCAGAGAGAGAGUCGUU77.99121002

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632703TGGCAGAGAGAGAGTCGTTAACGACTCTCTCTCTGCCA0.035200.002900.698300.750001.000001.00000


Target Position: 3174, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3174UCUAGCUCCCACUUCCUCU66.61272181

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8463192TCTAGCTCCCACTTCCTCTAGAGGAAGTGGGAGCTAGA0.503400.173300.500000.500000.978300.87500


Target Position: 2526, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2526ACUGUUUAUGUGCUCAUCA82.2552660

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9532544ACTGTTTATGTGCTCATCATGATGAGCACATAAACAGT0.017200.004700.482800.500001.000001.00000


Target Position: 2745, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2745ACAAGGUAGUAGAGGUAGA84.9947473

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9272763ACAAGGTAGTAGAGGTAGATCTACCTCTACTACCTTGT0.094000.028900.482800.500001.000001.00000


Target Position: 803, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
803CUGUGGAGAAGAUAGCUGA88.0892310

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
951821CTGTGGAGAAGATAGCTGATCAGCTATCTTCTCCACAG0.028700.005600.560300.500001.000001.00000


Target Position: 2694, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2694GAGAGUCGUUGAAGUCCCA92.8753136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9662712GAGAGTCGTTGAAGTCCCATGGGACTTCAACGACTCTC0.056500.006600.465500.500001.000001.00000


Target Position: 2555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2555GAGUGGUUUGCUUUUUUUU82.5209641

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9722573GAGTGGTTTGCTTTTTTTTAAAAAAAAGCAAACCACTC0.072600.001000.810300.750001.000001.00000


Target Position: 3493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3493UGACUUUUGUUCAUCCUUC66.79372161

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6753511TGACTTTTGTTCATCCTTCGAAGGATGAACAAAAGTCA0.134600.085100.551700.500000.967400.62500


Target Position: 2672, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2672GACUCACAUCAUUUGGCAG81.0279754

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8692690GACTCACATCATTTGGCAGCTGCCAAATGATGTGAGTC0.091200.002400.534500.500001.000001.00000


Target Position: 1318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1318UCCUUCUGUCUCUGUGGUU66.08962227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5741336TCCTTCTGTCTCTGTGGTTAACCACAGAGACAGAAGGA0.103000.070100.724100.750001.000001.00000


Target Position: 418, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
418ACCCAGGGCGAAGAGAUGA67.22052124

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
849436ACCCAGGGCGAAGAGATGATCATCTCTTCGCCCTGGGT0.132100.002800.629300.500000.951100.62500


Target Position: 3140, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3140UCUGAUUUUUUUCCUCUUG57.7862977

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7773158TCTGATTTTTTTCCTCTTGCAAGAGGAAAAAAATCAGA0.569600.466100.577600.500001.000001.00000


Target Position: 646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
646UUUCAGAAACUCAUAUUUA83.3538592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
968664TTTCAGAAACTCATATTTATAAATATGAGTTTCTGAAA0.235300.010500.465500.500001.000001.00000


Target Position: 782, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
782AGUUGAAACAUUUGGAGAA89.3556255

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
799800AGTTGAAACATTTGGAGAATTCTCCAAATGTTTCAACT0.072600.003700.534500.750001.000001.00000


Target Position: 1939, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1939UCCUUCAAAGGCAUUUUUG54.22673264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9781957TCCTTCAAAGGCATTTTTGCAAAAATGCCTTTGAAGGA0.055000.001700.724100.500000.929300.62500


Target Position: 3189, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3189CUCUCUGCUCUAGUUCAUU78.0876997

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8583207CTCTCTGCTCTAGTTCATTAATGAACTAGAGCAGAGAG0.035900.008000.801700.750001.000001.00000


Target Position: 991, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
991AAAGACAGUAGAUUGAAAA87.1155354

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8321009AAAGACAGTAGATTGAAAATTTTCAATCTACTGTCTTT0.050700.020100.500000.500001.000001.00000


Target Position: 1402, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1402GACCUCUGGGUGCUUUCUU74.18521366

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9811420GACCTCTGGGTGCTTTCTTAAGAAAGCACCCAGAGGTC0.221600.001000.681000.750000.945700.62500


Target Position: 3361, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3361UGCUGUCAGCCACUCUUCU71.29571671

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7073379TGCTGTCAGCCACTCTTCTAGAAGAGTGGCTGACAGCA0.293400.008800.629300.500000.945700.62500


Target Position: 2785, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2785CCAGCCCACCGCACCCCAA75.85581204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5722803CCAGCCCACCGCACCCCAATTGGGGTGCGGTGGGCTGG0.117600.014200.698301.000000.929300.87500


Target Position: 3840, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3840AUAGUAAGACCUCAAUAAA90.8802200

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9753858ATAGTAAGACCTCAATAAATTTATTGAGGTCTTACTAT0.438800.003900.543100.500001.000001.00000


Target Position: 421, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
421CAGGGCGAAGAGAUGAAUC69.22311901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
642439CAGGGCGAAGAGATGAATCGATTCATCTCTTCGCCCTG0.108700.010200.603400.500001.000001.00000


Target Position: 2996, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2996CAAGAGAACUUAGGUCAUU83.9208554

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8043014CAAGAGAACTTAGGTCATTAATGACCTAAGTTCTCTTG0.046300.015300.637900.750001.000001.00000


Target Position: 3633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3633GUCCAUGAUAGUUUACUUG72.89521513

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8523651GTCCATGATAGTTTACTTGCAAGTAAACTATCATGGAC0.089600.014600.672400.500001.000001.00000


Target Position: 3801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3801ACAUAUAUAACAAGCAUAA90.7671201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7543819ACATATATAACAAGCATAATTATGCTTGTTATATATGT0.058200.012300.672400.750001.000001.00000


Target Position: 613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
613GUUGUUGAAGAGGUCAUAG71.28181674

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
956631GTTGTTGAAGAGGTCATAGCTATGACCTCTTCAACAAC0.016800.003500.474100.500001.000001.00000


Target Position: 2654, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2654GCUAUAACUCUACCUAAAG78.186992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6852672GCTATAACTCTACCTAAAGCTTTAGGTAGAGTTATAGC0.107100.007900.715500.750001.000001.00000


Target Position: 2924, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2924UAUAUAUUAGUCAUUUAAU83.6561572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8632942TATATATTAGTCATTTAATATTAAATGACTAATATATA0.322600.079500.534500.500001.000001.00000


Target Position: 2498, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2498AAAAGUAGAUAAAUAAAAA97.667740

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8562516AAAAGTAGATAAATAAAAATTTTTATTTATCTACTTTT0.274800.064900.500000.500001.000001.00000


Target Position: 3360, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3360CUGCUGUCAGCCACUCUUC66.89552153

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9103378CTGCTGTCAGCCACTCTTCGAAGAGTGGCTGACAGCAG0.079800.001700.612100.500000.945700.75000


Target Position: 2858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2858UGGGCCACAACAUUUAAUG57.79412975

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5742876TGGGCCACAACATTTAATGCATTAAATGTTGTGGCCCA0.290600.015100.689700.500000.989100.62500


Target Position: 3747, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3747GUAAUAUAGUUAUAUUACA98.332831

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3745-3767TTGTAATATAGTTATATTACATAUGUAAUAUAACUAUAUUACAAGUAAUAUAGUUAUAUUACAUAU1.1-5.922


Target Position: 1280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1280UGUCUUUGUGAUUUUGAGU69.59291858

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8281298TGTCTTTGTGATTTTGAGTACTCAAAATCACAAAGACA0.094700.022400.500000.500001.000001.00000


Target Position: 3470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3470CUCCAACCCUACCCUUGUA85.0523471

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4873488CTCCAACCCTACCCTTGTATACAAGGGTAGGGTTGGAG0.614600.504100.629300.750000.989100.62500


Target Position: 3613, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3613UCUUUCACAGCAUUUACAU70.96611705

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6243631TCTTTCACAGCATTTACATATGTAAATGCTGTGAAAGA0.307100.274900.569000.750001.000001.00000


Target Position: 2251, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2251AGGCACAAGAAUCAUUUGA75.24441256

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9672269AGGCACAAGAATCATTTGATCAAATGATTCTTGTGCCT0.216700.008000.620700.500001.000001.00000


Target Position: 2985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2985GAUGAGGAAACCAAGAGAA93.7527115

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8043003GATGAGGAAACCAAGAGAATTCTCTTGGTTTCCTCATC0.169300.005600.508600.750001.000001.00000


Target Position: 1559, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1559CACCUAGUCAGGAAUAUUG77.62031036

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8621577CACCTAGTCAGGAATATTGCAATATTCCTGACTAGGTG0.065700.002500.646600.500000.956500.75000


Target Position: 2866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2866AACAUUUAAUGAGAAGUUA84.0867539

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7132884AACATTTAATGAGAAGTTATAACTTCTCATTAAATGTT0.190300.066700.612100.500001.000001.00000


Target Position: 730, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
730GUCAUGUUAAUUGGGAAAA74.88881300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
565748GTCATGTTAATTGGGAAAATTTTCCCAATTAACATGAC0.104600.042600.819000.750001.000001.00000


Target Position: 1040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1040UCCUAGCCGAGUGUGACAC51.01253434

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8251058TCCTAGCCGAGTGTGACACGTGTCACACTCGGCTAGGA0.068200.003100.577600.500000.929300.75000


Target Position: 1009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1009AGGAAAGGCUUGGUAAAAA85.3052458

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5171027AGGAAAGGCTTGGTAAAAATTTTTACCAAGCCTTTCCT0.138100.018100.844800.750001.000001.00000


Target Position: 2263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2263CAUUUGAACCUGGGAGGUA85.6884426

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382281CATTTGAACCTGGGAGGTATACCTCCCAGGTTCAAATG0.253200.002600.474100.750000.907600.62500


Target Position: 3334, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3334UCUCAACCCCCUCAUUUGU61.64012649

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7643352TCTCAACCCCCTCATTTGTACAAATGAGGGGGTTGAGA0.495800.475400.517200.500001.000001.00000


Target Position: 3655, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3655GAUUAUUUGGUUAAUCUUU85.5474435

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3653-3675GGGATTATTTGGTTAATCTTTGCAAAGAUUAACCAAAUAAUCCCGAUUAUUUGGUUAAUCUUUGCU6.9-10.332


Target Position: 754, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
754AGUCCACAGGAAGAGGUUG64.19652408

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
781772AGTCCACAGGAAGAGGTTGCAACCTCTTCCTGTGGACT0.134000.004200.560300.500000.951100.75000


Target Position: 3786, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3786AACAUAACAUAUAUAACAU90.1742220

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9213804AACATAACATATATAACATATGTTATATATGTTATGTT0.076000.038400.491400.500001.000001.00000


Target Position: 3503, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3503UCAUCCUUCAGAAUUCAAC60.00412791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8643521TCATCCTTCAGAATTCAACGTTGAATTCTGAAGGATGA0.066600.035900.577600.500001.000001.00000


Target Position: 3364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3364UGUCAGCCACUCUUCUUUC65.18562313

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7153382TGTCAGCCACTCTTCTTTCGAAAGAAGAGTGGCTGACA0.587000.008200.534500.500001.000001.00000


Target Position: 2606, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2606GGCUCUAGUCAUAAUUUAU97.11848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8102624GGCTCTAGTCATAATTTATATAAATTATGACTAGAGCC0.045500.004200.956901.000001.000001.00000


Target Position: 3773, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3773CAUAUAUAUAUAUAACAUA105.2963

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3771-3793AACATATATATATATAACATAACUAUGUUAUAUAUAUAUAUGUUCAUAUAUAUAUAUAACAUAACU6.7-6.401


Target Position: 957, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
957GGAGAUUGACACACUGAUC82.3383658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
874975GGAGATTGACACACTGATCGATCAGTGTGTCAATCTCC0.063200.002200.689700.750000.994600.62500


Target Position: 3864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3864GGAGAACAAAAAAAAAAAA93.4734123

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1763882GGAGAACAAAAAAAAAAAATTTTTTTTTTTTGTTCTCC0.982300.153700.870701.000001.000001.00000


Target Position: 2491, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2491AGUAAGUAAAAGUAGAUAA93.9594108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6902509AGTAAGTAAAAGTAGATAATTATCTACTTTTACTTACT0.076200.071300.672400.750001.000001.00000


Target Position: 632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
632GGGUUCCACAGUCUUUUCA82.1559668

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
912650GGGTTCCACAGTCTTTTCATGAAAAGACTGTGGAACCC0.029900.001700.767200.750001.000001.00000


Target Position: 3607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3607UACAUUUCUUUCACAGCAU74.38361343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7913625TACATTTCTTTCACAGCATATGCTGTGAAAGAAATGTA0.695900.697300.525900.500001.000001.00000


Target Position: 1938, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1938UUCCUUCAAAGGCAUUUUU58.57062908

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501956TTCCTTCAAAGGCATTTTTAAAAATGCCTTTGAAGGAA0.017300.001800.672400.500000.929300.75000


Target Position: 3788, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3788CAUAACAUAUAUAACAUAU94.918791

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8783806CATAACATATATAACATATATATGTTATATATGTTATG0.032100.015800.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3786-3808AACATAACATATATAACATATATAUAUGUUAUAUAUGUUAUGUUCAUAACAUAUAUAACAUAUAUU8.56.722


Target Position: 2972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2972UCCUUAUUUUAGAGAUGAG70.39471766

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9312990TCCTTATTTTAGAGATGAGCTCATCTCTAAAATAAGGA0.021500.002000.560300.500001.000001.00000


Target Position: 3429, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3429CCUGCUACUACCUCUGCUU79.7536846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6753447CCTGCTACTACCTCTGCTTAAGCAGAGGTAGTAGCAGG0.079200.036900.706901.000001.000001.00000


Target Position: 2529, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2529GUUUAUGUGCUCAUCAUAA96.457661

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2527-2549CTGTTTATGTGCTCATCATAAAGUUAUGAUGAGCACAUAAACAGGUUUAUGUGCUCAUCAUAAAGU14.96.932


Target Position: 2902, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2902GAACACCAUUCUAAACUAU91.0218196

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4852920GAACACCATTCTAAACTATATAGTTTAGAATGGTGTTC0.297000.148900.629300.750001.000001.00000


Target Position: 3271, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3271ACCCUCCAAUGGCUCACUU67.40532110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4803289ACCCTCCAATGGCTCACTTAAGTGAGCCATTGGAGGGT0.141100.089000.715500.750000.945700.62500


Target Position: 3852, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3852CAAUAAAUAUUUGGAGAAC75.37281245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8733870CAATAAATATTTGGAGAACGTTCTCCAAATATTTATTG0.045800.045000.500000.500001.000001.00000


Target Position: 3653, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3653GGGAUUAUUUGGUUAAUCU89.8191234

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3651-3673GTGGGATTATTTGGTTAATCTTTAGAUUAACCAAAUAAUCCCACGGGAUUAUUUGGUUAAUCUUUU10.015.422


Target Position: 2338, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2338GACUCCAUCUCAGAAAAAA93.1154131

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7082356GACTCCATCTCAGAAAAAATTTTTTCTGAGATGGAGTC0.560100.006500.819000.750000.989100.62500


Target Position: 864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
864GGGUUUUCUGCCCAAGGAU79.0277910

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
889882GGGTTTTCTGCCCAAGGATATCCTTGGGCAGAAAACCC0.069800.002100.810301.000000.907600.62500


Target Position: 3823, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3823GUUAUAUAGUCUUGUAUAU92.2396157

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3821-3843TTGTTATATAGTCTTGTATATAGAUAUACAAGACUAUAUAACAAGUUAUAUAGUCUUGUAUAUAGU8.5-5.922


Target Position: 3811, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3811CAAGCAUAACUUGUUAUAU88.5782289

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3809-3831AACAAGCATAACTTGTTATATAGAUAUAACAAGUUAUGCUUGUUCAAGCAUAACUUGUUAUAUAGU8.519.722


Target Position: 2497, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2497UAAAAGUAGAUAAAUAAAA82.9498613

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7122515TAAAAGTAGATAAATAAAATTTTATTTATCTACTTTTA0.268600.064700.534500.500001.000001.00000


Target Position: 3373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3373CUCUUCUUUCAGGUCCUCA77.21271077

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8383391CTCTTCTTTCAGGTCCTCATGAGGACCTGAAAGAAGAG0.145800.138700.586200.500001.000001.00000


Target Position: 2481, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2481CUAAAAUUUAAGUAAGUAA94.1262106

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4562499CTAAAATTTAAGTAAGTAATTACTTACTTAAATTTTAG0.562800.491300.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2479-2501CTCTAAAATTTAAGTAAGTAAAAUUACUUACUUAAAUUUUAGAGCUAAAAUUUAAGUAAGUAAAAU14.3-9.722


Target Position: 3080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3080AGUGCUUUUCCCCUCUACU74.26741357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723098AGTGCTTTTCCCCTCTACTAGTAGAGGGGAAAAGCACT0.710700.027800.500000.500001.000001.00000


Target Position: 2171, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2171UUCUGCUUUAAAAAAAAAA68.76241952

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7932189TTCTGCTTTAAAAAAAAAATTTTTTTTTTAAAGCAGAA0.957500.164200.672400.500001.000001.00000


Target Position: 2015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2015GACUGUCCCCCACCCCCAC62.7262551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9342033GACTGTCCCCCACCCCCACGTGGGGGTGGGGGACAGTC0.447800.170400.525900.500000.940200.62500


Target Position: 415, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
415GCGACCCAGGGCGAAGAGA68.95391930

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
883433GCGACCCAGGGCGAAGAGATCTCTTCGCCCTGGGTCGC0.060400.002100.698300.750000.951100.62500


Target Position: 3431, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3431UGCUACUACCUCUGCUUGA75.17811259

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7513449TGCTACTACCTCTGCTTGATCAAGCAGAGGTAGTAGCA0.065700.038700.629300.500001.000001.00000


Target Position: 3789, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3789AUAACAUAUAUAACAUAUA91.8599170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8553807ATAACATATATAACATATATATATGTTATATATGTTAT0.036100.013700.500000.500001.000001.00000


Target Position: 3517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3517UCAACUCACAUGUCUCUUG64.81912343

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823535TCAACTCACATGTCTCTTGCAAGAGACATGTGAGTTGA0.031300.024100.577600.500001.000001.00000


Target Position: 2929, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2929AUUAGUCAUUUAAUUCUUA87.9972318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9552947ATTAGTCATTTAATTCTTATAAGAATTAAATGACTAAT0.209300.055000.474100.500001.000001.00000


Target Position: 1188, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1188AGCGGAAUUUACCUGAUUU81.9085683

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681206AGCGGAATTTACCTGATTTAAATCAGGTAAATTCCGCT0.014100.004700.853400.750000.951100.87500


Target Position: 2170, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2170AUUCUGCUUUAAAAAAAAA81.6911699

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7992188ATTCTGCTTTAAAAAAAAATTTTTTTTTAAAGCAGAAT0.949000.152000.508600.500001.000001.00000


Target Position: 1624, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1624CCCUCAUUGUGACCUAAUU82.9532612

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_5162419CCCTCATTGTGACCTAATT1/1/0/097.21BAG1NM_004323.41NANANA9:33254700..33254718(-)00BAG1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4521642CCCTCATTGTGACCTAATTAATTAGGTCACAATGAGGG0.156500.068700.982801.000001.000001.00000


Target Position: 866, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
866GUUUUCUGCCCAAGGAUUU70.431760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
773884GTTTTCTGCCCAAGGATTTAAATCCTTGGGCAGAAAAC0.225200.004500.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
864-886GGGTTTTCTGCCCAAGGATTTGCAAAUCCUUGGGCAGAAAACCCGUUUUCUGCCCAAGGAUUUGCU18.712.222


Target Position: 2569, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2569UUUUUUUUUUUUUGGAUUA68.80171947

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9712587TTTTTTTTTTTTTGGATTATAATCCAAAAAAAAAAAAA0.152500.093200.465500.500001.000001.00000


Target Position: 3583, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3583GUGGGAUCCUCUCUCGACU78.9275920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413601GTGGGATCCTCTCTCGACTAGTCGAGAGAGGATCCCAC0.447100.001300.586200.500000.978300.62500


Target Position: 913, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
913AGGAGAGUAAAAGCCACAA82.2121663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
451931AGGAGAGTAAAAGCCACAATTGTGGCTTTTACTCTCCT0.191300.027400.698300.750001.000001.00000


Target Position: 653, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
653AACUCAUAUUUAAGGGAAA88.5501290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
738671AACTCATATTTAAGGGAAATTTCCCTTAAATATGAGTT0.062400.065800.646600.500000.994600.75000


Target Position: 3363, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3363CUGUCAGCCACUCUUCUUU78.4345971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4583381CTGTCAGCCACTCTTCTTTAAAGAAGAGTGGCTGACAG0.751500.026100.784500.750001.000001.00000


Target Position: 3264, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3264GCUUAGAACCCUCCAAUGG64.4242382

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7903282GCTTAGAACCCTCCAATGGCCATTGGAGGGTTCTAAGC0.097800.021900.508600.500000.913000.62500


Target Position: 2579, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2579UUUGGAUUAAUGAGGAAAU68.34221998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482597TTTGGATTAATGAGGAAATATTTCCTCATTAATCCAAA0.017800.006200.491400.500001.000001.00000


Target Position: 3314, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3314CCAUGCCUUCUCCCAUCUC64.21892405

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7313332CCATGCCTTCTCCCATCTCGAGATGGGAGAAGGCATGG0.921200.277000.534500.750000.967400.62500


Target Position: 3262, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3262CUGCUUAGAACCCUCCAAU77.48171049

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4513280CTGCTTAGAACCCTCCAATATTGGAGGGTTCTAAGCAG0.185200.057200.775900.750000.913000.62500


Target Position: 2744, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2744GACAAGGUAGUAGAGGUAG70.94881707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5632762GACAAGGTAGTAGAGGTAGCTACCTCTACTACCTTGTC0.110500.023900.646600.500001.000001.00000


Target Position: 2973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2973CCUUAUUUUAGAGAUGAGG60.96982694

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482991CCTTATTTTAGAGATGAGGCCTCATCTCTAAAATAAGG0.022400.004000.500000.500001.000001.00000


Target Position: 2583, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2583GAUUAAUGAGGAAAUCAUU92.7765140

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2581-2603TGGATTAATGAGGAAATCATTCTAAUGAUUUCCUCAUUAAUCCAGAUUAAUGAGGAAAUCAUUCUU7.2-1.822


Target Position: 2965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2965ACAGAUAUCCUUAUUUUAG74.09031376

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9162983ACAGATATCCTTATTTTAGCTAAAATAAGGATATCTGT0.024700.004800.534500.500001.000001.00000


Target Position: 2821, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2821CACUAUUGAUCUAUUUUUG80.3149811

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802839CACTATTGATCTATTTTTGCAAAAATAGATCAATAGTG0.128400.063800.646600.500001.000001.00000


Target Position: 3385, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3385GUCCUCAGAUGCACUGCAC71.14251688

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9403403GTCCTCAGATGCACTGCACGTGCAGTGCATCTGAGGAC0.020300.003000.525900.500000.923900.87500


Target Position: 2952, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2952ACUUGAGAGGUAGACAGAU79.2518894

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7562970ACTTGAGAGGTAGACAGATATCTGTCTACCTCTCAAGT0.308700.075200.525900.750001.000001.00000


Target Position: 2925, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2925AUAUAUUAGUCAUUUAAUU84.2021530

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9392943ATATATTAGTCATTTAATTAATTAAATGACTAATATAT0.267200.068700.534500.500001.000001.00000


Target Position: 3430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3430CUGCUACUACCUCUGCUUG69.91681814

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9253448CTGCTACTACCTCTGCTTGCAAGCAGAGGTAGTAGCAG0.065000.032700.637900.500001.000001.00000


Target Position: 2901, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2901CGAACACCAUUCUAAACUA101.6028

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5082919CGAACACCATTCTAAACTATAGTTTAGAATGGTGTTCG0.242300.144900.620701.000000.989100.62500


Target Position: 1276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1276AUAGUGUCUUUGUGAUUUU77.89921014

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011294ATAGTGTCTTTGTGATTTTAAAATCACAAAGACACTAT0.162800.034000.543100.500001.000001.00000


Target Position: 797, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
797AGAAGUCUGUGGAGAAGAU88.1645305

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850815AGAAGTCTGTGGAGAAGATATCTTCTCCACAGACTTCT0.053400.002800.543100.750001.000001.00000


Target Position: 3280, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3280UGGCUCACUUUCUCUUUAG65.84582248

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9643298TGGCTCACTTTCTCTTTAGCTAAAGAGAAAGTGAGCCA0.015400.002900.672400.500001.000001.00000


Target Position: 966, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
966CACACUGAUCCUGCCAGAA86.8699369

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
644984CACACTGATCCTGCCAGAATTCTGGCAGGATCAGTGTG0.114700.010000.620700.750000.956500.75000


Target Position: 2910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2910UUCUAAACUAUUCAUAUAU74.92661291

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6682928TTCTAAACTATTCATATATATATATGAATAGTTTAGAA0.751300.280600.629300.500001.000001.00000


Target Position: 3365, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3365GUCAGCCACUCUUCUUUCA82.7792623

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8283383GTCAGCCACTCTTCTTTCATGAAAGAAGAGTGGCTGAC0.522200.009200.594800.500001.000001.00000


Target Position: 978, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
978GCCAGAAAAUUUCAAAGAC74.13091370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
513996GCCAGAAAATTTCAAAGACGTCTTTGAAATTTTCTGGC0.179800.086700.681000.750001.000001.00000


Target Position: 1001, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1001GAUUGAAAAGGAAAGGCUU85.4013445

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8411019GATTGAAAAGGAAAGGCTTAAGCCTTTCCTTTTCAATC0.039500.002900.543100.750001.000001.00000


Target Position: 1471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1471CCCCCUCAGUCUUCAGAUA88.033316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6561489CCCCCTCAGTCTTCAGATATATCTGAAGACTGAGGGGG0.085600.056100.948301.000001.000001.00000


Target Position: 1342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1342GUCCAGCAAUCCACCUUUU78.374973

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6891360GTCCAGCAATCCACCTTTTAAAAGGTGGATTGCTGGAC0.089600.007700.819000.750001.000001.00000


Target Position: 3610, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3610AUUUCUUUCACAGCAUUUA75.49221235

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9533628ATTTCTTTCACAGCATTTATAAATGCTGTGAAAGAAAT0.614200.591400.474100.500001.000001.00000


Target Position: 2347, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2347UCAGAAAAAAAAAAAAUUG60.62542731

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6582365TCAGAAAAAAAAAAAATTGCAATTTTTTTTTTTTCTGA0.322000.172500.577600.500001.000001.00000


Target Position: 3597, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3597CGACUUCCCAUACAUUUCU76.95171102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6143615CGACTTCCCATACATTTCTAGAAATGTATGGGAAGTCG0.884100.318400.569000.750001.000001.00000


Target Position: 1861, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1861GCAAAGAGAAGGCACCAGA84.6286495

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8141879GCAAAGAGAAGGCACCAGATCTGGTGCCTTCTCTTTGC0.044900.049100.629300.750001.000001.00000


Target Position: 3003, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3003ACUUAGGUCAUUAGCGCAA77.92191009

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6443021ACTTAGGTCATTAGCGCAATTGCGCTAATGACCTAAGT0.166600.013500.560300.750001.000001.00000


Target Position: 1784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1784CAAGUCUUCAGAAGGUUAG68.78721949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9561802CAAGTCTTCAGAAGGTTAGCTAACCTTCTGAAGACTTG0.077500.001100.474100.500001.000001.00000


Target Position: 874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
874CCCAAGGAUUUGCAAGCUG64.11542415

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
777892CCCAAGGATTTGCAAGCTGCAGCTTGCAAATCCTTGGG0.051500.013500.706900.750001.000001.00000


Target Position: 3456, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3456CCUCACCUUCCUUCCUCCA75.09581270

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8403474CCTCACCTTCCTTCCTCCATGGAGGAAGGAAGGTGAGG0.890900.335300.500000.750001.000001.00000


Target Position: 776, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
776UAAAGAAGUUGAAACAUUU83.1192604

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
861794TAAAGAAGTTGAAACATTTAAATGTTTCAACTTCTTTA0.035600.011300.534500.500001.000001.00000


Target Position: 3177, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3177AGCUCCCACUUCCUCUCUG64.57392370

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7003195AGCTCCCACTTCCTCTCTGCAGAGAGGAAGTGGGAGCT0.073200.074400.569000.500001.000001.00000


Target Position: 1839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1839CCAGAGCCAUGGAUUAGGA86.4491390

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351857CCAGAGCCATGGATTAGGATCCTAATCCATGGCTCTGG0.403400.002100.474100.750000.978300.75000


Target Position: 1992, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1992ACAGCUGUUCUAUCCAUUU78.3321978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2992010ACAGCTGTTCTATCCATTTAAATGGATAGAACAGCTGT0.406000.186400.706900.750001.000001.00000


Target Position: 1344, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1344CCAGCAAUCCACCUUUUCU80.9195768

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6671362CCAGCAATCCACCTTTTCTAGAAAAGGTGGATTGCTGG0.082400.012200.620700.750001.000001.00000


Target Position: 3860, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3860AUUUGGAGAACAAAAAAAA82.2082664

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8023878ATTTGGAGAACAAAAAAAATTTTTTTTGTTCTCCAAAT0.677800.042400.508600.500001.000001.00000


Target Position: 3313, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3313CCCAUGCCUUCUCCCAUCU67.48312104

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1733331CCCATGCCTTCTCCCATCTAGATGGGAGAAGGCATGGG0.938000.263800.767200.750000.967400.62500


Target Position: 3420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3420GUCUUUGCUCCUGCUACUA82.09673

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7133438GTCTTTGCTCCTGCTACTATAGTAGCAGGAGCAAAGAC0.183000.006300.646600.750000.956501.00000


Target Position: 1472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1472CCCCUCAGUCUUCAGAUAC65.89782242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7731490CCCCTCAGTCTTCAGATACGTATCTGAAGACTGAGGGG0.052100.025400.810300.750001.000001.00000


Target Position: 832, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
832GAGUUGAAUAAAGAGCUUA91.7505175

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
731850GAGTTGAATAAAGAGCTTATAAGCTCTTTATTCAACTC0.065500.009500.775900.750001.000001.00000


Target Position: 1866, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1866GAGAAGGCACCAGAAUGAG72.34671567

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9611884GAGAAGGCACCAGAATGAGCTCATTCTGGTGCCTTCTC0.276300.023900.500000.500001.000001.00000


Target Position: 3598, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3598GACUUCCCAUACAUUUCUU84.7122487

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3103616GACTTCCCATACATTTCTTAAGAAATGTATGGGAAGTC0.860100.329900.681000.750001.000001.00000


Target Position: 2914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2914AAACUAUUCAUAUAUAUUA95.481879

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732932AAACTATTCATATATATTATAATATATATGAATAGTTT0.404000.328900.465500.500001.000001.00000


Target Position: 2022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2022CCCCACCCCCACCCCAUCA63.78712449

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2222040CCCCACCCCCACCCCATCATGATGGGGTGGGGGTGGGG0.648000.347000.767200.750001.000001.00000


Target Position: 1900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1900GUGAAGCCAACCAUAAACU74.93051289

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7161918GTGAAGCCAACCATAAACTAGTTTATGGTTGGCTTCAC0.069200.007200.586200.500001.000001.00000


Target Position: 2173, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2173CUGCUUUAAAAAAAAAAAA80.8764774

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1422191CTGCTTTAAAAAAAAAAAATTTTTTTTTTTTAAAGCAG0.956500.213300.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2171-2193TTCTGCTTTAAAAAAAAAAAAAAUUUUUUUUUUUUAAAGCAGAACUGCUUUAAAAAAAAAAAAAAU-11.319.700


Target Position: 831, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
831AGAGUUGAAUAAAGAGCUU81.4367723

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
722849AGAGTTGAATAAAGAGCTTAAGCTCTTTATTCAACTCT0.087500.006100.586200.750001.000001.00000


Target Position: 2249, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2249UGAGGCACAAGAAUCAUUU72.9581502

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8652267TGAGGCACAAGAATCATTTAAATGATTCTTGTGCCTCA0.269100.002500.724100.750001.000001.00000


Target Position: 3540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3540GAGAACCCUCACCUACUGU77.42131056

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6663558GAGAACCCTCACCTACTGTACAGTAGGTGAGGGTTCTC0.083200.068600.603400.500000.978300.62500


Target Position: 3703, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3703GGAGCUUCUUUAUCUUGGU82.4581650

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8313721GGAGCTTCTTTATCTTGGTACCAAGATAAAGAAGCTCC0.041600.006200.517200.750001.000001.00000


Target Position: 364, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
364ACCCUGAGUGAGGAAGCGA71.23161679

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
810382ACCCTGAGTGAGGAAGCGATCGCTTCCTCACTCAGGGT0.047600.003400.560300.500000.923900.62500


Target Position: 1015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1015GGCUUGGUAAAAAAGGUUC65.18892312

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8261033GGCTTGGTAAAAAAGGTTCGAACCTTTTTTACCAAGCC0.042100.029900.827600.750001.000001.00000


Target Position: 2476, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2476CAUCUCUAAAAUUUAAGUA90.591210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362494CATCTCTAAAATTTAAGTATACTTAAATTTTAGAGATG0.543000.280700.474100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2474-2496CCCATCTCTAAAATTTAAGTAAGUACUUAAAUUUUAGAGAUGGGCAUCUCUAAAAUUUAAGUAAGU4.920.221


Target Position: 667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
667GGAAAAUCUCUGAAGGAAA97.201245

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
847685GGAAAATCTCTGAAGGAAATTTCCTTCAGAGATTTTCC0.042600.002800.870701.000001.000001.00000


Target Position: 764, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
764AAGAGGUUGAACUAAAGAA89.2077266

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
974782AAGAGGTTGAACTAAAGAATTCTTTAGTTCAACCTCTT0.065600.024600.465500.500001.000001.00000


Target Position: 2880, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2880AGUUACUGUGCACCAAACU71.97051599

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8622898AGTTACTGTGCACCAAACTAGTTTGGTGCACAGTAACT0.220200.011900.500000.500001.000001.00000


Target Position: 2120, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2120CACUUGAGGCCAGGAGUUU74.53431324

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9422138CACTTGAGGCCAGGAGTTTAAACTCCTGGCCTCAAGTG0.048300.001300.793100.750001.000001.00000


Target Position: 3614, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3614CUUUCACAGCAUUUACAUA95.685976

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5653632CTTTCACAGCATTTACATATATGTAAATGCTGTGAAAG0.239000.204500.594800.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3612-3634TTCTTTCACAGCATTTACATAGTUAUGUAAAUGCUGUGAAAGAACUUUCACAGCAUUUACAUAGUU6.920.522


Target Position: 2035, Predicted by: Biltr, Ernai, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2035CCAUCAUUGUUUUUAAAAA95.776274

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_8203519CCATCATTGTTTTTAAAAA1/1/0/096.22BAG1NM_004323.41NANANA8:34479616..34479634(+)00BAG1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1112053CCATCATTGTTTTTAAAAATTTTTAAAAACAATGATGG0.647400.529500.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2033-2055CCCCATCATTGTTTTTAAAAAATUUUUUAAAAACAAUGAUGGGGCCAUCAUUGUUUUUAAAAAAUU-9.113.622


Target Position: 758, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
758CACAGGAAGAGGUUGAACU80.6075795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884776CACAGGAAGAGGTTGAACTAGTTCAACCTCTTCCTGTG0.057700.015500.586200.500001.000001.00000


Target Position: 2490, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2490AAGUAAGUAAAAGUAGAUA87.848327

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7202508AAGTAAGTAAAAGTAGATATATCTACTTTTACTTACTT0.077900.072400.594800.500001.000001.00000


Target Position: 2146, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2146GCCCAGGCAACAUAGCAAA83.8185563

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7662164GCCCAGGCAACATAGCAAATTTGCTATGTTGCCTGGGC0.175100.004701.000001.000000.951100.87500


Target Position: 3697, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3697GGUGAAGGAGCUUCUUUAU88.7067284

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_3369719GGTGAAGGAGCTTCTTTAT1/1/0/097.75BAG1NM_004323.41NANANANA00BAG1(0.002)


Target Position: 3022, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3022GGUUGUAGAGUAAGCGGCA90.6379207

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8333040GGTTGTAGAGTAAGCGGCATGCCGCTTACTCTACAACC0.108400.009700.500000.750001.000001.00000


Target Position: 2040, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2040AUUGUUUUUAAAAAAUUAA77.51051047

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9452058ATTGTTTTTAAAAAATTAATTAATTTTTTAAAAACAAT0.153900.138000.474100.500001.000001.00000


Target Position: 982, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
982GAAAAUUUCAAAGACAGUA88.5351292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9091000GAAAATTTCAAAGACAGTATACTGTCTTTGAAATTTTC0.601900.070400.491400.750001.000001.00000


Target Position: 1381, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1381CCAAAUUUUCCCAGCUGUU75.40531242

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7151399CCAAATTTTCCCAGCTGTTAACAGCTGGGAAAATTTGG0.069600.014300.698301.000001.000001.00000


Target Position: 1468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1468AGGCCCCCUCAGUCUUCAG62.34662581

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9501486AGGCCCCCTCAGTCTTCAGCTGAAGACTGAGGGGGCCT0.111000.001200.560300.500001.000001.00000


Target Position: 981, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
981AGAAAAUUUCAAAGACAGU76.67581136

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
785999AGAAAATTTCAAAGACAGTACTGTCTTTGAAATTTTCT0.234000.077100.517200.500001.000001.00000


Target Position: 1634, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1634GACCUAAUUCCAGAGCAUC72.25591576

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9121652GACCTAATTCCAGAGCATCGATGCTCTGGAATTAGGTC0.026100.003300.637900.500001.000001.00000


Target Position: 1265, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1265CUCAAUGAAAAAUAGUGUC65.13812320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9331283CTCAATGAAAAATAGTGTCGACACTATTTTTCATTGAG0.098500.028200.491400.500001.000001.00000


Target Position: 2686, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2686GGCAGAGAGAGAGUCGUUG71.32631669

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8742704GGCAGAGAGAGAGTCGTTGCAACGACTCTCTCTCTGCC0.033000.003000.853400.750001.000001.00000


Target Position: 3332, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3332CAUCUCAACCCCCUCAUUU78.298983

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4873350CATCTCAACCCCCTCATTTAAATGAGGGGGTTGAGATG0.913600.778200.655200.750001.000001.00000


Target Position: 420, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
420CCAGGGCGAAGAGAUGAAU75.00161278

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
687438CCAGGGCGAAGAGATGAATATTCATCTCTTCGCCCTGG0.135000.007900.836201.000001.000001.00000


Target Position: 3317, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3317UGCCUUCUCCCAUCUCAUC59.90942795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733335TGCCTTCTCCCATCTCATCGATGAGATGGGAGAAGGCA0.919400.335000.672400.500001.000001.00000


Target Position: 3218, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3218CAGCCCGAGUGAUCAUGAA92.3278154

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9143236CAGCCCGAGTGATCATGAATTCATGATCACTCGGGCTG0.195000.001700.612100.750001.000001.00000


Target Position: 3609, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3609CAUUUCUUUCACAGCAUUU80.9747761

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3983627CATTTCTTTCACAGCATTTAAATGCTGTGAAAGAAATG0.636800.620700.655200.750001.000001.00000


Target Position: 3322, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3322UCUCCCAUCUCAUCUCAAC63.64922467

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5933340TCTCCCATCTCATCTCAACGTTGAGATGAGATGGGAGA0.851000.785400.577600.500001.000001.00000


Target Position: 3467, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3467UUCCUCCAACCCUACCCUU57.04233029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9603485TTCCTCCAACCCTACCCTTAAGGGTAGGGTTGGAGGAA0.575300.615000.534500.500001.000001.00000


Target Position: 1667, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1667GGUUCUAGACUUUGUCCUC78.6928945

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8071685GGTTCTAGACTTTGTCCTCGAGGACAAAGTCTAGAACC0.046200.014900.543100.750000.902200.75000


Target Position: 3856, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3856AAAUAUUUGGAGAACAAAA89.8106236

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8263874AAATATTTGGAGAACAAAATTTTGTTCTCCAAATATTT0.155600.041900.500000.500001.000001.00000


Target Position: 1231, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1231GCCAUUUGCCAAUUUUCCU71.95411603

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091249GCCATTTGCCAATTTTCCTAGGAAAATTGGCAAATGGC0.184100.036100.655200.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1229-1251TGGCCATTTGCCAATTTTCCTACAGGAAAAUUGGCAAAUGGCCAGCCAUUUGCCAAUUUUCCUACU14.217.722


Target Position: 2605, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2605UGGCUCUAGUCAUAAUUUA84.8905476

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242623TGGCTCTAGTCATAATTTATAAATTATGACTAGAGCCA0.025800.001500.810300.750001.000001.00000


Target Position: 2911, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2911UCUAAACUAUUCAUAUAUA92.9728134

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4622929TCTAAACTATTCATATATATATATATGAATAGTTTAGA0.697300.353300.681000.750001.000001.00000


Target Position: 2898, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2898UGCCGAACACCAUUCUAAA86.3624393

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3212916TGCCGAACACCATTCTAAATTTAGAATGGTGTTCGGCA0.244100.122000.853400.750000.989101.00000


Target Position: 2687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2687GCAGAGAGAGAGUCGUUGA92.2375158

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8692705GCAGAGAGAGAGTCGTTGATCAACGACTCTCTCTCTGC0.034000.003000.629300.750001.000001.00000


Target Position: 2816, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2816UGGUUCACUAUUGAUCUAU70.70291735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6522834TGGTTCACTATTGATCTATATAGATCAATAGTGAACCA0.097000.009300.801700.750001.000001.00000


Target Position: 2867, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2867ACAUUUAAUGAGAAGUUAC72.9741501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7432885ACATTTAATGAGAAGTTACGTAACTTCTCATTAAATGT0.187600.140100.525900.500001.000001.00000


Target Position: 927, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
927CACAAUAGAGCAGUUUAUG72.00971594

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
625945CACAATAGAGCAGTTTATGCATAAACTGCTCTATTGTG0.136500.083900.637900.500001.000001.00000


Target Position: 2900, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2900CCGAACACCAUUCUAAACU68.58781971

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3512918CCGAACACCATTCTAAACTAGTTTAGAATGGTGTTCGG0.227800.139200.706900.750000.989100.75000


Target Position: 3160, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3160CCUCUGCCUCUCCCUCUAG67.74222066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3423178CCTCTGCCTCTCCCTCTAGCTAGAGGGAGAGGCAGAGG0.591600.431200.672400.750001.000001.00000


Target Position: 482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
482AGGAGGUGACCAGGGAGGA69.67531847

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942500AGGAGGTGACCAGGGAGGATCCTCCCTGGTCACCTCCT0.116400.017000.474100.500000.962000.75000


Target Position: 3706, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3706GCUUCUUUAUCUUGGUAAC75.10911269

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7343724GCTTCTTTATCTTGGTAACGTTACCAAGATAAAGAAGC0.063400.019300.706900.750001.000001.00000


Target Position: 1972, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1972CUGAGUUCUAUGUUUCCUU79.6177865

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4091990CTGAGTTCTATGTTTCCTTAAGGAAACATAGAACTCAG0.404100.196200.646600.750001.000001.00000


Target Position: 1874, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1874ACCAGAAUGAGUAAAGCAG67.70562070

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6121892ACCAGAATGAGTAAAGCAGCTGCTTTACTCATTCTGGT0.252900.140100.569000.500001.000001.00000


Target Position: 753, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
753CAGUCCACAGGAAGAGGUU79.1636901

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802771CAGTCCACAGGAAGAGGTTAACCTCTTCCTGTGGACTG0.105300.003500.637900.750000.951100.75000


Target Position: 3193, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3193CUGCUCUAGUUCAUUUUCU75.88451201

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8413211CTGCTCTAGTTCATTTTCTAGAAAATGAACTAGAGCAG0.864200.005400.560300.500001.000001.00000


Target Position: 2625, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2625GCUUAAUAACAUUGAUAGU85.3322456

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9202643GCTTAATAACATTGATAGTACTATCAATGTTATTAAGC0.024300.017900.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2623-2645ATGCTTAATAACATTGATAGTAGACUAUCAAUGUUAUUAAGCAUGCUUAAUAACAUUGAUAGUAGU13.4-2.332


Target Position: 1343, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1343UCCAGCAAUCCACCUUUUC49.65053493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8671361TCCAGCAATCCACCTTTTCGAAAAGGTGGATTGCTGGA0.097400.013400.698300.500001.000001.00000


Target Position: 2505, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2505GAUAAAUAAAAAGAAAAAA90.1038223

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4052523GATAAATAAAAAGAAAAAATTTTTTCTTTTTATTTATC0.922600.208300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2503-2525TAGATAAATAAAAAGAAAAAAAAUUUUUUCUUUUUAUUUAUCUAGAUAAAUAAAAAGAAAAAAAAU5.5-8.010


Target Position: 2164, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2164AACCCCAUUCUGCUUUAAA79.7331848

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6432182AACCCCATTCTGCTTTAAATTTAAAGCAGAATGGGGTT0.169700.097700.646600.500001.000001.00000


Target Position: 2557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2557GUGGUUUGCUUUUUUUUUU75.30231249

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7302575GTGGTTTGCTTTTTTTTTTAAAAAAAAAAGCAAACCAC0.089500.005800.793100.750001.000001.00000


Target Position: 3724, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3724CAGCAUUAUUUCAAGCAUA97.314243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7923742CAGCATTATTTCAAGCATATATGCTTGAAATAATGCTG0.048400.031700.741400.750000.989100.62500


Target Position: 1948, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1948GGCAUUUUUGUUAACCAUA88.6678288

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1946-1968AAGGCATTTTTGTTAACCATATCUAUGGUUAACAAAAAUGCCUUGGCAUUUUUGUUAACCAUAUCU20.014.022


Target Position: 3662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3662UGGUUAAUCUUUGCCUUUA79.8593839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6263680TGGTTAATCTTTGCCTTTATAAAGGCAAAGATTAACCA0.091100.012600.810300.750001.000001.00000


Target Position: 674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
674CUCUGAAGGAAAUGGAAAC68.86631942

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
829692CTCTGAAGGAAATGGAAACGTTTCCATTTCCTTCAGAG0.041600.005100.663800.500001.000001.00000


Target Position: 3643, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3643GUUUACUUGUGGGAUUAUU77.16971082

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3641-3663TAGTTTACTTGTGGGATTATTTGAAUAAUCCCACAAGUAAACUAGUUUACUUGUGGGAUUAUUUGU15.44.932


Target Position: 2960, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2960GGUAGACAGAUAUCCUUAU92.4295148

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_1296019GGTAGACAGATATCCTTAT1/1/0/097.75BAG1NM_004323.41NANANA9:33253364..33253382(-)00BAG1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362978GGTAGACAGATATCCTTATATAAGGATATCTGTCTACC0.026600.001400.810301.000000.940200.87500


Target Position: 1950, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1950CAUUUUUGUUAACCAUAUC75.14041264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9511968CATTTTTGTTAACCATATCGATATGGTTAACAAAAATG0.353400.079000.474100.500001.000001.00000


Target Position: 3377, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3377UCUUUCAGGUCCUCAGAUG62.9282532

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9543395TCTTTCAGGTCCTCAGATGCATCTGAGGACCTGAAAGA0.055300.032800.569000.500001.000001.00000


Target Position: 1941, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1941CUUCAAAGGCAUUUUUGUU79.7186851

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8991959CTTCAAAGGCATTTTTGTTAACAAAAATGCCTTTGAAG0.090800.002300.491400.750000.994600.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1939-1961TCCTTCAAAGGCATTTTTGTTAAAACAAAAAUGCCUUUGAAGGACUUCAAAGGCAUUUUUGUUAAU5.612.232


Target Position: 3198, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3198CUAGUUCAUUUUCUUUAGA83.2911597

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3196-3218CTCTAGTTCATTTTCTTTAGAGCUCUAAAGAAAAUGAACUAGAGCUAGUUCAUUUUCUUUAGAGCU11.720.322


Target Position: 2287, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2287UGCUGUGAGCCGAGAUUAC66.62052179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9132305TGCTGTGAGCCGAGATTACGTAATCTCGGCTCACAGCA0.211400.001700.672400.500000.945700.62500


Target Position: 2966, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2966CAGAUAUCCUUAUUUUAGA93.5073121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682984CAGATATCCTTATTTTAGATCTAAAATAAGGATATCTG0.034200.003900.560300.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2964-2986GACAGATATCCTTATTTTAGAGAUCUAAAAUAAGGAUAUCUGUCCAGAUAUCCUUAUUUUAGAGAU-4.315.922


Target Position: 3304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3304AGUCUUUACCCCAUGCCUU75.56751228

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6203322AGTCTTTACCCCATGCCTTAAGGCATGGGGTAAAGACT0.228900.134300.569000.750001.000001.00000


Target Position: 1520, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1520UAGUCCCAUAGCUGUAAAA80.926767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8241538TAGTCCCATAGCTGTAAAATTTTACAGCTATGGGACTA0.094500.042600.672400.500001.000001.00000


Target Position: 798, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
798GAAGUCUGUGGAGAAGAUA89.8198233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
884816GAAGTCTGTGGAGAAGATATATCTTCTCCACAGACTTC0.049400.002100.629300.750001.000001.00000


Target Position: 3800, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3800AACAUAUAUAACAAGCAUA90.9455198

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7063818AACATATATAACAAGCATATATGCTTGTTATATATGTT0.071800.015100.603400.500001.000001.00000


Target Position: 673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
673UCUCUGAAGGAAAUGGAAA77.79961023

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
828691TCTCTGAAGGAAATGGAAATTTCCATTTCCTTCAGAGA0.041800.003600.724100.750001.000001.00000


Target Position: 1250, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1250ACUCUCACACUGGUUCUCA77.68931029

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9701268ACTCTCACACTGGTTCTCATGAGAACCAGTGTGAGAGT0.069900.057400.482800.500001.000001.00000


Target Position: 1869, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1869AAGGCACCAGAAUGAGUAA88.2259300

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8881887AAGGCACCAGAATGAGTAATTACTCATTCTGGTGCCTT0.282000.014500.603400.500000.994600.62500


Target Position: 554, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
554ACCUUCAUGUUACCUCCCA72.38661564

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
894572ACCTTCATGTTACCTCCCATGGGAGGTAACATGAAGGT0.201000.035200.508600.500001.000001.00000


Target Position: 417, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
417GACCCAGGGCGAAGAGAUG71.85761612

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
905435GACCCAGGGCGAAGAGATGCATCTCTTCGCCCTGGGTC0.125700.001800.663800.500000.951100.62500


Target Position: 3077, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3077GCCAGUGCUUUUCCCCUCU70.29731776

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9593095GCCAGTGCTTTTCCCCTCTAGAGGGGAAAAGCACTGGC0.860600.001100.775900.750001.000001.00000


Target Position: 1517, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1517GUGUAGUCCCAUAGCUGUA91.8115171

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6411535GTGTAGTCCCATAGCTGTATACAGCTATGGGACTACAC0.088500.045200.612100.750001.000001.00000


Target Position: 665, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
665AGGGAAAAUCUCUGAAGGA84.4868508

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
950683AGGGAAAATCTCTGAAGGATCCTTCAGAGATTTTCCCT0.024400.005100.474100.500001.000001.00000


Target Position: 1305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1305CCUAUCUGUUUUCUCCUUC65.18972311

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5261323CCTATCTGTTTTCTCCTTCGAAGGAGAAAACAGATAGG0.240300.109900.672400.750001.000001.00000


Target Position: 2502, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2502GUAGAUAAAUAAAAAGAAA98.513328

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3132520GTAGATAAATAAAAAGAAATTTCTTTTTATTTATCTAC0.917800.070800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2500-2522AAGTAGATAAATAAAAAGAAAAAUUUCUUUUUAUUUAUCUACUUGUAGAUAAAUAAAAAGAAAAAU5.58.421


Target Position: 3433, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3433CUACUACCUCUGCUUGAAC72.02191592

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7503451CTACTACCTCTGCTTGAACGTTCAAGCAGAGGTAGTAG0.100900.051600.525900.500001.000001.00000


Target Position: 3454, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3454CUCCUCACCUUCCUUCCUC60.01792790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8673472CTCCTCACCTTCCTTCCTCGAGGAAGGAAGGTGAGGAG0.903700.357500.500000.500001.000001.00000


Target Position: 3384, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3384GGUCCUCAGAUGCACUGCA89.3828253

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9723402GGTCCTCAGATGCACTGCATGCAGTGCATCTGAGGACC0.012900.004500.500000.750000.923900.75000


Target Position: 3858, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3858AUAUUUGGAGAACAAAAAA82.8814615

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7423876ATATTTGGAGAACAAAAAATTTTTTGTTCTCCAAATAT0.674000.041900.543100.500001.000001.00000


Target Position: 2959, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2959AGGUAGACAGAUAUCCUUA94.93790

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9362977AGGTAGACAGATATCCTTATAAGGATATCTGTCTACCT0.020800.001600.810300.750000.940200.87500


Target Position: 1430, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1430GAGAGCUCUAAUUUGCCUU78.5177960

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8811448GAGAGCTCTAATTTGCCTTAAGGCAAATTAGAGCTCTC0.052400.002100.672400.750000.907600.62500


Target Position: 2168, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2168CCAUUCUGCUUUAAAAAAA88.0555315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2022186CCATTCTGCTTTAAAAAAATTTTTTTAAAGCAGAATGG0.831200.132200.844801.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2166-2188CCCCATTCTGCTTTAAAAAAAAAUUUUUUUAAAGCAGAAUGGGGCCAUUCUGCUUUAAAAAAAAAU-9.118.112


Target Position: 3846, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3846AGACCUCAAUAAAUAUUUG78.4162972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8853864AGACCTCAATAAATATTTGCAAATATTTATTGAGGTCT0.222700.002100.577600.500001.000001.00000


Target Position: 3192, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3192UCUGCUCUAGUUCAUUUUC58.03362957

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7373210TCTGCTCTAGTTCATTTTCGAAAATGAACTAGAGCAGA0.869100.005800.551700.500001.000001.00000


Target Position: 476, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
476GGAGCGAGGAGGUGACCAG76.88181113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
840494GGAGCGAGGAGGTGACCAGCTGGTCACCTCCTCGCTCC0.039800.012500.586200.750000.962000.75000


Target Position: 2492, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2492GUAAGUAAAAGUAGAUAAA94.863593

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6932510GTAAGTAAAAGTAGATAAATTTATCTACTTTTACTTAC0.076000.067800.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2490-2512AAGTAAGTAAAAGTAGATAAATAUUUAUCUACUUUUACUUACUUGUAAGUAAAAGUAGAUAAAUAU8.46.622


Target Position: 3855, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3855UAAAUAUUUGGAGAACAAA81.2458735

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9523873TAAATATTTGGAGAACAAATTTGTTCTCCAAATATTTA0.152800.041900.534500.500001.000001.00000


Target Position: 3134, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3134CCAUUCUCUGAUUUUUUUC65.63332274

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4883152CCATTCTCTGATTTTTTTCGAAAAAAATCAGAGAATGG0.696300.510500.672400.750001.000001.00000


Target Position: 3863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3863UGGAGAACAAAAAAAAAAA82.5341637

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4593881TGGAGAACAAAAAAAAAAATTTTTTTTTTTGTTCTCCA0.976700.150400.844800.750001.000001.00000


Target Position: 3593, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3593CUCUCGACUUCCCAUACAU85.1489465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3963611CTCTCGACTTCCCATACATATGTATGGGAAGTCGAGAG0.405100.197200.655200.750001.000001.00000


Target Position: 1046, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1046CCGAGUGUGACACAGUGGA79.6352863

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7001064CCGAGTGTGACACAGTGGATCCACTGTGTCACACTCGG0.121200.018000.543100.750000.978300.62500


Target Position: 3190, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3190UCUCUGCUCUAGUUCAUUU78.7577935

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7003208TCTCTGCTCTAGTTCATTTAAATGAACTAGAGCAGAGA0.116600.007200.724100.750001.000001.00000


Target Position: 483, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
483GGAGGUGACCAGGGAGGAA88.6685287

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
550501GGAGGTGACCAGGGAGGAATTCCTCCCTGGTCACCTCC0.351900.015300.698301.000000.978300.75000


Target Position: 1615, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1615ACCACUUAUCCCUCAUUGU71.0041702

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5901633ACCACTTATCCCTCATTGTACAATGAGGGATAAGTGGT0.304100.055000.646600.500001.000001.00000


Target Position: 2864, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2864ACAACAUUUAAUGAGAAGU67.92422044

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8822882ACAACATTTAATGAGAAGTACTTCTCATTAAATGTTGT0.201700.044900.500000.500001.000001.00000


Target Position: 1518, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1518UGUAGUCCCAUAGCUGUAA76.92171109

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5851536TGTAGTCCCATAGCTGTAATTACAGCTATGGGACTACA0.099700.047800.672400.750001.000001.00000


Target Position: 759, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
759ACAGGAAGAGGUUGAACUA90.2448217

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
768777ACAGGAAGAGGTTGAACTATAGTTCAACCTCTTCCTGT0.053600.018100.534500.750001.000001.00000


Target Position: 3312, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3312CCCCAUGCCUUCUCCCAUC62.822543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1193330CCCCATGCCTTCTCCCATCGATGGGAGAAGGCATGGGG0.920500.251000.810300.750000.967400.62500


Target Position: 827, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
827UGGAAGAGUUGAAUAAAGA84.1473537

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
749845TGGAAGAGTTGAATAAAGATCTTTATTCAACTCTTCCA0.120700.007700.620700.500001.000001.00000


Target Position: 1625, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1625CCUCAUUGUGACCUAAUUC73.02911496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7451643CCTCATTGTGACCTAATTCGAATTAGGTCACAATGAGG0.060900.024500.672400.750001.000001.00000


Target Position: 2163, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2163AAACCCCAUUCUGCUUUAA76.81771121

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9572181AAACCCCATTCTGCTTTAATTAAAGCAGAATGGGGTTT0.155100.093300.465500.500001.000001.00000


Target Position: 1007, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1007AAAGGAAAGGCUUGGUAAA83.9023556

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8531025AAAGGAAAGGCTTGGTAAATTTACCAAGCCTTTCCTTT0.078100.026800.500000.500001.000001.00000


Target Position: 3274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3274CUCCAAUGGCUCACUUUCU75.7881212

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7813292CTCCAATGGCTCACTTTCTAGAAAGTGAGCCATTGGAG0.687200.104000.586200.500001.000001.00000


Target Position: 2023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2023CCCACCCCCACCCCAUCAU59.14132860

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1042041CCCACCCCCACCCCATCATATGATGGGGTGGGGGTGGG0.669500.351900.836201.000001.000001.00000


Target Position: 3849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3849CCUCAAUAAAUAUUUGGAG72.8241520

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7963867CCTCAATAAATATTTGGAGCTCCAAATATTTATTGAGG0.047800.047600.534500.750001.000001.00000


Target Position: 1845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1845CCAUGGAUUAGGAAGGGCA84.0027548

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8981863CCATGGATTAGGAAGGGCATGCCCTTCCTAATCCATGG0.097200.026300.491400.750001.000001.00000


Target Position: 373, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
373GAGGAAGCGACCUGGAGUG70.26671782

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
966391GAGGAAGCGACCTGGAGTGCACTCCAGGTCGCTTCCTC0.014700.001700.517200.500000.907600.62500


Target Position: 3132, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3132GCCCAUUCUCUGAUUUUUU80.0435821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1513150GCCCATTCTCTGATTTTTTAAAAAATCAGAGAATGGGC0.552000.343801.000001.000001.000001.00000


Target Position: 1557, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1557UGCACCUAGUCAGGAAUAU69.03691920

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9551575TGCACCTAGTCAGGAATATATATTCCTGACTAGGTGCA0.086600.001100.810300.750000.956501.00000


Target Position: 291, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
291CAGGCCGCGGAUGAAGAAG57.91872963

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
973309CAGGCCGCGGATGAAGAAGCTTCTTCATCCGCGGCCTG0.629000.001000.646600.500001.000001.00000


Target Position: 3632, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3632AGUCCAUGAUAGUUUACUU92.2896155

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6343650AGTCCATGATAGTTTACTTAAGTAAACTATCATGGACT0.093500.010600.569000.750001.000001.00000


Target Position: 3011, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3011CAUUAGCGCAAGGUUGUAG70.41411764

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223029CATTAGCGCAAGGTTGTAGCTACAACCTTGCGCTAATG0.091400.012900.482800.500001.000001.00000


Target Position: 630, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
630AGGGGUUCCACAGUCUUUU68.39561992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
966648AGGGGTTCCACAGTCTTTTAAAAGACTGTGGAACCCCT0.033100.001100.844800.750000.978300.75000


Target Position: 3716, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3716CUUGGUAACAGCAUUAUUU82.518643

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5733734CTTGGTAACAGCATTATTTAAATAATGCTGTTACCAAG0.180700.014200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3714-3736ATCTTGGTAACAGCATTATTTCAAAAUAAUGCUGUUACCAAGAUCUUGGUAACAGCAUUAUUUCAU-1.820.022


Target Position: 2252, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2252GGCACAAGAAUCAUUUGAA97.826237

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6502270GGCACAAGAATCATTTGAATTCAAATGATTCTTGTGCC0.133100.009400.827601.000001.000001.00000


Target Position: 1321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1321UUCUGUCUCUGUGGUUGUA75.79631211

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8951339TTCTGTCTCTGTGGTTGTATACAACCACAGAGACAGAA0.062900.047500.491400.500001.000001.00000


Target Position: 2964, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2964GACAGAUAUCCUUAUUUUA101.11112

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9382982GACAGATATCCTTATTTTATAAAATAAGGATATCTGTC0.020500.005900.784500.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2962-2984TAGACAGATATCCTTATTTTAGAUAAAAUAAGGAUAUCUGUCUAGACAGAUAUCCUUAUUUUAGAU-9.720.322


Target Position: 657, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
657CAUAUUUAAGGGAAAAUCU82.487645

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
655-677CTCATATTTAAGGGAAAATCTCTAGAUUUUCCCUUAAAUAUGAGCAUAUUUAAGGGAAAAUCUCUU10.4-8.012


Target Position: 975, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
975CCUGCCAGAAAAUUUCAAA84.8638478

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
390993CCTGCCAGAAAATTTCAAATTTGAAATTTTCTGGCAGG0.234800.036400.844801.000001.000001.00000


Target Position: 906, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
906ACUUGAUAGGAGAGUAAAA92.5205146

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
598924ACTTGATAGGAGAGTAAAATTTTACTCTCCTATCAAGT0.096100.018700.706900.750001.000001.00000


Target Position: 3023, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3023GUUGUAGAGUAAGCGGCAA84.2745522

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8563041GTTGTAGAGTAAGCGGCAATTGCCGCTTACTCTACAAC0.036000.008800.500000.750001.000001.00000


Target Position: 2865, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2865CAACAUUUAAUGAGAAGUU84.1861533

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8222883CAACATTTAATGAGAAGTTAACTTCTCATTAAATGTTG0.193000.044200.500000.750001.000001.00000


Target Position: 3016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3016GCGCAAGGUUGUAGAGUAA96.106968

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5523034GCGCAAGGTTGTAGAGTAATTACTCTACAACCTTGCGC0.168900.015200.887901.000001.000001.00000


Target Position: 749, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
749AGAACAGUCCACAGGAAGA86.4013392

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
864767AGAACAGTCCACAGGAAGATCTTCCTGTGGACTGTTCT0.144800.020200.500000.500000.972800.87500


Target Position: 3696, Predicted by: Biltr, Ernai

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3696GGGUGAAGGAGCUUCUUUA99.451622

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_2369619GGGTGAAGGAGCTTCTTTA1/1/0/097.75BAG1NM_004323.41NANANA9:33252628..33252646(-)00BAG1(0.002)


Target Position: 1302, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1302GCUCCUAUCUGUUUUCUCC74.64751317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681320GCTCCTATCTGTTTTCTCCGGAGAAAACAGATAGGAGC0.170900.065300.482800.500001.000001.00000


Target Position: 1246, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1246UCCUACUCUCACACUGGUU68.46431985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6701264TCCTACTCTCACACTGGTTAACCAGTGTGAGAGTAGGA0.100900.008500.724100.750001.000001.00000


Target Position: 1371, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1371CCACCUCUGCCCAAAUUUU78.7088940

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5211389CCACCTCTGCCCAAATTTTAAAATTTGGGCAGAGGTGG0.268900.017900.844801.000001.000001.00000


Target Position: 3168, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3168UCUCCCUCUAGCUCCCACU60.79542709

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7673186TCTCCCTCTAGCTCCCACTAGTGGGAGCTAGAGGGAGA0.631500.555700.517200.500000.994600.62500


Target Position: 3277, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3277CAAUGGCUCACUUUCUCUU83.8811557

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8143295CAATGGCTCACTTTCTCTTAAGAGAAAGTGAGCCATTG0.673100.074500.508600.750001.000001.00000


Target Position: 3305, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3305GUCUUUACCCCAUGCCUUC64.65392362

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8363323GTCTTTACCCCATGCCTTCGAAGGCATGGGGTAAAGAC0.240400.148900.646600.500001.000001.00000


Target Position: 915, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
915GAGAGUAAAAGCCACAAUA96.31765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
376933GAGAGTAAAAGCCACAATATATTGTGGCTTTTACTCTC0.212100.040000.767200.750001.000001.00000


Target Position: 2667, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2667CUAAAGACUCACAUCAUUU87.0492357

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6882685CTAAAGACTCACATCATTTAAATGATGTGAGTCTTTAG0.076700.036000.672400.750000.983701.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2665-2687ACCTAAAGACTCACATCATTTGGAAAUGAUGUGAGUCUUUAGGUCUAAAGACUCACAUCAUUUGGU13.614.622


Target Position: 1473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1473CCCUCAGUCUUCAGAUACA93.901111

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8161491CCCTCAGTCTTCAGATACATGTATCTGAAGACTGAGGG0.044500.018100.784500.750001.000001.00000


Target Position: 294, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
294GCCGCGGAUGAAGAAGAAA80.9767760

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
760312GCCGCGGATGAAGAAGAAATTTCTTCTTCATCCGCGGC0.780900.004801.000001.000001.000001.00000


Target Position: 1304, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1304UCCUAUCUGUUUUCUCCUU69.94351810

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3701322TCCTATCTGTTTTCTCCTTAAGGAGAAAACAGATAGGA0.212900.096000.732800.750001.000001.00000


Target Position: 1868, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1868GAAGGCACCAGAAUGAGUA91.8099172

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9031886GAAGGCACCAGAATGAGTATACTCATTCTGGTGCCTTC0.284600.017400.491400.750001.000001.00000


Target Position: 1275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1275AAUAGUGUCUUUGUGAUUU76.7521127

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7851293AATAGTGTCTTTGTGATTTAAATCACAAAGACACTATT0.159300.031500.508600.500001.000001.00000


Target Position: 3624, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3624AUUUACAUAGUCCAUGAUA82.8344619

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9563642ATTTACATAGTCCATGATATATCATGGACTATGTAAAT0.051800.035700.465500.500001.000001.00000


Target Position: 2201, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2201UAGCUUGGCGUAGUGGCAU63.38082491

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242219TAGCTTGGCGTAGTGGCATATGCCACTACGCCAAGCTA0.023000.003400.517200.500001.000001.00000


Target Position: 1295, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1295GAGUAAAGCUCCUAUCUGU94.4297102

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8901313GAGTAAAGCTCCTATCTGTACAGATAGGAGCTTTACTC0.104400.003400.603400.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1293-1315TTGAGTAAAGCTCCTATCTGTTTACAGAUAGGAGCUUUACUCAAGAGUAAAGCUCCUAUCUGUUUU17.89.833


Target Position: 2663, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2663CUACCUAAAGACUCACAUC77.26981068

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9012681CTACCTAAAGACTCACATCGATGTGAGTCTTTAGGTAG0.145400.037900.491400.500000.983700.62500


Target Position: 965, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
965ACACACUGAUCCUGCCAGA80.7301784

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
928983ACACACTGATCCTGCCAGATCTGGCAGGATCAGTGTGT0.103100.008900.482800.500000.956500.62500


Target Position: 1469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1469GGCCCCCUCAGUCUUCAGA75.11981268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5751487GGCCCCCTCAGTCTTCAGATCTGAAGACTGAGGGGGCC0.102800.049800.775900.750001.000001.00000


Target Position: 3083, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3083GCUUUUCCCCUCUACUGUA91.7013177

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3573101GCTTTTCCCCTCTACTGTATACAGTAGAGGGGAAAAGC0.232300.069000.672401.000001.000001.00000


Target Position: 795, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
795GGAGAAGUCUGUGGAGAAG78.4655967

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
876813GGAGAAGTCTGTGGAGAAGCTTCTCCACAGACTTCTCC0.032800.005900.732800.750001.000001.00000


Target Position: 1274, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1274AAAUAGUGUCUUUGUGAUU80.6055796

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9001292AAATAGTGTCTTTGTGATTAATCACAAAGACACTATTT0.158000.029400.491400.500001.000001.00000


Target Position: 3594, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3594UCUCGACUUCCCAUACAUU78.4827965

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3253612TCTCGACTTCCCATACATTAATGTATGGGAAGTCGAGA0.430700.210700.715500.750001.000001.00000


Target Position: 933, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
933AGAGCAGUUUAUGAAGAUC72.75511526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
707951AGAGCAGTTTATGAAGATCGATCTTCATAAACTGCTCT0.071800.029900.543100.500001.000001.00000


Target Position: 2459, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2459GCAACAUAGCAAGACCCCA84.6833493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7952477GCAACATAGCAAGACCCCATGGGGTCTTGCTATGTTGC0.209800.127600.508600.750000.994600.75000


Target Position: 2817, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2817GGUUCACUAUUGAUCUAUU98.667926

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_6281719GGTTCACTATTGATCTATT1/1/0/097.21BAG1NM_004323.41NANANANA00BAG1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6662835GGTTCACTATTGATCTATTAATAGATCAATAGTGAACC0.101600.008800.844801.000001.000001.00000


Target Position: 2019, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2019GUCCCCCACCCCCACCCCA61.54492658

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482037GTCCCCCACCCCCACCCCATGGGGTGGGGGTGGGGGAC0.654400.314600.474100.500001.000001.00000


Target Position: 1258, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1258ACUGGUUCUCAAUGAAAAA86.7372379

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5911276ACTGGTTCTCAATGAAAAATTTTTCATTGAGAACCAGT0.097600.018900.706900.750001.000001.00000


Target Position: 3173, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3173CUCUAGCUCCCACUUCCUC63.66112466

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9223191CTCTAGCTCCCACTTCCTCGAGGAAGTGGGAGCTAGAG0.501400.185600.500000.500000.978301.00000


Target Position: 3623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3623CAUUUACAUAGUCCAUGAU87.9159322

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9473641CATTTACATAGTCCATGATATCATGGACTATGTAAATG0.048400.037700.474100.750001.000001.00000


Target Position: 3664, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3664GUUAAUCUUUGCCUUUAAC70.63831739

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9383682GTTAATCTTTGCCTTTAACGTTAAAGGCAAAGATTAAC0.088800.028000.500000.500001.000001.00000


Target Position: 3224, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3224GAGUGAUCAUGAAGUGCAA103.2724

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6613242GAGTGATCATGAAGTGCAATTGCACTTCATGATCACTC0.084300.036000.663800.750001.000001.00000


Target Position: 1555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1555GUUGCACCUAGUCAGGAAU79.0731907

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9681573GTTGCACCTAGTCAGGAATATTCCTGACTAGGTGCAAC0.098900.001100.637900.750000.956500.87500


Target Position: 3635, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3635CCAUGAUAGUUUACUUGUG79.9992824

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8713653CCATGATAGTTTACTTGTGCACAAGTAAACTATCATGG0.033700.019000.551700.750001.000001.00000


Target Position: 2537, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2537GCUCAUCAUAAAGUAGAAG72.56931551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5672555GCTCATCATAAAGTAGAAGCTTCTACTTTATGATGAGC0.104400.058600.715500.750001.000001.00000


Target Position: 2983, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2983GAGAUGAGGAAACCAAGAG74.12031373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9813001GAGATGAGGAAACCAAGAGCTCTTGGTTTCCTCATCTC0.194700.005200.500000.500001.000001.00000


Target Position: 485, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
485AGGUGACCAGGGAGGAAAU79.2967890

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
563503AGGTGACCAGGGAGGAAATATTTCCTCCCTGGTCACCT0.167200.014600.836200.750000.978301.00000


Target Position: 932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
932UAGAGCAGUUUAUGAAGAU79.1856899

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906950TAGAGCAGTTTATGAAGATATCTTCATAAACTGCTCTA0.078400.037800.491400.500001.000001.00000


Target Position: 3608, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3608ACAUUUCUUUCACAGCAUU77.33081066

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3043626ACATTTCTTTCACAGCATTAATGCTGTGAAAGAAATGT0.669900.663000.698300.750001.000001.00000


Target Position: 2455, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2455CUGGGCAACAUAGCAAGAC58.30272934

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9642473CTGGGCAACATAGCAAGACGTCTTGCTATGTTGCCCAG0.231600.002500.465500.500000.951101.00000


Target Position: 2820, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2820UCACUAUUGAUCUAUUUUU75.79761210

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6932838TCACTATTGATCTATTTTTAAAAATAGATCAATAGTGA0.134600.007500.724100.750001.000001.00000


Target Position: 1660, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1660GUUGUUGGGUUCUAGACUU82.3682656

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8631678GTTGTTGGGTTCTAGACTTAAGTCTAGAACCCAACAAC0.196400.002500.508600.750001.000001.00000


Target Position: 3620, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3620CAGCAUUUACAUAGUCCAU87.5191339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7193638CAGCATTTACATAGTCCATATGGACTATGTAAATGCTG0.068600.058200.629300.750001.000001.00000


Target Position: 1382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1382CAAAUUUUCCCAGCUGUUU71.73041625

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7291400CAAATTTTCCCAGCTGTTTAAACAGCTGGGAAAATTTG0.065600.008700.646600.750001.000001.00000


Target Position: 968, Predicted by: Biltr, Ernai, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
968CACUGAUCCUGCCAGAAAA98.134432

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_496819CACTGATCCTGCCAGAAAA1/1/0/097.21BAG1NM_004323.41NANANAX:38338998..38339016(+)00BAG1(0.002)

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
584986CACTGATCCTGCCAGAAAATTTTCTGGCAGGATCAGTG0.232000.013600.793100.750000.956500.75000


Target Position: 1847, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1847AUGGAUUAGGAAGGGCAAA69.68461846

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8421865ATGGATTAGGAAGGGCAAATTTGCCCTTCCTAATCCAT0.133400.034800.655200.500001.000001.00000


Target Position: 2563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2563UGCUUUUUUUUUUUUUUUU65.08442325

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4092581TGCTTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAAGCA0.248100.058500.853400.750001.000001.00000


Target Position: 3318, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3318GCCUUCUCCCAUCUCAUCU72.94541503

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2243336GCCTTCTCCCATCTCATCTAGATGAGATGGGAGAAGGC0.902900.467000.775900.750001.000001.00000


Target Position: 3382, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3382CAGGUCCUCAGAUGCACUG66.40532204

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9793400CAGGTCCTCAGATGCACTGCAGTGCATCTGAGGACCTG0.012300.006100.500000.500000.934800.62500


Target Position: 1380, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1380CCCAAAUUUUCCCAGCUGU70.13321795

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9211398CCCAAATTTTCCCAGCTGTACAGCTGGGAAAATTTGGG0.023900.012100.784500.750001.000001.00000


Target Position: 2655, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2655CUAUAACUCUACCUAAAGA95.16986

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2653-2675CGCTATAACTCTACCTAAAGACTUCUUUAGGUAGAGUUAUAGCGCUAUAACUCUACCUAAAGACUU15.86.333


Target Position: 2857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2857GUGGGCCACAACAUUUAAU76.71591132

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052875GTGGGCCACAACATTTAATATTAAATGTTGTGGCCCAC0.215900.006700.784500.750001.000001.00000


Target Position: 3600, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3600CUUCCCAUACAUUUCUUUC66.73082163

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9633618CTTCCCATACATTTCTTTCGAAAGAAATGTATGGGAAG0.772600.349000.465500.500001.000001.00000


Target Position: 3839, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3839UAUAGUAAGACCUCAAUAA89.8534230

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7903857TATAGTAAGACCTCAATAATTATTGAGGTCTTACTATA0.456400.003900.508600.500001.000001.00000


Target Position: 2571, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2571UUUUUUUUUUUGGAUUAAU62.85662540

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8942589TTTTTTTTTTTGGATTAATATTAATCCAAAAAAAAAAA0.114900.060200.491400.500001.000001.00000


Target Position: 3275, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3275UCCAAUGGCUCACUUUCUC56.30833095

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6443293TCCAATGGCTCACTTTCTCGAGAAAGTGAGCCATTGGA0.818200.108500.560300.500001.000001.00000


Target Position: 3705, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3705AGCUUCUUUAUCUUGGUAA81.787695

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7763723AGCTTCTTTATCTTGGTAATTACCAAGATAAAGAAGCT0.051600.010800.819000.750001.000001.00000


Target Position: 2037, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2037AUCAUUGUUUUUAAAAAAU71.65261634

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8002055ATCATTGTTTTTAAAAAATATTTTTTAAAAACAATGAT0.497100.388900.672400.500001.000001.00000


Target Position: 640, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
640CAGUCUUUUCAGAAACUCA97.110350

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
638-660CACAGTCTTTTCAGAAACTCATAUGAGUUUCUGAAAAGACUGUGCAGUCUUUUCAGAAACUCAUAU21.517.721


Target Position: 3229, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3229AUCAUGAAGUGCAAAUCUU77.42331055

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6793247ATCATGAAGTGCAAATCTTAAGATTTGCACTTCATGAT0.092500.018700.543100.500001.000001.00000


Target Position: 3539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3539GGAGAACCCUCACCUACUG77.17841080

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8723557GGAGAACCCTCACCTACTGCAGTAGGTGAGGGTTCTCC0.093200.002200.586200.750000.934800.62500


Target Position: 1260, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1260UGGUUCUCAAUGAAAAAUA78.9808916

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6701278TGGTTCTCAATGAAAAATATATTTTTCATTGAGAACCA0.081700.017300.801700.750001.000001.00000


Target Position: 1005, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1005GAAAAGGAAAGGCUUGGUA86.1883402

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021023GAAAAGGAAAGGCTTGGTATACCAAGCCTTTCCTTTTC0.036300.011500.491400.750001.000001.00000


Target Position: 1973, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1973UGAGUUCUAUGUUUCCUUC68.40341989

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7381991TGAGTTCTATGTTTCCTTCGAAGGAAACATAGAACTCA0.429800.214800.551700.500001.000001.00000


Target Position: 3316, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3316AUGCCUUCUCCCAUCUCAU75.52891233

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8693334ATGCCTTCTCCCATCTCATATGAGATGGGAGAAGGCAT0.920400.311600.500000.500001.000001.00000


Target Position: 539, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
539GCAAUGAGAAGCACGACCU78.2692985

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
801557GCAATGAGAAGCACGACCTAGGTCGTGCTTCTCATTGC0.057200.008300.508600.750001.000001.00000


Target Position: 1474, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1474CCUCAGUCUUCAGAUACAU84.435511

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9351492CCTCAGTCTTCAGATACATATGTATCTGAAGACTGAGG0.020900.012200.689701.000001.000001.00000


Target Position: 1841, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1841AGAGCCAUGGAUUAGGAAG66.67952170

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9021859AGAGCCATGGATTAGGAAGCTTCCTAATCCATGGCTCT0.232600.006900.586200.500000.978300.87500


Target Position: 698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
698UGUCAGCACUUGGAAUACA81.6056707

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
942716TGTCAGCACTTGGAATACATGTATTCCAAGTGCTGACA0.019000.009100.500000.500000.956500.62500


Target Position: 2784, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2784CCCAGCCCACCGCACCCCA64.41642386

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5972802CCCAGCCCACCGCACCCCATGGGGTGCGGTGGGCTGGG0.116700.012800.646600.750000.929301.00000


Target Position: 989, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
989UCAAAGACAGUAGAUUGAA78.7973932

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6681007TCAAAGACAGTAGATTGAATTCAATCTACTGTCTTTGA0.227600.087400.551700.750001.000001.00000


Target Position: 1563, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1563UAGUCAGGAAUAUUGGGAA83.9153555

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8601581TAGTCAGGAATATTGGGAATTCCCAATATTCCTGACTA0.073700.007500.500000.500001.000001.00000


Target Position: 3181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3181CCCACUUCCUCUCUGCUCU73.74161412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9373199CCCACTTCCTCTCTGCTCTAGAGCAGAGAGGAAGTGGG0.020600.020500.767200.750001.000001.00000


Target Position: 2791, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2791CACCGCACCCCAACUUUAA83.4291587

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4592809CACCGCACCCCAACTTTAATTAAAGTTGGGGTGCGGTG0.267900.026100.758600.750001.000001.00000


Target Position: 3015, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3015AGCGCAAGGUUGUAGAGUA93.9014110

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5313033AGCGCAAGGTTGTAGAGTATACTCTACAACCTTGCGCT0.181300.016500.672400.750001.000001.00000


Target Position: 2181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2181AAAAAAAAAAAAAAAAAAA83.5835577

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8682199AAAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTT0.864000.816900.500000.500001.000001.00000


Target Position: 2473, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2473CCCCAUCUCUAAAAUUUAA91.5208185

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1552491CCCCATCTCTAAAATTTAATTAAATTTTAGAGATGGGG0.549200.235300.956901.000001.000001.00000


Target Position: 3627, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3627UACAUAGUCCAUGAUAGUU74.63941318

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9063645TACATAGTCCATGATAGTTAACTATCATGGACTATGTA0.077800.025200.534500.500001.000001.00000


Target Position: 904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
904AAACUUGAUAGGAGAGUAA89.2396263

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
965922AAACTTGATAGGAGAGTAATTACTCTCCTATCAAGTTT0.059100.010000.465500.500001.000001.00000


Target Position: 2653, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2653CGCUAUAACUCUACCUAAA99.49320

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4102671CGCTATAACTCTACCTAAATTTAGGTAGAGTTATAGCG0.312400.033500.922401.000001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2651-2673TGCGCTATAACTCTACCTAAAGAUUUAGGUAGAGUUAUAGCGCACGCUAUAACUCUACCUAAAGAU19.814.933


Target Position: 2794, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2794CGCACCCCAACUUUAAUCA77.94061005

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4962812CGCACCCCAACTTTAATCATGATTAAAGTTGGGGTGCG0.144500.080700.698300.750001.000001.00000


Target Position: 2508, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2508AAAUAAAAAGAAAAAAAAA89.3694254

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8582526AAATAAAAAGAAAAAAAAATTTTTTTTTCTTTTTATTT0.875800.179300.500000.500001.000001.00000


Target Position: 3604, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3604CCAUACAUUUCUUUCACAG76.63311141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6343622CCATACATTTCTTTCACAGCTGTGAAAGAAATGTATGG0.720300.479000.560300.750001.000001.00000


Target Position: 1044, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1044AGCCGAGUGUGACACAGUG74.39811339

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7351062AGCCGAGTGTGACACAGTGCACTGTGTCACACTCGGCT0.127600.005600.560300.500000.929300.62500


Target Position: 2148, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2148CCAGGCAACAUAGCAAAAC60.59212736

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4062166CCAGGCAACATAGCAAAACGTTTTGCTATGTTGCCTGG0.186000.035400.698300.750000.951101.00000


Target Position: 3008, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3008GGUCAUUAGCGCAAGGUUG74.66981315

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8923026GGTCATTAGCGCAAGGTTGCAACCTTGCGCTAATGACC0.030300.014900.706900.750001.000001.00000


Target Position: 2560, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2560GUUUGCUUUUUUUUUUUUU72.04741589

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5122578GTTTGCTTTTTTTTTTTTTAAAAAAAAAAAAAGCAAAC0.160600.018700.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2558-2580TGGTTTGCTTTTTTTTTTTTTTTAAAAAAAAAAAAAGCAAACCAGUUUGCUUUUUUUUUUUUUUUU-11.318.600


Target Position: 1964, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1964AUAUCCUUCUGAGUUCUAU77.65741033

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8551982ATATCCTTCTGAGTTCTATATAGAACTCAGAAGGATAT0.266700.201200.500000.500001.000001.00000


Target Position: 1974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1974GAGUUCUAUGUUUCCUUCA86.6788380

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8591992GAGTTCTATGTTTCCTTCATGAAGGAAACATAGAACTC0.304800.178200.586200.500001.000001.00000


Target Position: 3469, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3469CCUCCAACCCUACCCUUGU69.9771807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4633487CCTCCAACCCTACCCTTGTACAAGGGTAGGGTTGGAGG0.488700.518700.637900.750000.989100.62500


Target Position: 2465, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2465UAGCAAGACCCCAUCUCUA85.6729428

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8442483TAGCAAGACCCCATCTCTATAGAGATGGGGTCTTGCTA0.264600.133300.500000.500000.929300.75000


Target Position: 2514, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2514AAAGAAAAAAAAACUGUUU74.00871383

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8202532AAAGAAAAAAAAACTGTTTAAACAGTTTTTTTTTCTTT0.103300.054100.500000.500001.000001.00000


Target Position: 3133, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3133CCCAUUCUCUGAUUUUUUU78.874923

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
1193151CCCATTCTCTGATTTTTTTAAAAAAATCAGAGAATGGG0.628200.484500.991401.000001.000001.00000


Target Position: 3590, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3590CCUCUCUCGACUUCCCAUA79.5259872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2443608CCTCTCTCGACTTCCCATATATGGGAAGTCGAGAGAGG0.342200.172200.801701.000001.000001.00000


Target Position: 3426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3426GCUCCUGCUACUACCUCUG69.87511821

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6283444GCTCCTGCTACTACCTCTGCAGAGGTAGTAGCAGGAGC0.094200.015300.569000.750001.000001.00000


Target Position: 3300, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3300CAAAAGUCUUUACCCCAUG70.13761794

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8973318CAAAAGTCTTTACCCCATGCATGGGGTAAAGACTTTTG0.200000.082300.491400.500000.989100.62500


Target Position: 2673, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2673ACUCACAUCAUUUGGCAGA71.99921597

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9262691ACTCACATCATTTGGCAGATCTGCCAAATGATGTGAGT0.093500.002200.482800.500001.000001.00000


Target Position: 2607, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2607GCUCUAGUCAUAAUUUAUG77.07271091

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8572625GCTCTAGTCATAATTTATGCATAAATTATGACTAGAGC0.093200.002600.698300.750001.000001.00000


Target Position: 755, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
755GUCCACAGGAAGAGGUUGA76.06461186

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
947773GTCCACAGGAAGAGGTTGATCAACCTCTTCCTGTGGAC0.097000.002500.594800.500000.951100.75000


Target Position: 765, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
765AGAGGUUGAACUAAAGAAG72.58531550

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
918783AGAGGTTGAACTAAAGAAGCTTCTTTAGTTCAACCTCT0.070200.019800.586200.500001.000001.00000


Target Position: 3468, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3468UCCUCCAACCCUACCCUUG51.65263397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9643486TCCTCCAACCCTACCCTTGCAAGGGTAGGGTTGGAGGA0.488200.530600.724100.500001.000001.00000


Target Position: 3499, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3499UUGUUCAUCCUUCAGAAUU63.66192465

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6393517TTGTTCATCCTTCAGAATTAATTCTGAAGGATGAACAA0.205400.059100.637900.500001.000001.00000


Target Position: 656, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
656UCAUAUUUAAGGGAAAAUC57.80862972

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
803674TCATATTTAAGGGAAAATCGATTTTCCCTTAAATATGA0.068100.054700.543100.500001.000001.00000


Target Position: 2562, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2562UUGCUUUUUUUUUUUUUUU59.08372867

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5512580TTGCTTTTTTTTTTTTTTTAAAAAAAAAAAAAAAGCAA0.226100.049600.646600.500001.000001.00000


Target Position: 956, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
956AGGAGAUUGACACACUGAU82.2202662

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
838974AGGAGATTGACACACTGATATCAGTGTGTCAATCTCCT0.040400.008300.663800.750001.000001.00000


Target Position: 2166, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2166CCCCAUUCUGCUUUAAAAA83.945552

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
2782184CCCCATTCTGCTTTAAAAATTTTTAAAGCAGAATGGGG0.291000.111700.991401.000001.000001.00000


Target Position: 2145, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2145AGCCCAGGCAACAUAGCAA86.2991397

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8262163AGCCCAGGCAACATAGCAATTGCTATGTTGCCTGGGCT0.168300.003100.706900.750000.951100.75000


Target Position: 1470, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1470GCCCCCUCAGUCUUCAGAU77.16851083

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4411488GCCCCCTCAGTCTTCAGATATCTGAAGACTGAGGGGGC0.161700.045800.819001.000001.000001.00000


Target Position: 3764, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3764CAUAUAUAACAUAUAUAUA108.1761

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3762-3784TACATATATAACATATATATATAUAUAUAUAUGUUAUAUAUGUACAUAUAUAACAUAUAUAUAUAU-6.4-6.411


Target Position: 1016, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1016GCUUGGUAAAAAAGGUUCA82.6441631

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8441034GCTTGGTAAAAAAGGTTCATGAACCTTTTTTACCAAGC0.038700.028600.629300.750001.000001.00000


Target Position: 2482, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2482UAAAAUUUAAGUAAGUAAA81.5537713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7142500TAAAATTTAAGTAAGTAAATTTACTTACTTAAATTTTA0.572000.492000.534500.500001.000001.00000


Target Position: 1006, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1006AAAAGGAAAGGCUUGGUAA85.6842427

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9751024AAAAGGAAAGGCTTGGTAATTACCAAGCCTTTCCTTTT0.036400.030500.465500.500001.000001.00000


Target Position: 2899, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2899GCCGAACACCAUUCUAAAC71.81061614

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3342917GCCGAACACCATTCTAAACGTTTAGAATGGTGTTCGGC0.234000.130300.853400.750000.989100.87500


Target Position: 2561, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2561UUUGCUUUUUUUUUUUUUU60.27092767

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9632579TTTGCTTTTTTTTTTTTTTAAAAAAAAAAAAAAGCAAA0.215600.044500.500000.500001.000001.00000


Target Position: 3482, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3482CCUUGUAUAGGUGACUUUU81.1863743

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3480-3502ACCCTTGTATAGGTGACTTTTGTAAAAGUCACCUAUACAAGGGUCCUUGUAUAGGUGACUUUUGUU19.211.633


Target Position: 3603, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3603CCCAUACAUUUCUUUCACA90.1776219

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5103621CCCATACATTTCTTTCACATGTGAAAGAAATGTATGGG0.744800.441200.784500.750001.000001.00000


Target Position: 2954, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2954UUGAGAGGUAGACAGAUAU74.9251292

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9042972TTGAGAGGTAGACAGATATATATCTGTCTACCTCTCAA0.061700.012500.603400.500001.000001.00000


Target Position: 955, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
955GAGGAGAUUGACACACUGA95.227385

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
870973GAGGAGATTGACACACTGATCAGTGTGTCAATCTCCTC0.213100.007800.586200.500001.000001.00000


Target Position: 1985, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1985UUCCUUCACAGCUGUUCUA73.06741493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8712003TTCCTTCACAGCTGTTCTATAGAACAGCTGTGAAGGAA0.515400.170100.500000.500001.000001.00000


Target Position: 2908, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2908CAUUCUAAACUAUUCAUAU96.09169

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5462926CATTCTAAACTATTCATATATATGAATAGTTTAGAATG0.462700.214100.612100.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2906-2928ACCATTCTAAACTATTCATATATAUAUGAAUAGUUUAGAAUGGUCAUUCUAAACUAUUCAUAUAUU8.76.932


Target Position: 2108, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2108AGGCGGGCGGAUCACUUGA71.60381640

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9582126AGGCGGGCGGATCACTTGATCAAGTGATCCGCCCGCCT0.050800.001100.620700.500000.978300.75000


Target Position: 1524, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1524CCCAUAGCUGUAAAACCAG69.31421885

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5461542CCCATAGCTGTAAAACCAGCTGGTTTTACAGCTATGGG0.110700.029500.706900.750000.907600.62500


Target Position: 2466, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2466AGCAAGACCCCAUCUCUAA87.0606355

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5342484AGCAAGACCCCATCTCTAATTAGAGATGGGGTCTTGCT0.287100.158100.819000.750000.929300.75000


Target Position: 995, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
995ACAGUAGAUUGAAAAGGAA91.7683174

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9111013ACAGTAGATTGAAAAGGAATTCCTTTTCAATCTACTGT0.026100.009800.534500.750001.000001.00000


Target Position: 2932, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2932AGUCAUUUAAUUCUUACAU78.8131931

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6772950AGTCATTTAATTCTTACATATGTAAGAATTAAATGACT0.162000.141700.551700.750001.000001.00000


Target Position: 1512, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1512UGAUCGUGUAGUCCCAUAG68.28512004

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6631530TGATCGTGTAGTCCCATAGCTATGGGACTACACGATCA0.224600.017200.551700.500001.000001.00000


Target Position: 2172, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2172UCUGCUUUAAAAAAAAAAA74.93011290

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3522190TCTGCTTTAAAAAAAAAAATTTTTTTTTTTAAAGCAGA0.956400.179100.724100.750001.000001.00000


Target Position: 2247, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2247GCUGAGGCACAAGAAUCAU81.5139718

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9332265GCTGAGGCACAAGAATCATATGATTCTTGTGCCTCAGC0.303300.001400.698301.000001.000001.00000


Target Position: 2652, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2652GCGCUAUAACUCUACCUAA99.766618

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4312670GCGCTATAACTCTACCTAATTAGGTAGAGTTATAGCGC0.290300.029400.887901.000001.000001.00000


Target Position: 2892, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2892CCAAACUGCCGAACACCAU76.1021183

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3002910CCAAACTGCCGAACACCATATGGTGTTCGGCAGTTTGG0.329100.130700.689701.000001.000001.00000


Target Position: 479, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
479GCGAGGAGGUGACCAGGGA80.8242778

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
771497GCGAGGAGGTGACCAGGGATCCCTGGTCACCTCCTCGC0.052900.024000.551700.750000.962001.00000


Target Position: 1262, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1262GUUCUCAAUGAAAAAUAGU74.72851311

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1260-1282TGGTTCTCAATGAAAAATAGTGTACUAUUUUUCAUUGAGAACCAGUUCUCAAUGAAAAAUAGUGUU-4.320.432


Target Position: 2152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2152GCAACAUAGCAAAACCCCA87.7757330

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7922170GCAACATAGCAAAACCCCATGGGGTTTTGCTATGTTGC0.583200.126800.508600.750000.994600.75000


Target Position: 2350, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2350GAAAAAAAAAAAAUUGAGU76.65161139

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9582368GAAAAAAAAAAAATTGAGTACTCAATTTTTTTTTTTTC0.264100.181700.465500.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2348-2370CAGAAAAAAAAAAAATTGAGTCAACUCAAUUUUUUUUUUUUCUGGAAAAAAAAAAAAUUGAGUCAU12.0-11.311


Target Position: 3306, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3306UCUUUACCCCAUGCCUUCU59.83142803

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8303324TCTTTACCCCATGCCTTCTAGAAGGCATGGGGTAAAGA0.254100.167700.500000.500001.000001.00000


Target Position: 3330, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3330CUCAUCUCAACCCCCUCAU65.88982243

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4033348CTCATCTCAACCCCCTCATATGAGGGGGTTGAGATGAG0.942500.792100.655200.750001.000001.00000


Target Position: 2080, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2080CCUAUAAUCCCAGCACUUU78.0673998

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7052098CCTATAATCCCAGCACTTTAAAGTGCTGGGATTATAGG0.072100.011700.844801.000000.994600.62500


Target Position: 1190, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1190CGGAAUUUACCUGAUUUCU74.51631325

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1188-1210AGCGGAATTTACCTGATTTCTTCAGAAAUCAGGUAAAUUCCGCUCGGAAUUUACCUGAUUUCUUCU16.314.232


Target Position: 1565, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1565GUCAGGAAUAUUGGGAAUG60.74212713

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9081583GTCAGGAATATTGGGAATGCATTCCCAATATTCCTGAC0.058000.009200.663800.500001.000001.00000


Target Position: 1181, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1181UCUCUGGAGCGGAAUUUAC60.79432710

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9281199TCTCTGGAGCGGAATTTACGTAAATTCCGCTCCAGAGA0.022100.001900.543100.500001.000001.00000


Target Position: 1910, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1910CCAUAAACUUCUCAGGAGU80.4248806

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9801928CCATAAACTTCTCAGGAGTACTCCTGAGAAGTTTATGG0.012000.004700.637900.750001.000001.00000


Target Position: 2662, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2662UCUACCUAAAGACUCACAU68.39591991

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6152680TCTACCTAAAGACTCACATATGTGAGTCTTTAGGTAGA0.176800.045400.569000.750001.000001.00000


Target Position: 2905, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2905CACCAUUCUAAACUAUUCA87.2809348

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8562923CACCATTCTAAACTATTCATGAATAGTTTAGAATGGTG0.470300.194400.569000.500001.000001.00000


Target Position: 3428, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3428UCCUGCUACUACCUCUGCU68.36871996

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8063446TCCTGCTACTACCTCTGCTAGCAGAGGTAGTAGCAGGA0.089100.028700.517200.500001.000001.00000


Target Position: 974, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
974UCCUGCCAGAAAAUUUCAA70.78191726

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
414992TCCTGCCAGAAAATTTCAATTGAAATTTTCTGGCAGGA0.253500.032000.724100.750001.000001.00000


Target Position: 3444, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3444GCUUGAACAGCUCCUCACC68.65881961

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8743462GCTTGAACAGCTCCTCACCGGTGAGGAGCTGTTCAAGC0.439800.088100.500000.500000.918500.62500


Target Position: 928, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
928ACAAUAGAGCAGUUUAUGA86.8029373

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
923946ACAATAGAGCAGTTTATGATCATAAACTGCTCTATTGT0.137300.082700.482800.500001.000001.00000


Target Position: 3704, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3704GAGCUUCUUUAUCUUGGUA94.2032105

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8153722GAGCTTCTTTATCTTGGTATACCAAGATAAAGAAGCTC0.044700.006700.629300.750001.000001.00000


Target Position: 1319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1319CCUUCUGUCUCUGUGGUUG69.09531911

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6681337CCTTCTGTCTCTGTGGTTGCAACCACAGAGACAGAAGG0.082100.058000.698300.750001.000001.00000


Target Position: 3152, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3152CCUCUUGUCCUCUGCCUCU75.88741199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5193170CCTCTTGTCCTCTGCCTCTAGAGGCAGAGGACAAGAGG0.612600.514300.620700.750001.000001.00000


Target Position: 1904, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1904AGCCAACCAUAAACUUCUC68.06112027

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7271922AGCCAACCATAAACTTCTCGAGAAGTTTATGGTTGGCT0.145100.021700.543100.500001.000001.00000


Target Position: 2496, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2496GUAAAAGUAGAUAAAUAAA96.984551

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4222514GTAAAAGTAGATAAATAAATTTATTTATCTACTTTTAC0.173600.065400.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2494-2516AAGTAAAAGTAGATAAATAAAAAUUUAUUUAUCUACUUUUACUUGUAAAAGUAGAUAAAUAAAAAU-7.54.921


Target Position: 2339, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2339ACUCCAUCUCAGAAAAAAA92.2414156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6382357ACTCCATCTCAGAAAAAAATTTTTTTCTGAGATGGAGT0.722300.010500.706900.750000.989100.62500


Target Position: 731, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
731UCAUGUUAAUUGGGAAAAA79.9568829

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
571749TCATGTTAATTGGGAAAAATTTTTCCCAATTAACATGA0.103300.037900.724100.750001.000001.00000


Target Position: 1871, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1871GGCACCAGAAUGAGUAAAG72.62381543

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4631889GGCACCAGAATGAGTAAAGCTTTACTCATTCTGGTGCC0.247100.025400.862100.750000.994600.62500


Target Position: 3472, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3472CCAACCCUACCCUUGUAUA85.9967412

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6213490CCAACCCTACCCTTGTATATATACAAGGGTAGGGTTGG0.092100.063900.801701.000000.989100.62500


Target Position: 1233, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1233CAUUUGCCAAUUUUCCUAC67.87522052

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9541251CATTTGCCAATTTTCCTACGTAGGAAAATTGGCAAATG0.132900.029300.474100.500001.000001.00000


Target Position: 2688, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2688CAGAGAGAGAGUCGUUGAA92.3674152

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8372706CAGAGAGAGAGTCGTTGAATTCAACGACTCTCTCTCTG0.040600.003000.612100.750001.000001.00000


Target Position: 1450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1450GGCCAGUUUCAGGUUUAUA90.1502221

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9071468GGCCAGTTTCAGGTTTATATATAAACCTGAAACTGGCC0.217400.001800.956901.000000.972800.75000


Target Position: 668, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
668GAAAAUCUCUGAAGGAAAU88.095308

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
666-688GGGAAAATCTCTGAAGGAAATGGAUUUCCUUCAGAGAUUUUCCCGAAAAUCUCUGAAGGAAAUGGU18.75.312


Target Position: 757, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
757CCACAGGAAGAGGUUGAAC66.68512168

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
725775CCACAGGAAGAGGTTGAACGTTCAACCTCTTCCTGTGG0.067000.015400.698300.750000.983700.62500


Target Position: 914, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
914GGAGAGUAAAAGCCACAAU86.9982359

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
425932GGAGAGTAAAAGCCACAATATTGTGGCTTTTACTCTCC0.197100.029900.862101.000001.000001.00000


Target Position: 3138, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3138UCUCUGAUUUUUUUCCUCU70.39761765

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8513156TCTCTGATTTTTTTCCTCTAGAGGAAAAAAATCAGAGA0.687600.525200.500000.500001.000001.00000


Target Position: 2923, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2923AUAUAUAUUAGUCAUUUAA90.9181199

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7802941ATATATATTAGTCATTTAATTAAATGACTAATATATAT0.188800.088500.508600.500001.000001.00000


Target Position: 3629, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3629CAUAGUCCAUGAUAGUUUA100.68114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5123647CATAGTCCATGATAGTTTATAAACTATCATGGACTATG0.129300.021500.620700.750001.000001.00000


Target Position: 3009, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3009GUCAUUAGCGCAAGGUUGU69.09191913

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8313027GTCATTAGCGCAAGGTTGTACAACCTTGCGCTAATGAC0.095200.014700.612100.500001.000001.00000


Target Position: 2147, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2147CCCAGGCAACAUAGCAAAA84.7947482

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4152165CCCAGGCAACATAGCAAAATTTTGCTATGTTGCCTGGG0.180400.036600.991401.000000.951101.00000


Target Position: 997, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
997AGUAGAUUGAAAAGGAAAG69.31491884

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8271015AGTAGATTGAAAAGGAAAGCTTTCCTTTTCAATCTACT0.042100.013300.569000.500001.000001.00000


Target Position: 903, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
903CAAACUUGAUAGGAGAGUA96.965852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
976921CAAACTTGATAGGAGAGTATACTCTCCTATCAAGTTTG0.047900.007600.465500.750001.000001.00000


Target Position: 2647, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2647CCUUUGCGCUAUAACUCUA92.6835142

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5212665CCTTTGCGCTATAACTCTATAGAGTTATAGCGCAAAGG0.121100.020500.672401.000001.000001.00000


Target Position: 3471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3471UCCAACCCUACCCUUGUAU58.40442925

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3273489TCCAACCCTACCCTTGTATATACAAGGGTAGGGTTGGA0.469000.493900.827600.750000.989100.62500


Target Position: 3191, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3191CUCUGCUCUAGUUCAUUUU75.53891231

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7103209CTCTGCTCTAGTTCATTTTAAAATGAACTAGAGCAGAG0.923600.006500.810300.750001.000001.00000


Target Position: 3017, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3017CGCAAGGUUGUAGAGUAAG67.44892108

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6543035CGCAAGGTTGTAGAGTAAGCTTACTCTACAACCTTGCG0.130500.009200.784500.750001.000001.00000


Target Position: 1943, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1943UCAAAGGCAUUUUUGUUAA77.79751024

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8451961TCAAAGGCATTTTTGTTAATTAACAAAAATGCCTTTGA0.190400.002900.689700.750000.994600.62500


Target Position: 2533, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2533AUGUGCUCAUCAUAAAGUA88.0063317

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9482551ATGTGCTCATCATAAAGTATACTTTATGATGAGCACAT0.406300.001200.474100.500001.000001.00000


Target Position: 3394, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3394UGCACUGCACCCUCUCCUG61.50082661

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9413412TGCACTGCACCCTCTCCTGCAGGAGAGGGTGCAGTGCA0.020300.002100.569000.500001.000001.00000


Target Position: 976, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
976CUGCCAGAAAAUUUCAAAG69.45681874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
732994CTGCCAGAAAATTTCAAAGCTTTGAAATTTTCTGGCAG0.200200.036800.646600.500001.000001.00000


Target Position: 2614, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2614UCAUAAUUUAUGCUUAAUA84.6916492

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3772632TCATAATTTATGCTTAATATATTAAGCATAAATTATGA0.302200.039900.681000.750001.000001.00000


Target Position: 2020, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2020UCCCCCACCCCCACCCCAU49.573498

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3582038TCCCCCACCCCCACCCCATATGGGGTGGGGGTGGGGGA0.652300.337100.715500.750001.000001.00000


Target Position: 3714, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3714AUCUUGGUAACAGCAUUAU67.84742054

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6373732ATCTTGGTAACAGCATTATATAATGCTGTTACCAAGAT0.308000.012400.637900.500001.000001.00000


Target Position: 917, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
917GAGUAAAAGCCACAAUAGA93.5884118

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
930935GAGTAAAAGCCACAATAGATCTATTGTGGCTTTTACTC0.475700.091700.586200.500001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
915-937GAGAGTAAAAGCCACAATAGAGCUCUAUUGUGGCUUUUACUCUCGAGUAAAAGCCACAAUAGAGCU11.64.922


Target Position: 806, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
806UGGAGAAGAUAGCUGACCA88.0923309

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
850824TGGAGAAGATAGCTGACCATGGTCAGCTATCTTCTCCA0.039900.007500.500000.500001.000001.00000


Target Position: 1510, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1510UGUGAUCGUGUAGUCCCAU72.30681572

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7981528TGTGATCGTGTAGTCCCATATGGGACTACACGATCACA0.202500.003700.551700.750001.000001.00000


Target Position: 766, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
766GAGGUUGAACUAAAGAAGU79.7133852

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
877784GAGGTTGAACTAAAGAAGTACTTCTTTAGTTCAACCTC0.089600.015000.603400.500001.000001.00000


Target Position: 2953, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2953CUUGAGAGGUAGACAGAUA96.931654

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5712971CTTGAGAGGTAGACAGATATATCTGTCTACCTCTCAAG0.335700.084800.594800.750001.000001.00000


Target Position: 2493, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2493UAAGUAAAAGUAGAUAAAU77.92771008

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7442511TAAGTAAAAGTAGATAAATATTTATCTACTTTTACTTA0.081900.065700.525900.500001.000001.00000


Target Position: 414, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
414GGCGACCCAGGGCGAAGAG59.86122798

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
877432GGCGACCCAGGGCGAAGAGCTCTTCGCCCTGGGTCGCC0.049500.002200.689700.750000.956500.62500


Target Position: 2176, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2176CUUUAAAAAAAAAAAAAAA84.7066488

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4692194CTTTAAAAAAAAAAAAAAATTTTTTTTTTTTTTTAAAG0.961700.809200.637900.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2174-2196TGCTTTAAAAAAAAAAAAAAAAAUUUUUUUUUUUUUUUAAAGCACUUUAAAAAAAAAAAAAAAAAU-11.3-9.100


Target Position: 2947, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2947ACAUAACUUGAGAGGUAGA85.1131469

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9242965ACATAACTTGAGAGGTAGATCTACCTCTCAAGTTATGT0.108000.035600.482800.500001.000001.00000


Target Position: 3461, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3461CCUUCCUUCCUCCAACCCU67.59812088

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8823479CCTTCCTTCCTCCAACCCTAGGGTTGGAGGAAGGAAGG0.739000.690900.500000.750001.000001.00000


Target Position: 2633, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2633ACAUUGAUAGUAGCCCUUU72.10381583

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9732651ACATTGATAGTAGCCCTTTAAAGGGCTACTATCAATGT0.012900.002900.706900.750001.000001.00000


Target Position: 2478, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2478UCUCUAAAAUUUAAGUAAG69.31371886

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8912496TCTCTAAAATTTAAGTAAGCTTACTTAAATTTTAGAGA0.547200.334300.586200.500001.000001.00000


Target Position: 3850, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3850CUCAAUAAAUAUUUGGAGA84.4691509

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8003868CTCAATAAATATTTGGAGATCTCCAAATATTTATTGAG0.047000.046800.586200.500001.000001.00000


Target Position: 3712, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3712UUAUCUUGGUAACAGCAUU73.59281432

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7413730TTATCTTGGTAACAGCATTAATGCTGTTACCAAGATAA0.322200.014300.525900.500001.000001.00000


Target Position: 1940, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1940CCUUCAAAGGCAUUUUUGU75.45111238

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8711958CCTTCAAAGGCATTTTTGTACAAAAATGCCTTTGAAGG0.069100.002300.637900.750000.989100.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1938-1960TTCCTTCAAAGGCATTTTTGTTAACAAAAAUGCCUUUGAAGGAACCUUCAAAGGCAUUUUUGUUAU-3.312.222


Target Position: 2626, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2626CUUAAUAACAUUGAUAGUA85.7293425

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2624-2646TGCTTAATAACATTGATAGTAGCUACUAUCAAUGUUAUUAAGCACUUAAUAACAUUGAUAGUAGCU20.3-7.533


Target Position: 540, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
540CAAUGAGAAGCACGACCUU84.8611479

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
811558CAATGAGAAGCACGACCTTAAGGTCGTGCTTCTCATTG0.050700.005300.508600.750001.000001.00000


Target Position: 1297, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1297GUAAAGCUCCUAUCUGUUU80.4684805

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7141315GTAAAGCTCCTATCTGTTTAAACAGATAGGAGCTTTAC0.119200.006300.681000.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
1295-1317GAGTAAAGCTCCTATCTGTTTTCAAACAGAUAGGAGCUUUACUCGUAAAGCUCCUAUCUGUUUUCU19.218.322


Target Position: 3362, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3362GCUGUCAGCCACUCUUCUU82.4359652

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5293380GCTGTCAGCCACTCTTCTTAAGAAGAGTGGCTGACAGC0.587100.017200.715501.000001.000001.00000


Target Position: 2916, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2916ACUAUUCAUAUAUAUUAGU75.65981222

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8272934ACTATTCATATATATTAGTACTAATATATATGAATAGT0.134400.133300.500000.500001.000001.00000


Target Position: 3018, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3018GCAAGGUUGUAGAGUAAGC70.54751751

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8253036GCAAGGTTGTAGAGTAAGCGCTTACTCTACAACCTTGC0.120400.008400.500000.500001.000001.00000


Target Position: 2556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2556AGUGGUUUGCUUUUUUUUU73.59161433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7772574AGTGGTTTGCTTTTTTTTTAAAAAAAAAGCAAACCACT0.079900.004300.706900.750001.000001.00000


Target Position: 666, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
666GGGAAAAUCUCUGAAGGAA93.7567114

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
960684GGGAAAATCTCTGAAGGAATTCCTTCAGAGATTTTCCC0.015700.003000.819001.000001.000001.00000


Target Position: 3802, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3802CAUAUAUAACAAGCAUAAC76.14761179

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8763820CATATATAACAAGCATAACGTTATGCTTGTTATATATG0.045000.009400.508600.500001.000001.00000


Target Position: 2889, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2889GCACCAAACUGCCGAACAC77.1191087

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6532907GCACCAAACTGCCGAACACGTGTTCGGCAGTTTGGTGC0.181100.042800.560300.750000.934800.62500


Target Position: 2646, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2646CCCUUUGCGCUAUAACUCU74.89981296

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6552664CCCTTTGCGCTATAACTCTAGAGTTATAGCGCAAAGGG0.086300.013700.767200.750001.000001.00000


Target Position: 3130, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3130AGGCCCAUUCUCUGAUUUU75.30061250

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4723148AGGCCCATTCTCTGATTTTAAAATCAGAGAATGGGCCT0.544900.045300.844800.750001.000001.00000


Target Position: 3845, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3845AAGACCUCAAUAAAUAUUU72.92171507

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9773863AAGACCTCAATAAATATTTAAATATTTATTGAGGTCTT0.261100.002000.637900.500001.000001.00000


Target Position: 822, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
822CCAGCUGGAAGAGUUGAAU76.76911126

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
926840CCAGCTGGAAGAGTTGAATATTCAACTCTTCCAGCTGG0.022500.001900.836201.000001.000001.00000


Target Position: 3081, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3081GUGCUUUUCCCCUCUACUG68.64761962

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8653099GTGCTTTTCCCCTCTACTGCAGTAGAGGGGAAAAGCAC0.216700.039800.508600.500001.000001.00000


Target Position: 2818, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2818GUUCACUAUUGAUCUAUUU84.3442517

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6952836GTTCACTATTGATCTATTTAAATAGATCAATAGTGAAC0.109900.007400.646600.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2816-2838TGGTTCACTATTGATCTATTTTTAAAUAGAUCAAUAGUGAACCAGUUCACUAUUGAUCUAUUUUUU6.620.322


Target Position: 967, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
967ACACUGAUCCUGCCAGAAA85.5917433

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
627985ACACTGATCCTGCCAGAAATTTCTGGCAGGATCAGTGT0.212400.011100.706900.750000.956500.75000


Target Position: 2610, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2610CUAGUCAUAAUUUAUGCUU75.9351197

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2608-2630CTCTAGTCATAATTTATGCTTAAAAGCAUAAAUUAUGACUAGAGCUAGUCAUAAUUUAUGCUUAAU19.720.322


Target Position: 1460, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1460AGGUUUAUAGGCCCCCUCA77.92951007

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9591478AGGTTTATAGGCCCCCTCATGAGGGGGCCTATAAACCT0.028900.005200.620700.500000.923900.62500


Target Position: 3857, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3857AAUAUUUGGAGAACAAAAA82.8091620

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7863875AATATTTGGAGAACAAAAATTTTTGTTCTCCAAATATT0.669600.041900.508600.500001.000001.00000


Target Position: 3376, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3376UUCUUUCAGGUCCUCAGAU66.25732216

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9273394TTCTTTCAGGTCCTCAGATATCTGAGGACCTGAAAGAA0.166900.074300.491400.500001.000001.00000


Target Position: 2698, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2698GUCGUUGAAGUCCCAGGAA81.6174704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9082716GTCGTTGAAGTCCCAGGAATTCCTGGGACTTCAACGAC0.027000.010400.646600.750001.000001.00000


Target Position: 2253, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2253GCACAAGAAUCAUUUGAAC79.5156874

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6792271GCACAAGAATCATTTGAACGTTCAAATGATTCTTGTGC0.112200.008100.706900.750001.000001.00000


Target Position: 1875, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1875CCAGAAUGAGUAAAGCAGG67.69112074

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8521893CCAGAATGAGTAAAGCAGGCCTGCTTTACTCATTCTGG0.248200.147800.500000.500001.000001.00000


Target Position: 2743, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2743AGACAAGGUAGUAGAGGUA91.2138189

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6982761AGACAAGGTAGTAGAGGTATACCTCTACTACCTTGTCT0.087100.019700.543100.750001.000001.00000


Target Position: 3621, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3621AGCAUUUACAUAGUCCAUG62.32032585

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7443639AGCATTTACATAGTCCATGCATGGACTATGTAAATGCT0.060900.046700.698300.500001.000001.00000


Target Position: 2341, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2341UCCAUCUCAGAAAAAAAAA72.03311591

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
3262359TCCATCTCAGAAAAAAAAATTTTTTTTTCTGAGATGGA0.921900.272600.870700.750001.000001.00000


Target Position: 623, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
623AGGUCAUAGGGGUUCCACA87.2646350

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
782641AGGTCATAGGGGTTCCACATGTGGAACCCCTATGACCT0.070300.012700.637900.500000.967400.62500


Target Position: 3278, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3278AAUGGCUCACUUUCUCUUU73.09321489

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8163296AATGGCTCACTTTCTCTTTAAAGAGAAAGTGAGCCATT0.670800.079700.508600.500001.000001.00000


Target Position: 796, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
796GAGAAGUCUGUGGAGAAGA84.6112496

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
972814GAGAAGTCTGTGGAGAAGATCTTCTCCACAGACTTCTC0.058700.004700.586200.500001.000001.00000


Target Position: 67, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
67GGGCGGUCAACAAGUGCGG57.59972992

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
79285GGGCGGTCAACAAGTGCGGCCGCACTTGTTGACCGCCC0.069800.003900.577600.500001.000001.00000


Target Position: 637, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
637CCACAGUCUUUUCAGAAAC71.17181686

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
976655CCACAGTCTTTTCAGAAACGTTTCTGAAAAGACTGTGG0.012700.003400.698300.750000.967400.87500


Target Position: 5, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
5CGGGGCGGGGCUGGGAAGU48.01253574

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
95123CGGGGCGGGGCTGGGAAGTACTTCCCAGCCCCGCCCCG0.017300.001400.706900.750001.000001.00000


Target Position: 3263, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3263UGCUUAGAACCCUCCAAUG65.27442303

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5933281TGCTTAGAACCCTCCAATGCATTGGAGGGTTCTAAGCA0.104300.033500.698300.500000.913000.62500


Target Position: 450, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
450GGUGACCCGGGACGAGGAG59.3522839

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978468GGTGACCCGGGACGAGGAGCTCCTCGTCCCGGGTCACC0.012300.001600.543100.750000.913000.87500


Target Position: 1515, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1515UCGUGUAGUCCCAUAGCUG68.52271978

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7881533TCGTGTAGTCCCATAGCTGCAGCTATGGGACTACACGA0.079000.024500.508600.500001.000001.00000


Target Position: 3158, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3158GUCCUCUGCCUCUCCCUCU70.2871779

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5813176GTCCTCTGCCTCTCCCTCTAGAGGGAGAGGCAGAGGAC0.812300.512200.594800.500001.000001.00000


Target Position: 1426, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1426UGGUGAGAGCUCUAAUUUG73.57291438

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9011444TGGTGAGAGCTCTAATTTGCAAATTAGAGCTCTCACCA0.028700.002900.698300.500001.000001.00000


Target Position: 555, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
555CCUUCAUGUUACCUCCCAG78.6249949

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
639573CCTTCATGTTACCTCCCAGCTGGGAGGTAACATGAAGG0.189900.039000.560300.750001.000001.00000


Target Position: 412, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
412GAGGCGACCCAGGGCGAAG63.34952493

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
975430GAGGCGACCCAGGGCGAAGCTTCGCCCTGGGTCGCCTC0.022900.001000.672400.500000.940200.75000


Target Position: 374, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
374AGGAAGCGACCUGGAGUGA71.56841646

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
915392AGGAAGCGACCTGGAGTGATCACTCCAGGTCGCTTCCT0.030100.003100.620700.500000.923900.62500


Target Position: 2935, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2935CAUUUAAUUCUUACAUAAC80.1804815

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7942953CATTTAATTCTTACATAACGTTATGTAAGAATTAAATG0.140400.104900.508600.500001.000001.00000


Target Position: 756, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
756UCCACAGGAAGAGGUUGAA71.58771642

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
646774TCCACAGGAAGAGGTTGAATTCAACCTCTTCCTGTGGA0.087700.019200.698300.750000.951100.75000


Target Position: 2471, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2471GACCCCAUCUCUAAAAUUU84.5569501

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4382489GACCCCATCTCTAAAATTTAAATTTTAGAGATGGGGTC0.440400.205400.819000.750001.000001.00000


Target Position: 3494, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3494GACUUUUGUUCAUCCUUCA92.726141

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7943512GACTTTTGTTCATCCTTCATGAAGGATGAACAAAAGTC0.468100.072700.594800.500001.000001.00000


Target Position: 551, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
551ACGACCUUCAUGUUACCUC59.77572807

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
978569ACGACCTTCATGTTACCTCGAGGTAACATGAAGGTCGT0.115900.030100.465500.500001.000001.00000


Target Position: 3506, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3506UCCUUCAGAAUUCAACUCA70.60831742

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9463524TCCTTCAGAATTCAACTCATGAGTTGAATTCTGAAGGA0.161700.035000.646600.500001.000001.00000


Target Position: 3319, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3319CCUUCUCCCAUCUCAUCUC69.22441900

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7173337CCTTCTCCCATCTCATCTCGAGATGAGATGGGAGAAGG0.856800.771600.534500.750001.000001.00000


Target Position: 2912, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2912CUAAACUAUUCAUAUAUAU89.7624239

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4992930CTAAACTATTCATATATATATATATATGAATAGTTTAG0.687000.344400.629300.750001.000001.00000

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
2910-2932TTCTAAACTATTCATATATATTAAUAUAUAUGAAUAGUUUAGAACUAAACUAUUCAUAUAUAUUAU-6.46.622


Target Position: 3167, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3167CUCUCCCUCUAGCUCCCAC64.79792346

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7603185CTCTCCCTCTAGCTCCCACGTGGGAGCTAGAGGGAGAG0.606300.557700.517200.500001.000001.00000


Target Position: 3321, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3321UUCUCCCAUCUCAUCUCAA76.84881117

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8833339TTCTCCCATCTCATCTCAATTGAGATGAGATGGGAGAA0.854000.788100.525900.500001.000001.00000


Target Position: 723, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
723UUGCCGGGUCAUGUUAAUU61.60582651

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
899741TTGCCGGGTCATGTTAATTAATTAACATGACCCGGCAA0.094600.002100.637900.500001.000001.00000


Target Position: 907, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
907CUUGAUAGGAGAGUAAAAG69.46651872

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
834925CTTGATAGGAGAGTAAAAGCTTTTACTCTCCTATCAAG0.095900.017200.500000.500001.000001.00000


Target Position: 1556, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1556UUGCACCUAGUCAGGAAUA70.97621704

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9691574TTGCACCTAGTCAGGAATATATTCCTGACTAGGTGCAA0.106900.001100.603400.500000.956501.00000


Target Position: 2863, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2863CACAACAUUUAAUGAGAAG74.65271316

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7462881CACAACATTTAATGAGAAGCTTCTCATTAAATGTTGTG0.212600.013600.655200.500001.000001.00000


Target Position: 3744, Predicted by: Biltr, Ernai, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3744CUUGUAAUAUAGUUAUAUU95.613178

Browse Ernai result
QueryIDQuerySubIDPositionLength[nt]SequenceSpecificity[Abs]EfficiencyScoreIntendedGeneIntendedTxnIntendedTxnHitsOtherGeneOtherTxnOthertTxnHitsLocationLowComplexRegionsCANRepeatsHomology
seqseq_10374419CTTGTAATATAGTTATATT1/1/0/096.22BAG1NM_004323.41NANANA9:33252580..33252598(-)00BAG1(0.002)

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3742-3764AACTTGTAATATAGTTATATTACAAUAUAACUAUAUUACAAGUUCUUGUAAUAUAGUUAUAUUACU1.16.922


Target Position: 801, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
801GUCUGUGGAGAAGAUAGCU77.92041010

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
977819GTCTGTGGAGAAGATAGCTAGCTATCTTCTCCACAGAC0.026700.006000.465500.500001.000001.00000


Target Position: 3814, Predicted by: Biltr, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3814GCAUAACUUGUUAUAUAGU86.1527405

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
3812-3834AAGCATAACTTGTTATATAGTCTACUAUAUAACAAGUUAUGCUUGCAUAACUUGUUAUAUAGUCUU-0.811.613


Target Position: 642, Predicted by: Biltr, Rnaxs, Sidirect

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
642GUCUUUUCAGAAACUCAUA89.0949272

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
774660GTCTTTTCAGAAACTCATATATGAGTTTCTGAAAAGAC0.304900.004500.775900.750000.967400.62500

Browse Sidirect result
target positiontarget sequenceRNA oligo, guidepassengerfunctional siRNA selectionseed-duplex stabilty (Tm), guidepassengermin. number of mismatches against off-targets, guidepassenger
640-662CAGTCTTTTCAGAAACTCATATTUAUGAGUUUCUGAAAAGACUGGUCUUUUCAGAAACUCAUAUUU19.214.822


Target Position: 3772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3772ACAUAUAUAUAUAUAACAU96.335264

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7343790ACATATATATATATAACATATGTTATATATATATATGT0.102000.005700.551700.750001.000001.00000


Target Position: 1849, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1849GGAUUAGGAAGGGCAAAGA84.2149526

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
4611867GGATTAGGAAGGGCAAAGATCTTTGCCCTTCCTAATCC0.148400.067500.646600.750001.000001.00000


Target Position: 721, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
721GGUUGCCGGGUCAUGUUAA89.2006268

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
906739GGTTGCCGGGTCATGTTAATTAACATGACCCGGCAACC0.154300.001800.819001.000001.000001.00000


Target Position: 2243, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2243GGAGGCUGAGGCACAAGAA93.7583113

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9802261GGAGGCTGAGGCACAAGAATTCTTGTGCCTCAGCCTCC0.025000.001000.698301.000001.000001.00000


Target Position: 772, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
772GAACUAAAGAAGUUGAAAC79.9968825

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
775790GAACTAAAGAAGTTGAAACGTTTCAACTTCTTTAGTTC0.088200.015500.525900.500000.972800.62500


Target Position: 3769, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3769AUAACAUAUAUAUAUAUAA97.422941

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8703787ATAACATATATATATATAATTATATATATATATGTTAT0.033700.003500.508600.500001.000001.00000


Target Position: 648, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
648UCAGAAACUCAUAUUUAAG71.42131663

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
605666TCAGAAACTCATATTTAAGCTTAAATATGAGTTTCTGA0.117200.020300.586200.500001.000001.00000


Target Position: 3276, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3276CCAAUGGCUCACUUUCUCU79.9416833

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
5043294CCAATGGCTCACTTTCTCTAGAGAAAGTGAGCCATTGG0.659600.071800.620700.750001.000001.00000


Target Position: 2342, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2342CCAUCUCAGAAAAAAAAAA89.9096227

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
802360CCATCTCAGAAAAAAAAAATTTTTTTTTTCTGAGATGG0.913700.353900.844801.000001.000001.00000


Target Position: 687, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
687GGAAACACCGUUGUCAGCA80.4685804

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
967705GGAAACACCGTTGTCAGCATGCTGACAACGGTGTTTCC0.023200.001100.517200.750000.902200.62500


Target Position: 2674, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2674CUCACAUCAUUUGGCAGAG66.87092156

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8972692CTCACATCATTTGGCAGAGCTCTGCCAAATGATGTGAG0.030400.012900.500000.500001.000001.00000


Target Position: 1516, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1516CGUGUAGUCCCAUAGCUGU82.5778636

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6601534CGTGTAGTCCCATAGCTGTACAGCTATGGGACTACACG0.084700.025100.569000.750001.000001.00000


Target Position: 3197, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3197UCUAGUUCAUUUUCUUUAG65.91272241

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7393215TCTAGTTCATTTTCTTTAGCTAAAGAAAATGAACTAGA0.085400.005500.551700.500001.000001.00000


Target Position: 1994, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1994AGCUGUUCUAUCCAUUUUG67.87222053

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8132012AGCTGTTCTATCCATTTTGCAAAATGGATAGAACAGCT0.048100.018800.706900.500001.000001.00000


Target Position: 2675, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2675UCACAUCAUUUGGCAGAGA73.58511435

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
8672693TCACATCATTTGGCAGAGATCTCTGCCAAATGATGTGA0.034300.013800.500000.500001.000001.00000


Target Position: 1372, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1372CACCUCUGCCCAAAUUUUC63.16712512

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
7181390CACCTCTGCCCAAATTTTCGAAAATTTGGGCAGAGGTG0.151700.010300.620700.500001.000001.00000


Target Position: 2961, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
2961GUAGACAGAUAUCCUUAUU85.7415423

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
9302979GTAGACAGATATCCTTATTAATAAGGATATCTGTCTAC0.021600.001600.672400.750000.940200.75000


Target Position: 3628, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
3628ACAUAGUCCAUGAUAGUUU80.6092793

Browse Rnaxs result
RANKPosTarget_sequencesiRNA_sequenceAcc_8Acc_16Asy_EAsy_SSelfFldFreeEnd
6033646ACATAGTCCATGATAGTTTAAACTATCATGGACTATGT0.095100.023400.706900.750001.000001.00000


Target Position: 1872, Predicted by: Biltr, Rnaxs

Go to Top

Browse Biltr result
PositionsiRNAknockdown_efficacyRank
1872GCACCAGAAUGAGUAAAGC69.87531820

Browse Rnaxs result